Fermented lactobacillus mucus with antibacterial and antioxidant activity, method and application thereof

Abstract

The application discloses a fermentation Lactobacillus muciadegradus with bacteriostatic and antioxidant activities and a method and application thereof. The strain is preserved under the number of CGMCC No. 38829 and named as Lactobacillus muciadegradus Limosilactobacillus fermentum JGSLF005. The fermentation of the strain has the characteristics of high production of bacteriocin, exopolysaccharide, organic acid, total phenol and free radical scavenging activity, and has good antibacterial and antioxidant activities and high β -glucosidase activity, and has significant inhibitory effect on Escherichia coli, Salmonella typhi, Staphylococcus aureus and Listeria monocytogenes. The application uses the fermentation Lactobacillus muciadegradus to ferment dry asparagus extraction liquid, prepares fermentation liquid rich in antioxidant and antibacterial, loads the fermentation liquid on fiber paper by taking nanocellulose as a carrier, and prepares degradable preservative paper, which can be applied to asparagus preservation and can effectively prolong the shelf life.

Description

Technical Field

[0001] This invention belongs to the field of microbial and biological fruit and vegetable packaging and preservation technology, and relates to a fermentation lactobacillus with antibacterial and antioxidant activity and its preparation and application in biodegradable antibacterial preservation paper. Background Technology

[0002] 1. Asparagus, considered the king of vegetables with both medicinal and edible uses, is a highly respiratory vegetable with a water content exceeding 90%. As a seasonal vegetable, asparagus undergoes vigorous respiration and metabolism after harvest, making it prone to water loss, chlorophyll degradation, and microbial contamination, resulting in a short shelf life and rapid quality deterioration. This characteristic directly leads to oversupply and low prices during peak production seasons, while undersupply and high prices occur during off-seasons, severely restricting the large-scale and stable development of the industry. Therefore, utilizing scientific storage and preservation technologies to delay post-harvest quality decline and extend shelf life of asparagus, thereby regulating market supply and demand balance and ensuring industry profitability, is of significant practical importance for promoting the high-quality development of the asparagus industry.

[0003] 2. Asparagus is primarily sold fresh, and processing this product generates approximately 75% byproducts, mainly including leaves, old stems, and scraps. Currently, most of these byproducts are discarded directly, resulting in resource waste and environmental pollution risks. It is worth noting that the nutritional value of asparagus byproducts is comparable to, or even higher than, that of edible tender stems, thus giving them greater potential for deep processing and promising prospects for resource utilization. Therefore, achieving efficient resource utilization of asparagus byproducts is a crucial issue that urgently needs to be addressed to promote the healthy development of the asparagus industry.

[0004] 3. Currently, fruit and vegetable preservation technologies encompass three categories: physical, chemical, and biological. Existing research often employs multi-technology synergistic preservation strategies, but industrialization still faces numerous shortcomings. Traditional treatments such as fumigation, plant essential oil coating, and spraying easily alter the natural flavor of fruits and vegetables, exhibiting particularly significant limitations in ready-to-eat fresh produce. Chemical preservatives also pose risks such as excessive residues on the surface of fruits and vegetables and difficulties in ensuring food safety. To address these issues, researchers are focusing on the development of functional slow-release preservation substrates: some studies utilize electrospinning processes to prepare slow-release films through blending or post-impregnation loading of antibacterial components, but this material has high production costs, poor mechanical strength, and is easily damaged during storage and transportation; other studies achieve antibacterial slow release by immobilizing copper-based MOFs on modified cellulose paper and loading plant essential oils, but this system not only poses food safety risks due to the metal carrier but also risks that excessive essential oil volatilization can interfere with the original flavor of fruits and vegetables. In addition, existing studies mostly involve directly spraying or soaking the lactic acid bacteria fermentation liquid. Although this has a certain preservation effect, the fermentation liquid itself has an odor, and the active antibacterial substances are released instantaneously and have a short duration of effect.

[0005] 4. Currently, asparagus preservation mainly relies on physical preservation methods such as low-temperature storage, and industrial production generally depends on low-temperature cold chain systems. Although there have been relevant studies on preservation methods such as fumigation, coating with plant essential oils, and spraying, their large-scale industrialization is significantly limited by issues such as flavor interference and chemical residues. Summary of the Invention

[0006] To address the problems existing in the background art, the present invention provides a fermenting Lactobacillus mucinus with antibacterial and antioxidant activities and its application in the preparation of biodegradable antibacterial preservation paper.

[0007] The technical problems solved by this invention include: 1. Utilize the fermentation of asparagus processing by-products to prepare natural antibacterial agents, thereby realizing the resource utilization of by-products and solving the problems of waste and environmental pollution.

[0008] 2. No chemical preservatives or plant essential oils are added. It relies on the antibacterial metabolites of fermented Lactobacillus mucilage to overcome the shortcomings of traditional preservatives, such as residues, deterioration of fruit and vegetable flavors due to essential oils, and the fact that direct spraying of the original liquid has a fast effect but a short preservation period. It also relies on nanocellulose to achieve long-term sustained release of antibacterial components.

[0009] 3. Biodegradable preservation paper is prepared using nanocellulose substrate, which avoids the shortcomings of electrospun film such as high cost, poor mechanical properties, and poor safety of MOF carrier. It reduces the dependence of asparagus preservation on cold chain, delays post-harvest quality deterioration, and extends shelf life.

[0010] The technical solution adopted in this invention is: 1. This invention uses asparagus processing byproducts as raw materials, sequentially subjecting them to microwave-heat pump drying and ultrasonic extraction to obtain an extract rich in polyphenols, flavonoids, and other active ingredients. After being supplemented with a carbon source, the extract is inoculated with *Lactobacillus fermentans* for liquid fermentation. The resulting fermentation broth retains the inherent antioxidant active substances (polyphenols, flavonoids, etc.) of the raw materials and also generates bio-derived antibacterial metabolites such as bacteriocins, organic acids, and extracellular polysaccharides. These complex metabolites exhibit excellent antibacterial activity against common putrefactive and pathogenic bacteria such as *Staphylococcus aureus*, *Escherichia coli*, *Salmonella*, and *Listeria monocytogenes*. Using this fermentation product as a functional antibacterial raw material to prepare bio-based preservative paper enables the high-value utilization of asparagus byproducts.

[0011] 2. Using virgin cellulose paper (AP) as the substrate, carboxymethyl groups are introduced into the cellulose molecular chain through carboxymethylation modification to obtain carboxymethyl cellulose paper (CMAP), providing numerous binding sites for the subsequent nanocellulose and chitosan composite system. CMAP is immersed in a nanocellulose-chitosan blend dispersion, and a cross-linked composite fiber network is constructed on the CMAP surface via in-situ deposition. It is then dried and cured at low temperature to enhance the adhesion of the surface composite network. This invention preferably uses an intermittent vacuum negative pressure impregnation process to load the fermentation products (point 1). Compared to room temperature and pressure impregnation, vacuum negative pressure can expel air trapped in the pores of the nanocellulose-chitosan cross-linked network. The pressure difference drives the fermentation broth containing probiotics, polyphenols, and antibacterial metabolites to uniformly penetrate the entire paper layer, improving the loading and distribution uniformity of functional active substances. By controlling the low vacuum degree, segmented pressure holding, and slow pressure release process, sudden pressure changes can avoid damaging the carboxymethyl cellulose paper substrate and surface composite fiber network, achieving efficient immobilization of antibacterial functional components while ensuring the integrity of the paper structure.

