Culture medium for protecting telomere length of embryonic cells in in vitro culture and methods of use and applications thereof

Abstract

The application discloses a culture solution for protecting embryo telomere length in in-vitro culture and a use method and application thereof, and aims to solve the problems of embryo telomere shortening and offspring health risks in assisted reproductive technology (ART) by optimizing in-vitro culture conditions. The application proposes that nicotinamide mononucleotide (NMN) and alpha-ketoglutarate (alpha-KG) are added in proportion in the existing culture solution that can be used for embryo culture, and antioxidants such as vitamin C (Vitamin C, VitC) are supplemented, wherein the combination of NMN and alpha-KG can effectively improve the mitochondrial function of in-vitro cultured embryos, improve the DNA methylation degree of related genes, restore the telomere length of in-vitro cultured blastocysts and avoid the significant shortening of offspring telomeres. Antioxidants such as VitC can reduce the production of mitochondrial reactive oxygen species (mtROS) and enhance the stability of the effect. In the formula, the specific proportion combination of NMN and alpha-KG is the core of improving the telomere length, and the antioxidant auxiliary components such as VitC enhance the stability of the effect.

Description

Technical Field

[0001] This invention belongs to the fields of medical biology and assisted reproductive technology; specifically, it relates to a culture medium for protecting the telomere length of embryonic cells in vitro, as well as its usage and application. Background Technology

[0002] Since 1978, approximately 10 million babies have been born globally through assisted reproductive technologies (ART), with birth rates ranging from 2% to 6% in Europe, about 2% in the United States, and about 1% in China. The vast majority of offspring conceived through ART appear to be healthy; however, some minor but concerning safety issues have been observed in this population, with higher rates of congenital malformations, premature birth, and low birth weight. Multiple studies have shown that the growth patterns of children conceived through ART differ from those conceived naturally, potentially linked to an increased risk of metabolic diseases later in life. Recently, research by Wang et al. further suggests that blastocyst transfer via ART may be associated with shortened telomeres in offspring peripheral blood leukocytes, a biomarker of shortened healthy lifespan. This study indicates that prolonged in vitro culture conditions may be the cause of shorter telomere length in pre-implantation embryos, but the exact mechanism remains largely unclear, and there are currently no effective interventions to mitigate this risk.

[0003] The "developmental origin of health and disease" theory posits that fetal development influences lifelong disease susceptibility in offspring. Preimplantation embryos are more sensitive to environmental disturbances during in vitro culture, which can impair blastocyst formation and alter gene expression profiles and metabolic activity. Furthermore, previous studies have shown that compared to in vivo development, in vitro fertilization disrupts key biological processes in multiple species (mice, cattle, pigs, etc.), including genetic information processing, energy and amino acid metabolism, and cytoskeleton organization. The mechanisms underlying embryonic sensitivity to in vitro culture may involve interactions at multiple levels, including epigenetics, metabolism, and cellular components.

[0004] Telomeres are located at the ends of chromosomes to maintain genome stability. Multiple risk factors, such as oxidative stress and chronic inflammation, can lead to telomere shortening. Cellular oxidative stress (i.e., a state where pro-oxidative molecules (such as reactive oxygen species, ROS)) exceeding the scavenging capacity of antioxidants is a key mechanism, primarily acting through increased metabolic rate, inducing inflammation, or exposure to toxins. Furthermore, recent reports have highlighted the interaction between telomere length and key cellular metabolic pathways. Based on this biochemical evidence, the "metabolic telomere depletion hypothesis" has been proposed—that during periods of energy scarcity, cells break down telomeres to obtain readily available nucleotides, thereby sustaining survival in resource-limited environments. Studies show that various factors affecting individual energy balance (such as nutrient deficiency and metabolic disorders) can lead to the upregulation of metabolic mediators in animals (such as glucocorticoids and AMP-activated kinases), thereby influencing telomere length through multiple possible biochemical pathways.

