Stable passaged feline embryonic intestinal epithelial cells, and preparation method and application thereof

Abstract

The application discloses stable passaging cat embryo intestinal epithelial cells and a preparation method and application thereof, and the preparation method comprises the following steps: extracting primary cat embryo intestinal cells from cat embryo intestinal tissues; culturing the primary cat embryo intestinal cells in an epithelial cell complete culture medium and combining with a differential digestion method to purify, so as to obtain primary cat embryo intestinal epithelial cells; and culturing the primary cat embryo intestinal epithelial cells in a culture medium to carry out subculture, so that the stable passaging cat embryo intestinal epithelial cells are obtained; the stable passaging cat embryo intestinal epithelial cells obtained by the preparation method can be stably passaged for a long time, can still maintain stable proliferation ability after multiple passages, reduces individual differences, improves the reliability and repeatability of experimental results, and in addition, the preparation method does not introduce exogenous genes or change the genotype of the cells by artificial technology, so that the stability at the gene level is ensured.

Description

Technical Field

[0001] This invention relates to the field of cell engineering technology, specifically to a stably passaged cat embryonic intestinal epithelial cell, its preparation method, and its application. Background Technology

[0002] Feline coronavirus (FCoV) is a member of the Coronaviridae family and is widespread in domestic and feral cat populations worldwide. They typically cause asymptomatic infections, but some FCoV strains, called feline infectious peritonitis virus (FIPV), can lead to a systemic and fatal disease called feline infectious peritonitis. This virus is primarily transmitted via the fecal-oral route, making infection very common in multi-cat environments. Kittens are the primary carriers, with kittens under one year old shedding 2.5 times more virus than adult cats. Furthermore, literature reports that purebred cats such as Bengal, Birmingham, and Ragdoll are more susceptible to FPV than mixed-breed cats, but the exact reasons remain unclear. The survival rate of cats infected with FPV decreases with age. The main clinical features of FPV are purulent granulomas and perivascular lesions; specific clinical symptoms vary depending on the affected organ. Common sites of lesion include the kidneys, liver, spleen, lungs, eyes, serous membranes, and mesenteric lymph nodes. It presents in two forms: exudative and non-exudative. Exudative lesions are characterized by fluid accumulation in the body cavities, while non-exudative lesions are characterized by granulomatous lesions in various organs and other related clinical symptoms. However, cats that initially present with non-exudative lesions usually develop fluid accumulation later on.

[0003] The main treatment principle for feline infectious peritonitis (FIPV) is currently symptomatic treatment. One of the main reasons why an effective FIPV vaccine has not yet been developed is the lack of highly pathogenic FIPV isolates and suitable infection models. Although the Crandell-Rees feline kidney (CRFK) cell line is widely used for FCoV isolation, multiple blind passages (usually 1–2 weeks) are often required to observe significant cytopathic effects (CPE) when isolating the virus from clinical samples for the first time, thus prolonging the virus isolation process. Theoretically, primary feline embryonic intestinal epithelial cells retain the polarity, differentiation state, and natural receptor expression profile of the source tissue, and therefore can provide a more physiologically relevant model for FCoV infection. However, due to the difficulty of tissue acquisition and bottlenecks in isolation and purification technology, a systematic and reproducible primary cell culture protocol has not yet been established; in addition, no parallel comparative studies of primary cells and CRFK cells have been conducted to assess the tropism and replication kinetics of the virus in these primary cells.

[0004] In view of this, the present invention is hereby proposed. Summary of the Invention

[0005] The purpose of this invention is to provide a stable passaged feline embryonic intestinal epithelial cell, its preparation method, and its application. The stable passaged feline embryonic intestinal epithelial cells prepared by this invention can be passaged stably for a long period of time and maintain stable proliferation capacity after multiple passages, reducing individual differences and improving the reliability and reproducibility of experimental results. In addition, the preparation method of this invention does not introduce exogenous genes or change the genotype of the cells through artificial technology, ensuring stability at the gene level.