[0012] The specific technical solution of the present invention is as follows: I. A strain of fermenting *Lactobacillus mucilaginosus* with antibacterial and antioxidant activity: The fermenting *Lactobacillus* was identified as *Lactobacillus fermentatus* JGSLF005, and named *Lactobacillus fermentatus*. Limosilactobacillus fermentum It is deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 21, 2026, with accession number CGMCC No. 38829.

[0013] II. A method for preparing fermentation broth for fermenting Lactobacillus mucilaginosus: The fermentation base liquid was obtained by using the infusion liquid of dried asparagus by-products as the fermentation base liquid, adding the fermenting mucinous lactobacillus for fermentation, and then concentrating the fermentation liquid at low temperature after the post-fermentation was completed.

[0014] The dried asparagus by-products were obtained through the following processing: Cut the asparagus stems and other byproducts from dried asparagus into 5-7cm sections, blanch them at 90-100℃ for 1-3 minutes, drain the water, and then perform intermittent heat pump drying at a microwave power of 300-400w and a heat pump temperature of 40-55℃ for 5-8 hours to achieve a moisture content of 8-12%. After pulverizing, obtain powder, seal and store in a light-proof container for later use.

[0015] The extract of the dried asparagus by-product is obtained by processing the dried asparagus by-product in the following manner: D1. Add the dried asparagus by-product to a food-grade ethanol aqueous solution with a volume fraction of 40%~60%. The ratio of dried asparagus by-product to ethanol aqueous solution is 1:15~1:25 g / mL. The ultrasonic power is 200~300 W, the extraction temperature is 40~50℃, and the ultrasonic time is 30~60 min. After extraction, centrifuge at 4000 r / min for 10 min, collect the supernatant, and filter to obtain the filter residue. D2. Repeat step D1 above to extract the filter residue once more, and combine the supernatants obtained from the two treatments to obtain the crude extract.

[0016] The fermentation temperature is 30~37℃ and the time is 24~48h. After the fermentation is completed, the fermentation liquid is concentrated by low-temperature vacuum rotary evaporation at 40-60℃ with a vacuum degree of -0.06~-0.08MPa, so that the solid content of the fermentation liquid is 6%~10%.

[0017] The percentage of solids content (6%~10%) is a mass fraction (mass percentage), calculated as: w = M solids / m total mass of fermentation broth * 100%, representing the ratio of the mass of solid matter to the total mass of the system.

[0018] This invention changes the traditional methods of preserving fruits and vegetables, such as spraying, coating, and electrospinning (which are expensive). Instead, it prepares biodegradable and antibacterial preservation paper, which can degrade without leaving any residue. This results in extended shelf life, expanded sales radius, and improved comprehensive utilization of by-products.

[0019] III. A fermentation broth, prepared using the above method, is an antibacterial and antioxidant fermentation broth.

[0020] The application of the fermented *Lactobacillus mucinus* or fermentation broth in the preparation of biodegradable preservation packaging, and its application in inhibiting bacteria and resisting oxidation against *Escherichia coli*, *Salmonella typhi*, *Staphylococcus aureus*, and *Listeria monocytogenes*.

[0021] The preservation method refers to the preservation of fruits and vegetables, and the fruits and vegetables may be asparagus.

[0022] IV. A method for preserving fruits and vegetables using fermentation liquid: Modified fiber paper is prepared by in-situ deposition molding of nanocellulose-chitosan blend liquid as a carrier. The fiber paper is first soaked in nanocellulose carrier to obtain nanocellulose-chitosan / CMAP composite cellulose paper. Then, the nanocellulose-chitosan / CMAP composite cellulose paper is soaked in the concentrated fermentation liquid. The concentrated fermentation liquid is loaded onto the fiber paper, and after drying, a biodegradable and antibacterial preservation paper is obtained, which is used in the preservation of fruits and vegetables.

[0023] The nanocellulose carrier is specifically: Using virgin cellulose paper AP as a substrate, carboxymethyl groups were introduced into the cellulose molecular chain through carboxymethylation modification to obtain carboxymethyl cellulose paper CMAP; carboxymethyl cellulose paper CMAP provides a large number of binding sites for subsequent in-situ growth of nanocellulose-chitosan.

[0024] The specific carboxymethylation modification treatment is as follows: S1. Prepare 150 mL of a water / isopropanol mixed solvent with a volume ratio of 1:4 to 1:5, immerse the virgin cellulose paper in it, and slowly add 15 mL of a 20% sodium hydroxide solution while stirring. Stir and alkalize at 25°C for 1.5 to 2 hours. S2, then add 3.0 g sodium chloroacetate, and stir at 50°C for 3-4 h for etherification reaction; S3. After removing the paper, it is first thoroughly neutralized and washed with deionized water, then washed three times with food-grade anhydrous ethanol, and dried in a ventilated room at room temperature to obtain carboxymethyl cellulose paper (CMAP) without harmful residues.

[0025] The nanocellulose-chitosan blend is prepared by mixing nanocellulose aqueous suspension and chitosan dilute acid aqueous solution at a volume ratio of 3:1 to 4:1. The 2% w / v chitosan dilute acid aqueous solution is specifically prepared by taking food-grade chitosan powder, dissolving it in 1% acetic acid aqueous solution, stirring at low speed at room temperature for 4 hours until completely dissolved, and removing insoluble impurities. Take a 1% w / v nanocellulose aqueous suspension and slowly add the chitosan solution to it according to the above volume ratio, stirring at a low speed of 300 r / min throughout the process. After the addition is complete, stir continuously for 1 hour, then homogenize at high speed of 10,000~150,000 r / min for 5 minutes to eliminate agglomerated particles and obtain a uniform, stable, and non-layered nanocellulose-chitosan blended dispersion.

[0026] Carboxymethyl cellulose paper (CMAP) was completely immersed in the nanocellulose-chitosan blend dispersion and allowed to stand at 35°C for 30-60 minutes to complete in-situ deposition. Nanocellulose and chitosan cross-linked with each other through molecular hydrogen bonds to form composite fiber aggregates. At the same time, the negatively charged carboxymethyl groups on the CMAP surface electrostatically adsorbed the chitosan cations, promoting the continuous enrichment and adsorption of composite fibers to the surface and internal pores of the paper base, thus constructing a dense and porous cross-linked fiber network on the paper surface. After removing the paper, the free dispersion on the surface was drained at room temperature and dried at a low temperature of 40-50°C to obtain nanocellulose-chitosan / CMAP composite cellulose paper.

[0027] The soaking process employs intermittent vacuum negative pressure impregnation, maintaining a vacuum of -0.03 to -0.05 MPa for 4 to 6 minutes, followed by a slow pressure release over a 2-minute gradient. After impregnation, the paper is lightly pressed to drain and then dried at a low temperature of 35 to 40°C using cold air, thus preserving the antibacterial active components completely. This process yields a biodegradable, antibacterial, and antioxidant preservation paper, which is then applied to the preservation of fruits and vegetables.

[0028] The fruit or vegetable mentioned can be asparagus.

[0029] The strain provided by this invention exhibits high production of bacteriocins, extracellular polysaccharides, organic acids, total phenols, and free radical scavenging activity during fermentation, and also possesses good antibacterial, antioxidant, and high [efficacy / potency]. β It inhibits glucosidase activity and has a significant inhibitory effect on Escherichia coli, Salmonella typhi, Staphylococcus aureus, and Listeria monocytogenes.