[0005] Specifically, nutritional deficiencies trigger glucocorticoid / AMP-activated kinase signaling, downregulating the expression of telomere-maintaining enzymes and related proteins by inhibiting the target of rapamycin pathway. Mitochondrial ATP depletion reduces nucleotide synthesis and accelerates telomere consumption; CD38 overexpression disrupts NAD+. + Metabolism disrupts the Sirtuin 1-dependent mitochondrial axis, increases reactive oxygen species production, and leads to defects in polyADP-RNA polymerase-related genome repair, ultimately accelerating telomere dysfunction. Furthermore, Sirtuin 6 acts as a NAD+ receptor agonist. + The histone H3 lysine 9 deacetylase, which is dependent on telomere chromatin, plays a crucial role in maintaining telomere chromatin structure and genome integrity. Previous studies have found that Sirt6-deficient mice exhibit genomic instability and metabolic disorders, and typically die around 4 weeks after birth; while transgenic mice overexpressing Sirt6 have a significantly longer lifespan than wild-type mice. Increasing evidence suggests that SIRT6 plays a vital role in multiple aspects, including inhibiting genome damage, maintaining telomere integrity, promoting DNA repair, maintaining metabolic homeostasis, and alleviating oxidative stress. Although in vitro interference experiments have shown that SIRT6 deficiency in oocytes leads to early embryonic developmental arrest and telomere dysfunction in mice, its specific role in culture-induced telomere shortening remains unclear—a key knowledge gap that this invention aims to address.

[0006] Preimplantation embryonic development is a dynamic process, with the eight-cell stage to the blastocyst stage being the final stage of in vitro embryo culture and a critical period for mammalian embryo implantation. Compared to cleavage-stage embryos, blastocyst embryos are better adapted to the uterine environment and therefore have different energy requirements, necessitating appropriate culture media to meet their stage-specific energy needs. Currently available culture media for blastocyst culture include, but are not limited to, human embryo culture media G2, CSC, and G-TL, and mouse embryo culture media KSOM. In the field of assisted reproduction, G2 culture media is mainly used for culturing human embryos from the eight-cell stage to the blastocyst stage. CSC culture media (i.e., "complex embryo culture system") is often used in conjunction with advanced embryo screening technologies (such as preimplantation genetic diagnosis (PGD) / preimplantation genetic screening (PGS)) to provide a more stable and suitable growth environment for embryos by optimizing its composition and culture conditions, enabling genetic screening and diagnosis of embryos before implantation. G-TL culture media is a completely animal-free artificial culture medium that provides a more stable and suitable growth environment for embryos by optimizing culture conditions such as pH, osmotic pressure, and nutrients. KSOM medium is a culture medium specifically designed for mouse embryo culture.

[0007] Although existing blastocyst culture media are optimized based on the physiological needs of mammalian embryos before implantation, their composition is relatively fixed and cannot dynamically adapt to the stage-specific energy metabolism requirements of the preimplantation embryo. This insufficient adaptability may lead to an imbalance in mitochondrial homeostasis during embryonic development. In this case, cells may obtain ready-to-use nucleotides through the telomere shortening induction salvage pathway, thereby affecting embryonic development and increasing the long-term health risks of offspring. Therefore, there is an urgent need to develop a method and culture medium that can improve the telomere length of embryonic cells cultured from mammalian blastocysts in vitro. Summary of the Invention

[0008] The purpose of this invention is to overcome the problem that energy deficiency in existing culture media leads to mitochondrial and metabolic dysfunction in blastocyst cells, thereby affecting the telomere length of blastocysts and offspring cells. The invention provides a culture medium that protects the telomere length of embryonic cells in vitro, along with its usage and application. The aim is to improve the success rate of assisted reproductive technology (ART) and the safety of offspring by optimizing culture conditions through multi-target regulation.