[0006] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: The first aspect of this invention provides a method for preparing stably passaged cat embryonic intestinal epithelial cells, the method comprising the following steps: (a) Extraction of primary feline gut cells from feline gut tissue; (b) Primary feline intestinal cells were cultured in complete epithelial cell culture medium and purified by differential digestion to obtain primary feline intestinal epithelial cells; (c) Primary feline intestinal epithelial cells are placed in a culture medium for passage culture to obtain the stable passaged feline intestinal epithelial cells. Based on total volume, the culture medium comprises the following components: FBS 4%~6%, FGF-10 90~110ng / mL, EGF 40~60ng / mL, Y27632 8~12μM, GlutaMAX 1~3mM, HEPES 8~12mM, N-acetyl-L-cysteine ​​1~1.5mM, penicillin-streptomycin-amphoteric B 0.8%~1.2%, L-WRN conditioned medium 30%~50%, the balance being Advanced DMEM / F12.

[0007] Preferably, based on total volume, the culture medium comprises the following components: FBS 5%, FGF-10 100 ng / mL, EGF 50 ng / mL, Y27632 10 μM, GlutaMAX 2 mM, HEPES 10 mM, N-acetyl-L-cysteine ​​1.25 mM, penicillin-streptomycin-amphoteric B 1%, L-WRN conditioned medium 40%, the remainder being Advanced DMEM / F12.

[0008] Preferably, the final concentration of penicillin added to the culture medium is 80~120U / mL, the final concentration of streptomycin added is 0.05~0.15mg / mL, and the final concentration of amphotericin B added is 0.2~0.3μg / mL.

[0009] Preferably, the subculture temperature is 36-38°C and the carbon dioxide concentration is 5%.

[0010] Preferably, the culture medium is changed every 1 to 2 days during the passage process.

[0011] Preferably, the number of subcultures is not less than 60.

[0012] A second aspect of the present invention provides a stable passaged cat embryonic intestinal epithelial cell prepared by the above-described preparation method.

[0013] A third aspect of the present invention provides the application of stable passaged feline embryonic intestinal epithelial cells prepared by the above-described method in constructing a cell model of feline coronavirus infection in vitro.

[0014] The fourth aspect of the present invention provides a method for constructing a cell model of feline coronavirus infection in vitro, the method comprising infecting stably passaged feline embryonic intestinal epithelial cells prepared by the preparation method with feline coronavirus.

[0015] Compared with the prior art, the beneficial effects of the present invention include at least the following: The method of this invention successfully constructed a stable passaged cat embryonic intestinal epithelial cell line by activating the Wnt / β-catenin signaling pathway in cat embryonic intestinal epithelial cells. Compared with traditional methods of stable cell passage, this invention does not introduce exogenous genes or alter the cell's genotype through artificial techniques, ensuring stability at the gene level. In addition, the stable passaged cat embryonic intestinal epithelial cells maintain stable proliferative capacity after multiple passages, reducing individual differences and improving the reliability and reproducibility of experimental results. Furthermore, stable passaged cat embryonic cells can meet the requirements of large-scale experiments, reducing experimental costs and workload, reducing dependence on fresh cat embryos, and complying with animal welfare requirements.

[0016] The stable passaged feline embryonic intestinal epithelial cells of this invention can be stably passaged for a long time, improving biosafety. They can be cultured for a long time under sterile conditions, reducing the risk of contamination introduced during extraction and culture, and ensuring the safety of the laboratory environment. Moreover, the stable passaged feline embryonic intestinal epithelial cells have broad application prospects, providing more stable and reliable cell models for virology research, vaccine development, drug screening and other fields, and promoting the progress of related research. Attached Figure Description

[0017] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to scale.

[0018] Figure 1 This is the culture morphology of primary cat embryonic intestinal epithelial cells in Example 1 of the present invention; Figure 2 This represents the doubling level of the stable passaged cat embryo intestinal epithelial cell population in Example 1 of this invention; Figure 3 This is the result of immunofluorescence verification of primary cat embryonic intestinal epithelial cells as epithelial cells in Example 2 of the present invention; Figure 4 This is the result of RT-qPCR verification in Example 2 of the present invention that the primary cat embryonic intestinal epithelial cells are epithelial cells; Figure 5 This is the verification result of stable passaged feline embryonic intestinal epithelial cells (50th generation) in feline coronavirus infection in Example 3 of the present invention; Figure 6 This invention relates to Example 4, which uses RT-qPCR to detect the expression level of coronavirus infection-related receptors in stable passaged cat embryonic intestinal epithelial cells (generation 50). Detailed Implementation

[0019] The embodiments of the technical solution of the present invention will be described in detail below with reference to the examples. The following embodiments are only used to illustrate the technical solution of the present invention more clearly, and are therefore only examples, and should not be used to limit the scope of protection of the present invention.