[0030] This invention uses Lactobacillus mucilaginosus JGSLF005 to ferment dried asparagus extract to prepare a fermentation broth rich in antioxidants and antibacterial agents. Using nanocellulose as a carrier, the fermentation broth is loaded onto fiber paper to prepare biodegradable preservation paper. This preservation paper is then applied to the preservation of asparagus, which can effectively extend the shelf life and has broad application prospects and commercial value.

[0031] This invention addresses the shortcomings of existing preservation technologies and possesses the following beneficial effects and innovative advantages: 1. Low cost, fully biodegradable, suitable for industrial production, and does not damage the original flavor of fruits and vegetables. Existing electrospinning processes are costly, and direct coating or soaking can cause the film to adhere to the surface of fruits and vegetables, altering the natural flavor of asparagus. This invention uses modified cellulose paper as a carrier, with a simple preparation process, readily available raw materials, and the entire material is biodegradable. The preservation paper physically isolates the asparagus, fully preserving the original flavor of the fruits and vegetables.

[0032] 2. High-value utilization of asparagus by-products, high safety, and higher loading efficiency of antibacterial components. Traditional essential oil preservation methods often result in pungent odors that mask the delicate aroma of asparagus. This invention utilizes the fermentation of asparagus processing byproducts to prepare an antibacterial liquid, achieving resource utilization of waste. The raw materials are entirely bio-based, ensuring high food safety and eliminating any off-flavors that interfere with the asparagus's taste. Furthermore, intermittent vacuum negative pressure impregnation, replacing room temperature soaking, allows the antibacterial active components to fully penetrate the fiber network, improving both the binding capacity and the uniformity of distribution. Attached Figure Description

[0033] Figure 1 The colony morphology of Lactobacillus fermentans JGSLF005 is shown in the image. Figure 2 Gram staining image of fermenting Lactobacillus mucinus JGSLF005; Figure 3 Cell viability graphs for different groups; Figure 4 Appearance images for different groups; Figure 5 A graph showing the quality changes of different groups; Figure 6 The graph shows the changes in lignin content and hardness in different groups; Figure 7 This diagram shows the changes in the activity of key enzymes involved in lignin synthesis in different groups. Detailed Implementation

[0034] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0035] The embodiments of the present invention are as follows: Example 1: Isolation, purification and identification of Lactobacillus fermentans JGSLF005 1. Harvesting of naturally fermented asparagus pickles Aseptically transfer 30 mL of natural asparagus kimchi fermentation liquid into a 50 mL sterile centrifuge tube, seal and refrigerate at 4°C. The sample was collected from the laboratory of the Institute of Agricultural Product Processing, Jiangxi Academy of Agricultural Sciences, on June 10, 2025.

[0036] 2. Isolation and purification of bacterial strains S1. Preparation of bacterial suspension: Take the above fermentation broth sample and inoculate it into sterile MRS broth medium at a volume inoculation rate of 3% to 5%. Place it in a constant temperature incubator at 37℃ and incubate for 24 to 36 hours. When the medium is turbid and there is white bacterial precipitate at the bottom, the bacterial enrichment is complete and subsequent separation and purification can be carried out.

[0037] S2. Plate Spreading: Take the enriched MRS broth bacterial suspension and aseptically dilute it 10-fold with sterile physiological saline; take 10 μL of each solution and spread it on a plate. -5 ~10 -8 Add 100 μL of diluted bacterial suspension to the surface of MR solid medium, spread it evenly on the surface with a sterile spreader, let it stand at room temperature for 8-10 minutes, and after the bacterial suspension has penetrated into the medium, invert the culture dish and incubate it in a constant temperature incubator at 37℃ for 48-72 hours.

[0038] S3, streak plate purification: Use a sterile inoculating loop to pick up a single colony from the plate in S2 and inoculate it onto a new MRS fixation medium for streak isolation. Repeat the streak purification until a single colony with consistent morphology is obtained.

[0039] S4. Morphological identification of the strain: Select a single colony obtained from the above purification, stain the strain according to the instructions of the Gram staining kit, and observe it under a microscope to observe the Gram staining properties, capsule and flagella and other microscopic morphological characteristics of Lactobacillus fermentans JGSLF005.

[0040] S5. Preservation of the strain: Single colonies of the target *Lactobacillus fermentatus* were retained after Gram staining and screening. These single colonies were then inoculated into MRS broth medium for amplification and culture to obtain a concentration of 10... 8 ~10 9 CFU / mL bacterial suspension. Using a sterile pipette, 0.5 mL of the bacterial suspension and 0.5 mL of sterile 20% glycerol were respectively pipetted into sterile bacterial culture preservation tubes, thoroughly mixed, and then stored in an ultra-low temperature freezer at -80 ℃.

[0041] 3. Molecular identification of the strain DNA extraction and 16S rDNA PCR amplification were performed on suspected *Lactobacillus fermentans* strains for identification. The purified suspected target strains were inoculated into MRS broth medium and cultured at 37°C for 24 h. DNA was then extracted using a bacterial genomic DNA extraction kit. The extracted DNA was amplified by PCR using 1 μL of 10 μM upstream primer 27F (5'-AGAGTTTGATCCTGGCTCAG-3', SEQ ID NO.1), 1 μL of 10 μM downstream primer 1495R (5'-CTACGGCTACCTTGTTACGA-3', SEQ ID NO.2), 12.5 μL of 2×Taq plus Buffer, and 1 μL of template DNA. The final volume was brought to 25 μL with sterile ddH2O. Sterile ultrapure water was used as a negative control instead of template DNA. PCR amplification program: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 55 ℃ annealing for 30 s, 72 ℃ extension for 1 min, 29 cycles; final extension at 72 ℃ for 5 min. The amplified target DNA fragment was recovered and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing sequence is shown in SEQ ID NO.3, as follows:

[0042] 4. Morphological and molecular identification results of the strain Morphological observation was performed on the colonies of suspected *Lactobacillus fermentatus* purified by streak plating. The strain formed milky white, round colonies on MRS medium. The colony surface was smooth, the edges were regular, and the colonies were opaque. Figure 1 Gram staining revealed that this strain was Gram-positive, with rod-shaped cells. Figure 2 ).

[0043] The 16S rDNA was directly amplified from bacterial cells, and the sequencing results were compared with BLAST. 16S rDNA homology analysis showed that this strain was classified as... Limosilactobacillus (Lactobacillus spp.), showing 100% homology with the reference sequence of Lactobacillus fermentum in the GenBank database, confirming that the isolated strain is Lactobacillus fermentum. The bacillus was named JGSLF005 and its culture was deposited. Details of the deposit are as follows: This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on May 21, 2026, with accession number CGMCC No. 38829.

[0044] Example 2: Acid resistance of fermenting Lactobacillus mucinus JGSLF005 β Analysis of glucosidase activity and antioxidant properties 1. Acid resistance test Take 1 mL of Lactobacillus fermentum JGSLF005 culture medium and place it in a 1.5 mL centrifuge tube. Centrifuge at 8000 × g for 5 min and collect the bacterial pellet. Wash the bacterial pellet twice with sterile culture medium, then resuspend the bacterial pellet in MRS broth medium with a pH of 2.5 and incubate anaerobically at 35 °C. Take 1 mL samples at 0 h and 3 h of culture, and perform 10-fold serial dilutions with 0.9% sterile physiological saline (10... -1 ~10 -7 Select an appropriate dilution and spread it onto MRS agar plates. Incubate anaerobically at 35°C for 48–72 h. After incubation, count the colonies on the plates and calculate the acid-resistant survival rate of the strains. The formula for calculating the strain survival rate is as follows: Strain survival rate (%) = (N1 / N0) × 100% in, N 1 The number of viable bacteria after 3 hours; N 0 The number of viable cells in the strain at 0h As can be seen from Table 1, N1 It is 7.62×10 8 CFU N 0 It is 8.78×10 8 The survival rate of CFU was 86.79% ± 5.47%, indicating that the strain has good acid resistance.