[0009] Previous studies have shown that in assisted reproductive technology (ART) treatment, prolonging embryo culture to the blastocyst stage before transfer is closely related to the risk of unhealthy lifespan in offspring, specifically manifested as significantly shortened telomeres in white blood cells of infants born from blastocyst transfer. Building upon this, this invention further explores the mechanism using a mouse model: in vitro culture leads to the formation of nicotinamide adenine dinucleotide (NAD) within the blastocyst. + Sirt6 depletion leads to impaired Sirt6 function, inducing telomere shortening in the blastocyst inner cell mass, while simultaneously increasing the accumulation of reactive oxygen species (ROS) and forming NAD+. + A vicious cycle of "exhaustion → Sirt6 dysfunction → telomere shortening → ROS accumulation" was observed. Furthermore, DNA methylation analysis revealed that in vitro culture significantly increased the overall methylation level of blastocysts, while α-ketoglutarate (α-KG), a key cofactor of TET family demethylases, effectively improved the hypermethylation state induced by in vitro culture. Further whole-genome methylation sequencing of offspring one week after birth revealed that the Sirt6 promoter region methylation level in offspring born from in vitro blastocyst transfer was significantly higher than that in the naturally conceived group—suggesting that epigenetic modifications may participate in the regulation of telomere length by modulating Sirt6 expression.

[0010] To address the aforementioned problems, this invention proposes the combined addition of nicotinamide mononucleotide (NMN) and α-KG to existing culture media during various stages of mammalian embryo in vitro culture, including gamete treatment culture, fertilization operation culture, embryo culture during the division stage before the fertilized egg reaches approximately eight cells, and subsequent blastocyst culture. This is supplemented with antioxidants such as vitamin C (VitC) to achieve "energy replenishment (NMN enhances NAD50)." + This formula offers multi-dimensional protection through a combination of "level (α-KG) + epigenetic regulation (α-KG improves methylation) + antioxidant (VitC reduces ROS)". Experimental results show that this formula can effectively improve mitochondrial dysfunction caused by in vitro culture, reduce ROS production and DNA damage, and significantly restore telomere length in in vitro cultured blastocysts (telomere shortening is reversed compared to naturally developing blastocysts in vivo); at the same time, telomere length in daughter cells is also effectively maintained.

[0011] Overall, this invention is the first to elucidate NAD. + The Sirt6 axis is the core mechanism for inducing telomere shortening in blastocysts through in vitro culture. By employing a combined supplementation strategy of "NMN + α-KG + Vitamin C," comprehensive protection of telomere length and telomere homeostasis in embryos and progeny cells is achieved. This invention not only provides precise molecular targets (such as NAD+) for optimizing embryo culture conditions in ART, but also... + (Sirt6 axis, methylation regulation), and by improving telomere homeostasis in blastocysts and offspring, it provides a key theoretical framework for mitigating long-term health risks (such as metabolic diseases and shortened lifespan) in offspring conceived through ART, and is expected to significantly improve the success rate of ART treatment and the safety of offspring.

[0012] This invention provides NAD + and / or Sirt6 and / or NAD + The application of Sirt6 axis and / or mitochondrial reactive oxygen species (mtROS) and / or mitochondrial membrane potential and / or demethylases and / or telomere length as targets for protecting embryonic cell telomere length in in vitro embryo culture.

[0013] This invention also provides NAD + and / or Sirt6 and / or NAD + The application of Sirt6 axis and / or mtROS and / or mitochondrial membrane potential and / or demethylase and / or telomere length as drug targets in the development, design, screening, and preparation of drugs that protect embryonic cell telomere length in in vitro embryo culture.

[0014] The present invention also provides a regulator / promoter / activator that can regulate, promote, or activate NAD as described above. + The levels of mitochondrial membrane potential, and / or the expression and / or function of Sirt6, and / or mitochondrial membrane potential, and / or the expression and / or function of demethylases, and / or telomere length, etc.

[0015] Furthermore, the regulator / promoter / activator includes NMN, α-KG, etc.

[0016] The present invention also provides an inhibitor / antagonist / regulator that can inhibit / antagonize / regulate the level of mtROS and / or epigenetic modifications of Sirt6 as described above.