[0020] It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning as understood by those skilled in the art to which this invention pertains.

[0021] This invention provides a method for preparing stably passaged cat embryonic intestinal epithelial cells, the method comprising the following steps: (a) Extraction of primary feline gut cells from feline gut tissue; (b) Primary feline intestinal cells were cultured in complete epithelial cell culture medium and purified by differential digestion to obtain primary feline intestinal epithelial cells; (c) Primary feline intestinal epithelial cells are placed in a culture medium for passage culture to obtain the stable passaged feline intestinal epithelial cells. Based on total volume, the culture medium comprises the following components: FBS 4%~6%, FGF-10 90~110ng / mL, EGF 40~60ng / mL, Y27632 8~12μM, GlutaMAX 1~3mM, HEPES 8~12mM, N-acetyl-L-cysteine ​​1~1.5mM, penicillin-streptomycin-amphoteric B 0.8%~1.2%, L-WRN conditioned medium 30%~50%, the balance being Advanced DMEM / F12.

[0022] In one embodiment, the culture medium comprises the following components based on total volume: FBS 5%, FGF-10 100 ng / mL, EGF 50 ng / mL, Y27632 10 μM, GlutaMAX 2 mM, HEPES 10 mM, N-acetyl-L-cysteine ​​1.25 mM, penicillin-streptomycin-amphoteric B 1%, L-WRN conditioned medium 40%, the remainder being Advanced DMEM / F12.

[0023] In one embodiment, the final concentration of penicillin added to the culture medium is 80-120 U / mL, the final concentration of streptomycin added is 0.05-0.15 mg / mL, and the final concentration of amphotericin B added is 0.2-0.3 μg / mL.

[0024] In one embodiment, the subculture temperature can be any value between 36 and 38°C, and the carbon dioxide concentration is 5%.

[0025] In one embodiment, the culture medium is changed every 1 to 2 days during the passage process.

[0026] In one embodiment, the subculture is performed at least 60 times.

[0027] Another embodiment of the present invention provides a stable passaged cat embryonic intestinal epithelial cell prepared by the above preparation method.

[0028] In another embodiment of the present invention, the application of stable passaged feline embryonic intestinal epithelial cells prepared by the above-described method in constructing a cell model of feline coronavirus infection in vitro is provided.

[0029] Another embodiment of the present invention provides a method for constructing a cell model of feline coronavirus infection in vitro, the method comprising infecting stably passaged feline embryonic intestinal epithelial cells prepared by the preparation method with feline coronavirus.

[0030] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0031] L-WRN conditioned medium was prepared by the following method: Seed 5 × 10⁵ cells in a 150 mm cell culture flask. 6 L-WRN cells were cultured in 30 mL of DMEM / F12 medium (containing 10% FBS, 1× non-essential amino acids (working concentration 100 μM), and 1% penicillin-streptomycin-amphotericin B (working concentration of penicillin 100 U / mL, streptomycin 0.1 mg / mL, and amphotericin B 0.25 µg / mL). After 72 h, the first batch of conditioned medium was collected, centrifuged at 2000 g for 10 min, and temporarily stored at 4 °C. The same 30 mL of DMEM / F12 medium was added again, and the cells were cultured for another 48 h. The second batch of conditioned medium was collected, centrifuged at 2000 g for 10 min, and temporarily stored at 4 °C. The same procedure was repeated to collect the third batch. The three batches of conditioned medium were mixed and thoroughly blended, filtered through a 0.22 μm filter, aliquoted, and frozen at -80 °C.