[0045] 2. β -Glucosidase activity test The bacterial culture of *Lactobacillus myxitis* JGSLF005 was centrifuged at 8000×g for 10 min at 4℃, and the supernatant was collected as the extracellular crude enzyme solution. The bacterial precipitate was washed twice with 0.2 mol / L acetate-sodium acetate buffer at pH 5.0, sonicated on ice, and centrifuged at 12000×g for 10 min. The supernatant was used as the intracellular crude enzyme solution, and the crude enzyme solution was diluted appropriately. pNPG was dissolved in 25 mmol / L buffer to prepare a 10 mmol / L substrate solution. 510 μL of 25 mmol / L buffer was added to a 1.5 mL centrifuge tube, and the solution was preheated at 75℃ for 5 min. Then, 60 μL of 10 mmol / L pNPG substrate and 30 μL of serially diluted crude enzyme solution were added sequentially. The reaction was incubated at 75℃ for 5 min, and then 150 μL of 0.5 mol / L Na2CO3 was added immediately to terminate the reaction. Add 200 μL of reaction solution to a 96-well plate and measure the absorbance at 405 nm using a microplate reader. Set up three replicates for each group. The blank control group was replaced with an equal volume of buffer solution instead of the enzyme solution. Calculate the product yield based on the absorbance value against a pNP standard curve (mmol / L concentration unit). Enzyme activity unit is defined as: under optimal reaction conditions, the amount of enzyme required to hydrolyze pNPG to generate 1 μmol of pNP per minute is 1 U.

[0046] Table 1 shows that the strain... β - The glucosidase activity was 3.18 ± 0.51 U / mL.

[0047] 3. Antioxidant performance test (1) When the viable bacterial concentration of the strain reaches 10 8 ~10 9 When CFU / mL, the bacterial suspension was centrifuged at 5000×g for 5 min, and the supernatant culture medium was discarded; the bacterial precipitate was collected and resuspended in sterile physiological saline. The resulting bacterial suspension was the sample for antioxidant capacity testing. DPPH free radical scavenging capacity and ABTS were used to test the antioxidant capacity. + The in vitro antioxidant activity of this strain was comprehensively evaluated using three indicators: free radical scavenging rate, metal ion chelating ability, and concentration of V at 100 μg / mL. C For comparison.

[0048] (2) Tests for scavenging DPPH free radicals A 0.1 mmol / L DPPH working solution was prepared using anhydrous ethanol as the solvent. The reaction was carried out in a 96-well microplate. 100 μL of bacterial suspension and 100 μL of DPPH solution were added to each well, mixed thoroughly, and incubated at 25 ℃ in the dark for 30 min. The absorbance was measured at 517 nm and recorded as A1. Two control groups were simultaneously set up: a blank control group (100 μL of bacterial suspension and 100 μL of anhydrous ethanol per well, absorbance recorded as A2); and a blank baseline group (100 μL of pure water and 100 μL of DPPH solution per well, absorbance recorded as A3). All groups were configured with three replicates. The DPPH free radical scavenging rate was calculated using the following formula: DPPH radical scavenging rate (%) = [1 - (A1 - A2) / A3] × 100 As shown in Table 1, the DPPH free radical scavenging rate of this strain was 65.21±8.95%.

[0049] (3) ABTS + Determination of free radical scavenging rate Prepare 7 mmol / L ABTS solution and 2.45 mmol / L potassium persulfate solution separately with pure water. Mix the two solutions thoroughly and incubate at 4 ℃ in the dark for 12–16 h to obtain ABTS stock solution. Dilute the ABTS stock solution with PBS buffer. The absorbance of the diluted solution at 734 nm is controlled to be 0.70–0.8, which is the ABTS working reaction solution. Perform reaction measurement on 96-well microplates: add 100 μL of bacterial suspension and 400 μL of ABTS reaction solution to each well, incubate at 25 ℃ in the dark for 30 min, mix thoroughly, and measure the absorbance at 734 nm, recorded as A1; add 100 μL of bacterial suspension and 400 μL of PBS buffer to each well of the sample blank group, and measure the absorbance, recorded as A2; add 100 μL of pure water and 400 μL of ABTS reaction solution to each well of the standard control group, and measure the absorbance, recorded as A3. All groups are equipped with 3 parallel multiple holes, ABTS + The formula for calculating free radical scavenging rate is as follows: ABTS + Free radical scavenging rate (%) = [1 − (A1 - A2) / A3] × 100 Table 1 shows that the ABTS of this strain + The free radical scavenging rate was 75.94 ± 2.84%.

[0050] (4) Test on the chelating ability of metal ions Mix 1 mL of bacterial suspension with 3.7 mL of ultrapure water, then add 0.1 mL of 2 mmol / L Fe. 2+ The solution was thoroughly mixed by vortexing and reacted at room temperature for 10 min. Then, 0.2 mL of 5 mmol / L phenanthroline chromogenic solution was added, and the mixture was incubated in a water bath at 25°C in the dark for 10 min. The absorbance of the system was measured at 562 nm. The formula for calculating the metal ion chelating ability is as follows: Metal ion chelation rate (%) = [1−(A1-A2) / A3]×100 Where A3 is the absorbance value after replacing the sample solution in the reaction system with 1 mL of distilled water; A1 is the absorbance value of the sample solution after the reaction; A2 is the absorbance value after replacing Fe in the reaction system with 0.1 mL of distilled water. 2+ The absorbance of the solution.

[0051] As shown in Table 1, the metal chelation rate of this strain is 69.95±7.12%.

[0052] Table 1. Acid resistance of the strains β - Glucosidase activity and antioxidant properties The above experimental results show that the fermentation *Lactobacillus mucinus* JGSLF005 of the present invention has acid resistance and high... β It has glucosidase activity and strong antioxidant activity, and can be used to prepare preservation materials with antioxidant effects.

[0053] Example 3: Antimicrobial test of Lactobacillus fermentans JGSLF005 The Oxford cup method was used to determine the antibacterial activity of *Lactobacillus mucinus* JGSLF005 against common pathogenic bacteria. *Salmonella typhimurium*, *Escherichia coli*, *Staphylococcus aureus*, and *Listeria monocytogenes* were inoculated into LB broth for activation culture, and the viable bacterial concentration was adjusted to 10⁻⁶. 8 ~10 9 CFU / mL; 100 μL of pathogenic bacterial suspension was evenly spread onto sterile LB agar plates. After absorption, sterile Oxford cups were placed vertically on the plate surface. 200 μL of *Lactobacillus fermentum* JGSLF005 bacterial suspension of the same concentration was added to each Oxford cup, with 200 μL of sterile PBS buffer added as a blank control. Each experiment was performed in triplicate. The plates were incubated upside down at 37 ℃ for 24–36 h. After incubation, the diameter of the inhibition zone was measured and recorded for each group.