[0017] Furthermore, the inhibitors / antagonists / regulators include antioxidants such as Vitamin C.

[0018] The present invention also provides a drug / drug composition comprising the modulator / promoter / activator as described above, and / or the inhibitor / antagonist / modulator as described above.

[0019] Furthermore, the drug / drug composition can be used alone and / or in combination with other drugs.

[0020] Furthermore, the drug / drug composition includes one or more of NMN, α-KG, Vitamin C, etc.

[0021] Preferably, the pharmaceutical composition includes NMN, α-KG, and Vitamin C, wherein NMN, α-KG, and Vitamin C are added in equal proportions, and the concentration range is 1µM-1mM. Preferably, the concentration of NMN is 10µM, the concentration of α-KG is 150µM, and the concentration of Vitamin C is 50µM.

[0022] This invention also provides a culture medium for protecting the telomere length of embryonic cells in vitro. The culture medium contains components for protecting the telomere length of embryonic cells in vitro, including NMN and α-KG. NMN and α-KG synergistically protect the telomere length of embryonic cells.

[0023] Furthermore, the ingredients also include Vitamin C.

[0024] The concentration of NMN in the culture medium is 1µM-1mM; preferably, it is 10µM.

[0025] The concentration of α-KG is 1µM-1mM; preferably, it is 150µM.

[0026] The concentration of VitC is 1µM-1mM; preferably, it is 50µM.

[0027] Specifically, the base medium of the culture medium is a culture medium suitable for early in vitro embryonic development, and can be selected from any one of culture media such as G2, CSC, G-TL, KSOM, mHTF, etc., or other culture media prepared according to specific embryonic development needs.

[0028] In one specific embodiment, the base medium of the culture medium is G2 culture medium; the components and contents of the G2 culture medium are as follows: HSA 5 mg / ml, citrate 0.08 mM, lactate 6.0 mM, pyruvate 0.07 mM, glucose 3.4 mM, calcium 1.1 mM, magnesium 1.7 mM, potassium 5.8 mM, chloride 127 mM, sodium 149 mM, phosphorus 0.3 mM, chromium 0.2 µg / L, cobalt 0.2 µg / L, manganese 0.6 µg / L, iron 3 µg / L, aluminum 1 µg / L, non-essential amino acids (NEAA), essential amino acids (EAA), etc.

[0029] In one specific embodiment, the base medium of the culture medium is CSC culture medium; the components and contents of the CSC culture medium are as follows: HSA 5 mg / ml, citrate 0.01 mM, lactate 5.6 mM, pyruvate 0.17 mM, glucose 0.5 mM, calcium 1.9 mM, magnesium 0.8 mM, potassium 2.8 mM, chlorine 112 mM, sodium 135 mM, phosphorus 0.2 mM, chromium 0.7 µg / L, cobalt 0.2 µg / L, manganese 0.8 µg / L, iron 4 µg / L, NEAA, EAA, etc.

[0030] In one specific embodiment, the culture medium is G-TL culture medium; the composition and content of the G-TL culture medium are as follows: HSA 5 mg / ml, octanoate 0.344 mM, citrate 0.01 mM, lactate 10.01 mM, pyruvate 0.55 mM, glucose 0.97 mM, glutamine 10 µM, calcium 1.0 mM, magnesium 1.62 mM, potassium 5.5 mM, chloride 106 mM, sodium 137 mM, phosphorus 0.25 mM, NEAA, EAA, etc.

[0031] In one specific embodiment, the base medium of the culture medium is KSOM culture medium; the composition and content of the KSOM culture medium are: BSA 1 g / L, NaCl 5.55 g / L, KCl 0.19 g / L, KH2PO4 0.05 g / L, MgSO4 7H2O 0.05 g / L, CaCl2 2H2O 0.25 g / L, NaHCO3 2.1 g / L, sodium lactate 1.12 g / L, sodium pyruvate 0.02 g / L, glucose 0.04 g / L, glutamine 0.146 g / L, penicillin G potassium salt 0.06 g / L, phenol red 0.001 g / L, streptomycin sulfate 0.05 g / L, EDTA 0.004 g / L, etc.