[0032] Example 1

[0033] This embodiment describes a method for preparing stably passaged feline embryonic intestinal epithelial cells, the preparation method comprising the following steps: (a) Non-partum fetal embryos were transferred to a laminar flow hood. The abdominal cavity was opened along the midline of the embryo using sterile instruments. The intestinal tissue was completely removed, and the surface fat, capsule, blood vessels, and other accessory structures were carefully removed. The tissue samples were thoroughly washed with PBS (Biosharp, BL142A) containing 1% penicillin-streptomycin-amphoteric B. The samples were then mechanically minced to about 1 mm³. The samples were digested with 0.5 mg / mL neutral collagenase (Solarbio, C8140) at 37°C for 30 minutes, with gentle shaking every 5 minutes. Digestion was stopped when the tissue showed a typical swollen and white appearance. The digestion products were filtered through a 100 μm cell sieve and centrifuged at 1200 × g for 5 minutes to collect the cell pellet, thus obtaining primary fetal intestinal cells. (b) The cell pellet (primary feline enterocytes) was resuspended in epithelial cell selective medium (Procell LifeScience & Technology, CM-ZY002), which effectively inhibits the proliferation of non-epithelial cells. The culture system was maintained with a medium change frequency of every 48 hours. Simultaneously, the feline enterocytes were purified using differential digestion, and cell morphology was monitored periodically using an optical microscope. The results are as follows: Figure 1 As shown ( Figure 1 (A and B are observations magnified 4 times and 10 times, respectively). After purification, most cells exhibited the typical "paving stone" morphology of epithelial cells, yielding primary cat embryonic gut epithelial cells. (c) Primary feline intestinal epithelial cells were placed in a culture medium and passaged for 50 generations at a temperature of 37°C and a carbon dioxide concentration of 5%. The culture medium was changed once every day during the passage process to obtain the stable passaged feline intestinal epithelial cells. Based on total volume, the culture medium comprises the following components: The medium consisted of 5% FBS, 100 ng / mL FGF-10, 50 ng / mL EGF, 10 μM Y27632, 2 mM GlutaMAX, 10 mM HEPES, 1.25 mM N-acetyl-L-cysteine, 1% penicillin-streptomycin-amphoteric acid B, 40% L-WRN conditioned medium, with the remainder being Advanced DMEM / F12. The final concentrations of penicillin, streptomycin, and amphotericin B in the medium were 100 U / mL, 0.1 mg / mL, and 0.25 μg / mL, respectively.

[0034] Cell proliferation rate was assessed using the cumulative population doubling level (PDL); the calculation formula is as follows: PD = log(final cell number / cell seeding number) × log2 + sum of PD values ​​from previous passages; the doubling results are as follows: Figure 2 As shown, by Figure 2 It is known that the culture medium of the present invention can provide support for long-term cell culture, with a passage time of more than 60 days.

[0035] Example 2

[0036] This example demonstrates the use of immunofluorescence and RT-qPCR to detect feline embryonic gut cell types. CRFK cells were mixed with primary feline gut epithelial cells (i.e., the cells obtained in step (b) of Example 1) at a ratio of 2 × 10⁻⁶. 4Cells were seeded at a density of 1 cell / well in 48-well plates and cultured at 37 °C and 5% CO2 for 24 hours until the cell confluence reached 80%-90%. The culture medium was aspirated, and 500 μL of PBS was added to each well. The cells were shaken at 150 rpm for 5 minutes at room temperature and washed 3 times (the following washing steps are the same as this step). Cells were fixed with 4% paraformaldehyde (BioSharp, BL539A) at room temperature for 10 minutes and washed 3 times. For the detection of biomarkers other than EpCAM, cells were permeabilized with 0.1% Triton X-100 (Biotopped, Top1141S) at room temperature for 10 minutes and washed 3 times. Cells were blocked overnight in 5% BSA (Solarbio, A8020) at 4 °C, washed 3 times, and then incubated overnight at 4 °C with the following primary antibodies: Vimentin (HUABIO, ET16010-739), E-cadherin (Affinity, AF0131), and α-SMA (Affinity, AF0131). AF1032), EpCAM (HUABIO, EM1111), and Pankerantin (Protainteach, 26411-1-AP) were used. The antibodies were diluted with 5% BSA according to the instructions. After removing the primary antibody and washing three times, the antibodies were incubated with the corresponding secondary antibody at room temperature in the dark for 1 hour. Alexa Fluor 488-labeled goat anti-mouse IgG (Servicebio, GB25301) and Alexa Fluor 488-labeled goat anti-rabbit IgG (Servicebio, GB25303) were used. Finally, the slides were mounted with anti-fluorescence quenching mounting medium containing DAPI (Servicebio, G1407). All fluorescence images were acquired using a Biotek Cytation1.