[0054] Table 2. Diameter of the inhibition zone (mm) of Lactobacillus fermentans strain JGSLF005 JGSLF005 10.25±1.02 9.21±10.84 11.44±1.81 9.97±0.54 PBS 5.89±0.05 6.00±0.10 5.94±0.95 5.91±0.58 The results are shown in Table 2. Fermented Lactobacillus mucinus JGSLF005 showed significant inhibitory effects on four pathogenic bacteria: Salmonella typhimurium, Escherichia coli, Staphylococcus aureus, and Listeria monocytogenes.

[0055] Example 4: Preparation method of fermentation broth from fermentation of Lactobacillus mucilaginosus JGSLF005 The preparation method is as follows: Asparagus by-products → washing and cutting → blanching → intermittent heat pump drying → grinding → extraction → inoculation and fermentation → concentration of fermentation liquid Fresh asparagus byproducts without rot or spoilage were selected, cleaned, cut into 5-7 cm sections, blanched at 100℃ for 1 minute, drained, and then subjected to intermittent heat pump drying at 350W microwave power and 45℃ heat pump temperature for 6 hours to achieve a moisture content of 10%. The resulting powder was then sealed and stored away from light for later use. A 50% ethanol aqueous solution (food grade) was used at a material-to-liquid ratio of 1:20 (g / mL), with an ultrasonic power of 250W, an extraction temperature of 45℃, and an ultrasonic time of 45 minutes. After extraction, the mixture was centrifuged at 4000 r / min for 10 minutes, and the supernatant was collected. The residue was extracted once more, and the supernatants from both extractions were combined to obtain a crude extract.

[0056] Add 5% glucose and 0.01% fermenting Lactobacillus mucilaginosus JGSLF005 starter culture (live count 1×10⁻⁶). 8 ~10 9 CFU), after being mixed evenly, was fermented at 37℃ for 3 days. After fermentation, it was concentrated to 8% solids by rotary evaporation under low pressure at 40℃. After concentration, the antibacterial, antioxidant, and extracellular polysaccharide active substances of the fermentation broth were analyzed, and the results are shown in Table 3: 3 The results showed that the unfermented extract had an inhibition zone of only 7.29-8.51 mm against Salmonella typhimurium, Escherichia coli, Staphylococcus aureus, and Listeria monocytogenes; the fermented Lactobacillus mucinus JGSLF005 After concentration, the inhibition zone of the fermentation broth reached 16.21–18.44 mm, and the difference in antibacterial effect between the two was significant, indicating that the fermentation broth obtained by concentration of this strain has superior antibacterial properties.

[0057] Table 3. Diameter of the inhibition zone in the fermentation broth (mm) Concentrated liquid post-fermentation broth <![CDATA[17.25±1.02 b ]]> <![CDATA[16.21±0.84 b ]]> <![CDATA[18.44±0.71 b ]]> <![CDATA[17.97±0.54 b ]]> Unfermented extract <![CDATA[7.29±0.05 a ]]> <![CDATA[8.20±0.10 a ]]> <![CDATA[7.74±0.95 a ]]> <![CDATA[8.51±0.58 a ]]> As shown in Table 4, compared with the unfermented extract, the concentrated fermentation broth showed significant differences in organic acids, total phenols, total flavonoids, total saponins, extracellular polysaccharides, and bacteriocins, indicating that the antioxidant and antibacterial properties were significantly improved after fermentation with Lactobacillus mucilaginosus JGSLF005.

[0058] Table 4 Functional metabolites of fermentation broth Concentrated liquid post-fermentation broth <![CDATA[25.62±1.58 b ]]> <![CDATA[6.25±0.21 b ]]> <![CDATA[4.25±0.45 b ]]> <![CDATA[1.65±0.14 b ]]> <![CDATA[0.60±0.19 b ]]> <![CDATA[2051±59.47 b ]]> Unfermented extract <![CDATA[0.00±0.00 a ]]> <![CDATA[1.02±0.05 a ]]> <![CDATA[0.78±0.01 a ]]> <![CDATA[0.25±0.01 a ]]> <![CDATA[0.00±0.00 a ]]> <![CDATA[0.00±0.00 a ]]> Example 5: Preparation of biodegradable preservation paper and its application in asparagus preservation 1. Preparation of Carboxymethyl Cellulose Paper (CMAP): Using virgin cellulose paper (AP) as the substrate, 150 mL of a 1:4 water / isopropanol mixed solvent was prepared and the virgin cellulose paper was immersed in it. 15 mL of a 20% sodium hydroxide solution was slowly added dropwise while stirring, and the mixture was alkalized at 25°C for 1.5 h. Then, 3.0 g of sodium chloroacetate was added, and the mixture was stirred at 50°C for 3 h to induce etherification. After removing the paper, it was first thoroughly neutralized with deionized water and washed, then washed three times with food-grade anhydrous ethanol. The paper was then dried at room temperature under ventilation to obtain carboxymethyl cellulose paper (CMAP) free of harmful residues.

[0059] 2. Preparation of nanocellulose-chitosan blend: The ratio of nanocellulose to chitosan is 3:1. Prepare a 2% (w / v) dilute acid aqueous solution of chitosan: Take food-grade chitosan powder and dissolve it in a 1% acetic acid aqueous solution. Stir at low speed at room temperature for 4 hours until completely dissolved to remove insoluble impurities. Take a 1% (w / v) nanocellulose aqueous suspension and slowly add the above chitosan solution dropwise to it at a solid mass ratio of 3:1, stirring at low speed (300 r / min) throughout the process. After the dropwise addition is completed, continue stirring for 1 hour, and then homogenize at high speed for 5 minutes to eliminate agglomerated particles and obtain a uniform, stable, and non-stratified nanocellulose-chitosan blend dispersion.

[0060] 3. Preparation of nanocellulose-chitosan / CMAP composite cellulose paper: CMAP was completely immersed in nanocellulose-chitosan blended dispersion, and after standing at a constant temperature of 35℃ for 45 min, the paper was removed and the free dispersion on the surface was drained at room temperature. The paper was then dried at a low temperature of 45℃ to obtain nanocellulose-chitosan / CMAP composite cellulose paper.

[0061] 4. Preparation of biodegradable preservation paper: An intermittent vacuum negative pressure impregnation method was used to load the concentrated fermentation broth onto nanocellulose-chitosan / CMAP composite cellulose paper. The vacuum degree was maintained at -0.04 MPa for 5 minutes, followed by a 2-minute gradual depressurization. After impregnation, the paper was lightly pressed and drained, then dried at 35℃ using cold air to obtain biodegradable, antibacterial, and antioxidant preservation paper.

[0062] 5. Application in asparagus preservation: Use the preservation paper prepared by this invention to completely wrap a whole bundle of fresh asparagus, and stack the wrapped asparagus in an orderly layered manner in a foam packaging box for low-temperature storage at 4°C.

[0063] Example 6: Preparation of biodegradable preservation paper and its application in asparagus preservation This embodiment provides a method for preparing biodegradable preservation paper and its application in asparagus preservation. The difference from Example 5 is that "preparing a water / isopropanol mixed solvent at a volume ratio of 1:4" is replaced with "preparing a water / isopropanol mixed solvent at a volume ratio of 1:5"; "alkalinizing at 25°C for 1.5 hours" is replaced with "alkalinizing at 25°C for 2 hours"; and "etherification reaction at 50°C with stirring for 3 hours" is replaced with "etherification reaction at 50°C with stirring for 4 hours". The remaining steps are the same as in Example 5.

[0064] Example 7: Preparation of biodegradable preservation paper and its application in asparagus preservation This embodiment provides a method for preparing biodegradable preservation paper and its application in asparagus preservation. The difference from Example 5 is that "nanocellulose:chitosan ratio 3:1" is changed to "nanocellulose:chitosan ratio 4:1"; "35℃ constant temperature standing for 45 min" is changed to "35℃ constant temperature standing for 60 min"; and "vacuum degree -0.04MPa pressure for 5 min, followed by a 2 min gradual pressure release; after impregnation, lightly press and drain, then dry at 35℃ cold air" is changed to "vacuum degree -0.03MPa pressure for 6 min, followed by a 2 min gradual pressure release; after impregnation, lightly press and drain, then dry at 40℃ cold air". The remaining steps are the same as in Example 5.

[0065] Comparative Example 1 The only difference between this comparative example and Example 5 is that fresh asparagus was wrapped in unmodified virgin cellulose paper (AP) to complete the preservation process.

[0066] Comparative Example 2 The only difference between this comparative example and Example 5 is that fresh asparagus was wrapped in nanocellulose-chitosan / CMAP composite cellulose paper to complete the preservation process.

[0067] Comparative Example 3 The only difference between this comparative example and Example 5 is that the intermittent vacuum negative pressure impregnation process was not used when preparing the preservation paper. Instead, the fermentation liquid was directly soaked at room temperature and pressure. The rest of the preparation steps are completely consistent with Example 5. The biodegradable preservation paper was then used to preserve fresh asparagus.

[0068] Based on the comparison of the above embodiments and comparative examples: Comparison Case 1 This comparative study analyzes and compares the antibacterial and antioxidant activities of Asparagus Preservation Paper in Examples 5-7 and Comparative Examples 1-3.

[0069] As shown in Table 5, the antibacterial properties of Examples 5-7 are significantly different from those of Comparative Examples 1-3, while the differences in antibacterial properties between Examples 5-7 are not significant. This indicates that the intermittent vacuum negative pressure impregnation method can effectively increase the loading rate of antibacterial substances, thereby enhancing antibacterial activity.

[0070] Table 5. Diameter of inhibition zone (mm) Example 5 <![CDATA[18.49±0.25 d ]]> <![CDATA[17.95±0.34 d ]]> <![CDATA[19.87±0.36 d ]]> <![CDATA[19.01±0.74 d ]]> Example 6 <![CDATA[17.58±0.41 d ]]> <![CDATA[16.98±0.64 d ]]> <![CDATA[18.94±0.68 d ]]> <![CDATA[18.01±0.57 d ]]> Example 7 <![CDATA[18.15±0.61 d ]]> <![CDATA[17.51±0.81 d ]]> <![CDATA[19.08±0.84 d ]]> <![CDATA[18.73±0.68 d ]]> Comparative Example 1 <![CDATA[0.00±0.00 a ]]> <![CDATA[0.00±0.00 a ]]> <![CDATA[0.00±0.00 a ]]> <![CDATA[0.0.±0.00 a ]]> Comparative Example 2 <![CDATA[7.26±0.31 b ]]> <![CDATA[8.01±0.54 b ]]> <![CDATA[7.95±0.58 b ]]> <![CDATA[7.26±0.19 b ]]> Comparative Example 3 <![CDATA[11.25±0.87 c ]]> <![CDATA[10.48±0.51 c ]]> <![CDATA[12.64±0.83 c ]]> <![CDATA[10.98±0.72 c ]]> As shown in Table 6, the antioxidant properties of Examples 5-7 are significantly different from those of Comparative Examples 1-3, while the differences in antioxidant properties between Examples 5-7 are not significant. This indicates that the intermittent vacuum negative pressure impregnation method synergistically using nanocellulose-chitosan / CMAP substrate can effectively improve the loading rate of antioxidant substances, thereby enhancing antioxidant activity.

[0071] Table 6 Antioxidant properties Comparison Case 2 The four types of food preservation paper prepared in Examples 5-7 and Comparative Examples 1-3 were used as test samples. The cytotoxicity of the extract of each sample to HL-7702 human hepatocytes was evaluated by referring to the CCK-8 colorimetric method to verify the food contact biosafety of the food preservation paper of the present invention.

[0072] 1. Preparation of extract for preservation paper The biodegradable preservation paper prepared in Examples 5-7 and Comparative Examples 1-3 were cut into 1cm × 1cm samples and sterilized by ultraviolet irradiation. DMEM whole-cell culture medium was used as the extraction medium, and the samples were extracted at 37°C in the dark for 24 hours. After extraction, the extract was filtered through a 0.22μm sterile filter membrane and collected for later use.

[0073] 2. Incubation of cell plates and samples Cells were counted using a cell counting chamber, and HL-7702 cells were seeded into 96-well cell culture plates (1×10⁻⁶). 4 The culture medium was then removed, and the six extracts from step 1 were added. Six replicates were set up for each group, and the incubation was continued for another 24 hours.

[0074] 3. Colorimetric reaction and detection Replace the culture medium in the 96-well plate with 100 μL L-MEM and add 10 μL of CCK-8 solution, incubate for 2 hours. Measure the absorbance of the cells at 450 nm. The group containing culture medium and cells served as the control group, and the group containing culture medium and CCK-8 served as the blank group. Cell viability was calculated using the following formula: Cell viability (%) = (A 样品 -A 空白 ) / (A 对照 -A 空白 )×100 Depend on Figure 3 It can be seen that the cell viability of all 6 samples was above 94%, indicating that the prepared biodegradable preservation paper is biocompatible and can be used as a food preservation material.

[0075] Comparison Case 3 This comparative analysis examines the quality of the preservation effect of Example 5 and Comparative Examples 1-3, as follows: Figure 4 and Figure 5 As shown. Figure 5 In the middle: A is H B represents the weight loss rate; C represents the total bacterial count; and D represents the vitamin C content.

[0076] The results of Comparison Case 1 and Comparison Case 2 show that there are no significant differences in the various properties of the preservation paper prepared by the processes of Examples 5-7. Therefore, only Example 5 and Comparative Examples 1-3 were selected for subsequent comparative experiments on the preservation effect of asparagus.

[0077] 1. Appearance The appearance of asparagus is the most direct indicator of its post-harvest deterioration and a direct basis for consumers to judge the quality of goods on the shelf. For example... Figure 4 As shown, Comparative Example 1 showed signs of deterioration such as yellowing of the roots and shrinkage and lignification of the shoot tips after 10 days of storage; Comparative Example 2 showed signs of yellowing after 15 days of storage, and the shoot tips showed signs of shrinkage and lignification after 20 days of storage; Comparative Example 3 and Example 5 maintained their good appearance after 20 days of storage, and the asparagus preservation effect of Example 5 was significantly better than that of Comparative Example 3.

[0078] 2. Color difference Color measurements were performed on different groups of asparagus to obtain... L*a*b* The value was measured three times, and the result was expressed as hue angle ( ). H The formula is as follows: H =tan -1 [ b* / a* ] Depend on Figure 5 As can be seen from A, all groups show H The decrease in values ​​is related to pigment degradation and nutrient depletion caused by the accumulation of metabolic byproducts. (Example 5 vs. Comparative Examples 1-3) H The significant difference in values ​​indicates that the method described in Example 5 can effectively delay the yellowing of asparagus.

[0079] 3. Weightlessness rate Sample weight loss was quantified by gravimetric analysis and expressed as the difference between the initial weight and the weight recorded at 5-day intervals. The initial weight was measured immediately after asparagus sample processing. Results were expressed as a percentage, calculated using the following formula: Weight loss rate (%) = (M0 - M1) / M0 × 100% M0 and M1 represent the initial sample weight (g) and the sample weight during storage (g), respectively.