[0037] Immunofluorescence results as follows Figure 3 As shown, by Figure 3 It can be seen that CRFK cells express EpCAM, Pankeratin, and Vimentin, but not α-SMA and E-cadherin; while primary feline intestinal epithelial cells express EpCAM, E-cadherin, and Pankeratin, but not Vimentin and α-SMA, indicating that they are epithelial-derived cells.

[0038] In addition, to further validate the above results at the transcriptional level, RNA was extracted from CRFK and primary feline intestinal epithelial cells using a total RNA extraction kit (Magen, R4011), and reverse transcription was performed according to the instructions of the reverse transcription kit (TOLOBIO, 22107-01). The mRNA expression levels of Vimentin, α-SMA, and EpCAM were detected using a quantitative real-time PCR kit (TOLOBIO, 22204-01) according to the kit instructions. Primer sequences are shown in Table 1, and the detection results are as follows: Figure 4 As shown; Table 1 Primer information for real-time quantitative PCR detection of cell types

[0039] Depend on Figure 4 The mRNA expression levels of Vimentin, α-SMA, and EpCAM were consistent with the immunofluorescence results. Vimentin mRNA expression in primary feline enteroepithelial cells was significantly lower than in CRFK cells; EpCAM mRNA expression in primary feline enteroepithelial cells was significantly higher than in CRFK cells. Furthermore, α-SMA mRNA expression in primary feline enteroepithelial cells was significantly lower than in CRFK cells.

[0040] Example 3

[0041] This example illustrates the observation of cytopathic effects after FCoV-GFP infection and the detection of the relative expression level of viral mRNA within cells.

[0042] CRFK cells and stable passaged feline intestinal epithelial cells (passage 50) were seeded at a density of 5 × 10³ cells / well in 96-well plates and cultured at 37°C in a 5% CO2 incubator for 24 h. Once cell confluence reached 80%, the supernatant was discarded, and the cells were washed three times with pre-cooled PBS. An MOI of 1 for FCoV-GFP virus suspension was added to each well, and the plate was gently shaken several times to mix. The plates were then incubated at 37°C for 2 h to complete virus adsorption. The maintenance medium was then changed: CRFK cells were cultured in DMEM containing 2% FBS and 1% penicillin-streptomycin-amphoteric B triple antibodies, while stable passaged feline intestinal epithelial cells were cultured in the passaged medium described in Example 1. GFP fluorescence intensity was assessed using a Biotek Cytation1 multi-functional microplate detection system at 24, 48, and 72 hours post-infection to evaluate viral infection efficiency. Whole-cell lysates were collected at 72 hours for quantitative determination of relative viral load. The expression level of FCoV-GFP 3'UTR (F: GGCAACCCGATGTTTAAAACTGG SEQ ID NO:9; R: CACTAGATCCAGACGTTAGCTC SEQ ID NO:10) was detected using RT-qPCR, with feline GAPDH as an internal reference gene. Furthermore, the mean fluorescence intensity of FCoV-GFP infection was statistically analyzed using ImageJ software, and the fluorescence signal was normalized by area.

[0043] Bright-field microscopy observation results ( Figure 5 A) showed that, 24-48 hours post-infection (hpi), CRFK did not exhibit significant cytopathic effect (CPE), while stable passaged cat embryonic intestinal epithelial cells showed partial cell shrinkage and detachment immediately at 24 hpi, with most cells detaching at 48 hpi, and almost all cells detaching by 72 hpi. Fluorescence microscopy observation ( Figure 5 B) It was found that at 24 hpi, the number of GFP-positive cells in stably passaged feline embryonic intestinal epithelial cells was the highest, and the fluorescence intensity was the strongest; CRFK cells showed the weakest fluorescence signal. This indicates that FCoV-GFP replicates most actively in feline embryonic intestinal cells and induces significant CPE, with the fluorescence signal weakening over time due to rapid cell death. In contrast, the fluorescence signal in CRFK cells gradually increased over time, suggesting that the virus replicated continuously but did not cause rapid cell death. This result is highly consistent with the enterotropic pathogenic characteristics of FCoV in natural infection. Figure 5 C is Figure 5 Fluorescence quantification of B.

[0044] To quantitatively analyze viral load, whole-cell lysates were collected at 72 hpi for RT-qPCR detection. Figure 5The results showed that the relative content of FCoV-GFP RNA was highest in stable passaged cat embryonic intestinal epithelial cells, significantly higher than that in CRFK cells (p<0.05). These results indicate that stable passaged cat embryonic intestinal epithelial cells are highly susceptible to FCoV, supporting efficient viral replication and leading to rapid cytopathic effects.