[0080] Post-harvest asparagus stems are characterized by high tenderness and high water content, making them prone to weight loss during storage. Figure 5 As shown in B, the weight loss rate of all four groups of samples increased with prolonged storage time. Among them, compared with Comparative Examples 1-3, the weight loss rate of Example 5 increased more slowly and showed a significant difference from the other groups.

[0081] 4. Total bacterial count Asparagus sample (5.0 g) was mixed with 45 mL of diluent (sterile water), ground in a mortar and pestle, and stirred thoroughly. The mixture was then serially diluted. Each diluted solution (1.0 mL) was added to two sterile Petri dishes. Total bacterial count was determined on agar medium. Petri dishes used for bacterial counting were incubated at 37 °C for 48 h. Results are expressed as log CFU / g of sample.

[0082] Microbial contamination severely limits the shelf life of post-harvest asparagus and poses a risk of foodborne illness. Figure 5 As can be seen from C, compared with day 0, the total number of bacteria in Example 5 and Comparative Example 3 showed a decreasing trend on day 5, indicating that the fermentation product of fermenting Lactobacillus mucinus JGSLF005 has antibacterial properties. However, the total number of colonies showed an increasing trend in the later stage, but was significantly lower than that of other comparative examples.

[0083] 5. Vitamin C Vitamin C content was determined using the 2,6-dichlorophenol-indophenol titration method. Vitamin C concentration is a key nutritional quality indicator in fruits and vegetables. Figure 5 As shown in D, the vitamin C content of all groups showed a decreasing trend. The decrease was most significant in Comparative Example 1, while the decrease rate in Example 5 was significantly lower than that in the other groups.

[0084] In summary, the biodegradable preservation paper prepared using the process of Example 5 can effectively delay the yellowing process of asparagus during cold storage, inhibit the increase in weight loss, reduce the proliferation rate of total bacterial count, and slow down the degradation and loss of vitamin C. This indicates that the composite preservation paper prepared by the present invention has excellent post-harvest preservation performance, can significantly maintain the appearance quality and nutrition of asparagus during storage, and is suitable for low-temperature preservation of asparagus.

[0085] Comparison Case 4 This comparative study measured the lignification and hardness of Example 5 and Comparative Examples 1-3 after preservation effects, such as... Figure 6 As shown. Figure 6 In the diagram: A represents lignin content; B represents hardness.

[0086] 1. Lignin Asparagus tender stems stored at 4 ℃ for different days were collected. The aged tips were removed, surface impurities were washed off, and surface moisture was blotted dry with filter paper. 2.0 g of fresh asparagus was weighed, rapidly frozen in liquid nitrogen, and thoroughly pulverized into powder using a cryogenic grinder. After centrifugation, the supernatant was discarded, and the precipitate was retained. The precipitate was washed sequentially: twice with 95% ethanol, once with an ethanol-n-hexane mixture (volume ratio 1:2), and once more with 95% ethanol, followed by drying for 30 min. The dried precipitate was then added to 5.0 mL of a bromoacetyl-glacial acetic acid mixture and incubated at 70 ℃ for 30 min. Subsequently, 1.0 mL of sodium hydroxide solution and 0.1 mL of hydroxylamine hydrochloride solution were added sequentially and mixed thoroughly. 0.5 mL of the above reaction mixture was transferred and diluted to 25 mL with glacial acetic acid. The absorbance was measured at 280 nm to calculate the lignin content.

[0087] The accumulation of lignin causes asparagus stems to lignify, making them hard and affecting their texture and quality. Figure 6 As shown in Figure A, the initial lignin content of asparagus was 32.5 mg / g. During the storage period at 4℃, the lignin content of all treatment groups showed a continuous upward trend. Among them, Comparative Example 1 showed the largest increase in lignin accumulation, with its lignin content significantly higher than that of the other groups from the 5th day of storage. Compared with Comparative Examples 1-3, the lignin growth rate of the treatment group in Example 5 was lower, which can effectively inhibit the postharvest lignification process of asparagus.

[0088] 2. Hardness The hardness of the asparagus midsection was measured using a TA-XT plus texture analyzer (Stable Micro Systems, Godalmin, UK) equipped with an A / CBK probe. The test parameters were set as follows: pre-test speed = 5.0 mm / s, test speed = 1.0 mm / s, post-test speed = 5.0 mm / s, contact force = 5.0 g.

[0089] Firmness is a key parameter for assessing the market quality and texture characteristics of asparagus. Lignification leading to hardening negatively impacts sensory properties. Figure 6 As shown in B, the hardness of Comparative Examples 1 and 2 showed a gradual increasing trend. The hardness of Comparative Examples 3 and 4 decreased on day 10, which was due to the increased activity of hydrolytic enzymes breaking down substances such as cellulose and pectin, thus loosening the tissue structure. However, after day 15, the hardness gradually and slowly increased steadily.

[0090] Comparison Case 5 This comparative study measured the activity of key enzymes involved in lignin synthesis after preservation effects in Example 5 and Comparative Examples 1-3. Figure 7 As shown. Figure 7 In the diagram: A represents POD enzyme activity; B represents PLA enzyme activity.

[0091] 1. POD enzyme activity The POD extraction and activity assay method was improved based on the work of Guo et al. (2022b). The reaction mixture contained 0.5 mL of crude enzyme solution, 3.0 mL of o-methoxyphenol solution, and 0.5 mL of hydrogen peroxide solution. Absorbance was monitored at 470 nm for 2 min. Enzyme activity units (U) were defined as the amount of enzyme required to increase absorbance by 0.1 per minute under specified conditions.

[0092] 2. PLA enzyme activity The PAL activity assay method was modified based on the protocol of Huyskens-Keil et al. (2020). In the experiment, L-phenylalanine solution (0.5 mL) and borate buffer (3.0 mL) were added sequentially to the reaction tube. The control group used a boil-inactivated enzyme solution (0.5 mL), while the test group used 0.5 mL of enzyme extract. Both groups of tubes were incubated at 37 °C for 1 hour, and then 0.1 mL of hydrochloric acid solution was quickly added to terminate the reaction. The absorbance values ​​of both groups were then measured at 290 nm. The PAL activity unit (U) was defined as an increase of 0.1 absorbance per gram of fresh weight (FW) of asparagus tissue per hour in the reaction system.

[0093] PAL, as the rate-limiting enzyme in phenylpropanoid metabolism, plays a crucial regulatory role in postharvest asparagus lignin biosynthesis; POD catalyzes the dehydrogenation polymerization of lignin monomers, directly driving the lignification process. Figure 7 It was observed that the activities of POD and PAL in all groups initially increased and then decreased. The initial increase may be due to the mechanical damage caused by cutting activating POD and PAL to participate in cell wall modification, while the subsequent decrease may be due to the involvement of POD and PAL in the lignification process of asparagus. The POD and PAL activities in the Example 5 group were consistently lower than those in Comparative Examples 1-3, indicating that the method used in Example 5 can effectively inhibit enzyme activity, thereby reducing lignin production and delaying the lignification of asparagus. This result is consistent with Comparative Examples 3 and 4.

[0094] As shown in Comparison 4 and Comparison 5, the fermentation product loaded with Lactobacillus fermentans JGSLF005 can effectively inhibit metabolic activity, control water loss, and delay the hardening and lignification process.

[0095] Therefore, a comprehensive comparison of the results in cases 3-5 shows that the biodegradable preservation paper prepared using the process in Example 5 can not only effectively delay the yellowing and deterioration of asparagus during 4°C refrigeration, inhibit the increase in storage weight loss, slow down the proliferation of total microbial colonies, and reduce the oxidative degradation loss of vitamin C; it can also reduce the postharvest metabolic intensity of asparagus, reduce tissue moisture loss, significantly inhibit the activity of key lignification enzymes such as PAL and POD, and delay the hardening and lignofibrosis process of asparagus. Asparagus treated with the preservation paper of this invention can still maintain a stable and intact appearance and product quality after 20 days of refrigeration at 4°C, significantly extending its shelf life; compared to the group treated with ordinary virgin cellulose paper, the shelf life of asparagus can be extended by more than 10 days.

[0096] Compared to traditional preservation methods such as chemical preservation, fruit and vegetable coating, and raw material soaking, the process of this invention is simple and easy to operate, with mild and controllable production conditions. The raw materials used are natural and green, and the finished product is completely biodegradable, with no chemical residues, excellent biocompatibility, and high food contact safety. This biodegradable preservation paper has outstanding practical value and potential for large-scale industrialization in the field of post-harvest low-temperature cold chain preservation of asparagus. It also provides important technical reference for the research, industrial production, and application of green biodegradable preservation substrates for fresh fruits and vegetables.

[0097] The above specific embodiments are used to explain and illustrate the present invention, but not to limit the present invention. Any modifications and changes made to the present invention within the spirit and scope of the claims shall fall within the protection scope of the present invention.

[0098] The above description is only a preferred embodiment of the present invention. Therefore, all equivalent changes or modifications made to the structure, features and principles described in the claims of this patent application are included in the scope of this patent application.

[0099] The gene sequence involved in this invention is as follows: SEQ ID No.1; Name: Upstream primer 27F DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct AGAGTTTGATCCTGGCTCAG SEQ ID No.2; Name: Downstream primer 1495R DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct CTACGGCTACCTTGTTACGA SEQ ID No. 3; Name: Recovery and amplification of target DNA fragments DNA type: genomic DNA Biological source: Limosilactobacillus fermentum

Claims

1. A fermenting *Lactobacillus mucinus* strain with antibacterial and antioxidant activity, characterized in that: The fermenting *Lactobacillus* was identified as *Lactobacillus fermentatus* JGSLF005, and named *Lactobacillus fermentatus*. Limosilactobacillus fermentum It is deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 21, 2026, with accession number CGMCC No. 38829.

2. A method for preparing fermentation broth using *Lactobacillus fermentans* as described in claim 1, characterized in that, The fermentation base liquid was obtained by using the infusion liquid of dried asparagus by-products as the fermentation base liquid, adding the fermenting mucinous lactobacillus for fermentation, and then concentrating the fermentation liquid at low temperature after the post-fermentation was completed.

3. The preparation method according to claim 2, characterized in that, The dried asparagus by-products were obtained through the following processing: Cut the asparagus stems and other by-products into sections, blanch them at 90-100℃, drain the water, and then dry them with an intermittent heat pump to achieve a moisture content of 8-12%. After pulverizing, obtain powder for later use. The extract of the dried asparagus by-product is obtained by processing the dried asparagus by-product in the following manner: D1. Add the dried asparagus by-product to the ethanol-water solution. The ratio of dried asparagus by-product to ethanol-water solution is 1:15~1:25 g / mL. The ultrasonic power is 200~300 W, the extraction temperature is 40~50℃, the ultrasonic time is 30~60 min, and after extraction, centrifuge at 4000 r / min for 10 min. Collect the supernatant and filter to obtain the residue. D2. Repeat step D1 above to extract the filter residue once more, and combine the supernatants obtained from the two treatments to obtain the crude extract.

4. The preparation method according to claim 2, characterized in that, The fermentation temperature is 30~37℃ and the time is 24~48h. After the fermentation is completed, the fermentation liquid is concentrated by low-temperature vacuum rotary evaporation at 40-60℃ with a vacuum degree of -0.06~-0.08MPa, so that the solid content of the fermentation liquid is 6%~10%.

5. A fermentation broth, characterized in that, It is prepared by any of the preparation methods described in claims 2-4.

6. The application of the fermented *Lactobacillus mucinus* according to claim 1 or the fermentation broth according to claim 5, characterized in that, Its applications include the preparation of biodegradable food preservation packaging, as well as its antibacterial and antioxidant effects against Escherichia coli, Salmonella typhi, Staphylococcus aureus, and Listeria monocytogenes.

7. A method for preserving fruits and vegetables using the fermentation liquid of claim 5, characterized in that, Modified fiber paper was prepared by in-situ deposition molding of nanocellulose-chitosan blend liquid as a carrier. The fiber paper was first soaked in the carrier to obtain nanocellulose-chitosan / CMAP composite cellulose paper, and then soaked in the fermentation liquid. After drying, it was obtained as biodegradable and antibacterial preservation paper.

8. The method for preserving fruits and vegetables according to claim 7, characterized in that, The carrier is specifically: using original cellulose paper AP as the substrate, and through carboxymethylation modification, introducing carboxymethyl groups into the cellulose molecular chain to obtain carboxymethyl cellulose paper CMAP; The specific carboxymethylation modification treatment is as follows: S1. Prepare a water / isopropanol mixed solvent with a volume ratio of 1:4 to 1:5, immerse the virgin cellulose paper in it, add a 20% sodium hydroxide solution dropwise while stirring, and alkalize at 25°C for 1.5 to 2 hours. S2, then add 3.0 g sodium chloroacetate, and stir at 50°C for 3-4 h for etherification reaction; S3. After removing the paper, it is first thoroughly neutralized and washed with deionized water, then washed three times with food-grade anhydrous ethanol, and dried in a ventilated room at room temperature to obtain carboxymethyl cellulose paper (CMAP) without harmful residues.

9. The method for preserving fruits and vegetables according to claim 7, characterized in that, The nanocellulose-chitosan blend solution is prepared by mixing nanocellulose aqueous suspension and chitosan dilute acid aqueous solution at a volume ratio of 3:1 to 4:1; the chitosan dilute acid aqueous solution is specifically prepared as follows: Take food-grade chitosan powder, dissolve it in an aqueous acetic acid solution, stir at room temperature for 4 hours until completely dissolved, and remove insoluble impurities; Take a 1% w / v nanocellulose aqueous suspension and add the chitosan solution dropwise to it according to the above volume ratio, stirring at a low speed of 300 r / min throughout the process. After the addition is complete, stir continuously for 1 hour, then homogenize for 5 minutes to eliminate agglomerated particles and obtain a uniform, stable, and non-layered nanocellulose-chitosan blended dispersion.

10. The method for preserving fruits and vegetables according to claim 7, characterized in that, Carboxymethyl cellulose paper (CMAP) was completely immersed in the nanocellulose-chitosan blend dispersion and allowed to stand at 35°C for 30-60 minutes to complete in-situ deposition. Nanocellulose and chitosan cross-linked with each other through molecular hydrogen bonds to form composite fiber aggregates. At the same time, the negatively charged carboxymethyl groups on the CMAP surface electrostatically adsorbed the chitosan cations, promoting the continuous enrichment and adsorption of composite fibers to the surface and internal pores of the paper base, thus constructing a dense and porous cross-linked fiber network on the paper surface. After removing the paper, the free dispersion on the surface was drained at room temperature and dried at a low temperature of 40-50°C to obtain nanocellulose-chitosan / CMAP composite cellulose paper.

Images