[0045] Example 4

[0046] This example demonstrates the detection of coronavirus receptor mRNA expression levels in cells using RT-qPCR.

[0047] To investigate the molecular mechanism by which FCoV-GFP exhibits superior replication capacity compared to CRFK cells in stable passaged feline intestinal epithelial cells (passage 50), RNA was extracted from stable passaged feline intestinal epithelial cells and CRFK cells using a total RNA extraction kit (Magen, R4011), and reverse transcription was performed according to the instructions of a reverse transcription kit (TOLOBIO, 22107-01). Quantitative real-time PCR (qPCR) was used to detect the expression levels of key coronavirus-related receptor genes APN and ACE2, following the kit's instructions. Aminopeptidase N (APN) is a known major receptor for FCoV, and angiotensin-converting enzyme 2 (ACE2) is a type I transmembrane protein and metalloenzyme. Previous studies have not shown that ACE2 is a major receptor for feline infectious peritonitis virus (FCoV). The results are as follows: Figure 6 As shown, the relative expression level of aminopeptidase N (APN) mRNA was higher in stable passaged feline intestinal epithelial cells than in CRFK, but the difference was not statistically significant. Angiotensin-converting enzyme 2 (ACE2) expression was also high in stable passaged feline intestinal epithelial cells and significantly higher than in CRFK, possibly indirectly reflecting the diversity of coronavirus receptor utilization. In contrast, the receptor expression pattern in CRFK cells deviates significantly from the actual in vivo situation, which may be the main reason why it cannot accurately simulate the FCoV infection process.

[0048] The above results demonstrate that the feline embryonic intestinal epithelial cell model established in this invention has significant advantages over CRFK: (1) it retains the tissue-specific epithelial cell phenotype; (2) it maintains the physiologically relevant viral receptor expression pattern; and (3) it more accurately simulates the in vivo cytopathic effect of FCoV. These characteristics make this model of great value in the study of FCoV pathogenic mechanisms, antiviral drug screening, and vaccine evaluation.

[0049] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered within the scope of the claims and specification of the present invention.

Claims

1. A method for preparing stably passaged cat embryonic intestinal epithelial cells, characterized in that, The preparation method includes the following steps: (a) Extraction of primary feline gut cells from feline gut tissue; (b) Primary feline intestinal cells were cultured in complete epithelial cell culture medium and purified by differential digestion to obtain primary feline intestinal epithelial cells; (c) Primary feline intestinal epithelial cells are placed in a culture medium for passage culture to obtain the stable passaged feline intestinal epithelial cells. Based on total volume, the culture medium comprises the following components: FBS 4%~6%, FGF-10 90~110ng / mL, EGF 40~60ng / mL, Y27632 8~12μM, GlutaMAX 1~3mM, HEPES 8~12mM, N-acetyl-L-cysteine ​​1~1.5mM, penicillin-streptomycin-amphoteric B 0.8%~1.2%, L-WRN conditioned medium 30%~50%, the balance being Advanced DMEM / F12.

2. The preparation method according to claim 1, characterized in that, Based on total volume, the culture medium comprises the following components: FBS 5%, FGF-10 100 ng / mL, EGF 50 ng / mL, Y27632 10 μM, GlutaMAX 2 mM, HEPES 10 mM, N-acetyl-L-cysteine ​​1.25 mM, penicillin-streptomycin-amphoteric B 1%, L-WRN conditioned medium 40%, the remainder being Advanced DMEM / F12.

3. The preparation method according to claim 1, characterized in that, The subculture temperature was 36-38℃, and the carbon dioxide concentration was 5%.

4. The preparation method according to claim 1, characterized in that, The culture medium is changed every 1-2 days during the passage process.

5. The preparation method according to claim 1, characterized in that, The number of subcultures shall not be less than 60.

6. The use of stably passaged feline embryonic intestinal epithelial cells prepared by any one of claims 1 to 5 in constructing a cell model of feline coronavirus infection in vitro.

7. A method for constructing a cell model of feline coronavirus infection in vitro, characterized in that, The construction method includes using feline coronavirus to infect stably passaged feline embryonic intestinal epithelial cells prepared by any one of claims 1 to 5.

Images