[0032] In one specific embodiment, the base medium of the culture medium is mHTF culture medium; the composition and content of the mHTF culture medium are as follows: sodium chloride 97.6mM, potassium chloride 4.7mM, magnesium carbonate (or magnesium sulfate) 0.2mM, calcium chloride 2.04mM; sodium pyruvate 0.33mM, sodium lactate 21.4mM; gentamicin 50µg / ml, phenol red 0.001%wt / vol; sodium bicarbonate 25.0mM, 4-hydroxyethylpiperazine ethanesulfonic acid 25mM, etc.

[0033] Furthermore, the base solution of the culture medium includes the removal of components of the culture medium (base solution) as described above, the substitution of similar substances, or the increase or decrease of their content within a range of 30%.

[0034] Specifically, the non-essential amino acids (NEAAs) include one or more of the following: glutamic acid, glutamine, alanine, asparagine, glycine, aspartic acid, cystine, proline, serine, tyrosine, and taurine; preferably, they are glutamic acid, glutamine, alanine, asparagine, aspartic acid, glycine, proline, serine, and taurine.

[0035] Specifically, the essential amino acids (EAAs) include one or more of arginine, cysteine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, tyrosine, and valine; preferably, they are arginine, cysteine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, tyrosine, and valine.

[0036] Specifically, the culture medium is used for in vitro culture of mammalian (including human) embryos, including gamete treatment culture, fertilization operation culture, mitotic embryo culture before the fertilized egg develops to about eight cells, and subsequent blastocyst culture, etc.

[0037] The NMN / α-kG / VitC described in this invention works synergistically with the base solution.

[0038] The present invention also provides the application of the culture medium in protecting the telomere length of embryonic cells during in vitro embryo culture.

[0039] In this invention, the addition of NMN, α-KG, and Vitamin C to existing culture media to improve mitochondrial function in mammalian blastocysts cultured in vitro, thereby extending telomere length, is a technical concept that is not readily apparent. The timing of this addition is crucial. Embryonic development involves stage-specific metabolic transitions, with significantly different nutritional requirements at different stages. Therefore, the timing of addition must strictly correspond to metabolic milestones: NMN should be added after the eight-cell stage, when the embryo begins its metabolic transition from pyruvate to glucose and NAD+. + The embryo is most severely depleted and requires timely NMN supplementation to restore Sirt6 (a key protein for telomere homeostasis) function. α-KG should be added after the eight-cell stage, when TET enzyme activity begins to increase, regulating Sirt6 promoter demethylation; adding α-KG at this time can activate the demethylation process. Vitamin C should be continuously added from the four- to eight-cell stage, when the embryo is most sensitive to oxidative stress and mtROS accumulates the most, requiring continuous addition to scavenge free radicals. The stability, precise ratio, and compatibility with existing culture media of these three components are the core challenges. Adding these three components to the culture medium requires ensuring their stability and bioavailability in the culture medium. Since these three components are all key regulators of embryonic metabolism, they need to be rationally ratiod to ensure that each component can fully exert its function. In addition, the interactions between other components in the culture medium and these three components need to be considered to avoid possible side effects or interference. Existing studies are mostly single-component, short-term experiments, lacking data on the safety of multi-component combinations and long-term offspring. The long-term effects of α-KG regulation of Sirt6 methylation remain unclear, and whether it will lead to "transgenerational inheritance effects" (such as abnormal Sirt6 expression in offspring) needs further verification. Whether NMN supplementation affects glucose and lipid metabolism in offspring (such as the incidence of obesity and diabetes) requires long-term follow-up. Whether the synergistic effects of these three factors exhibit "additive effects" or "antagonistic effects" needs to be verified through transcriptome sequencing (analyzing blastocyst gene expression) and metabolomics (analyzing changes in blastocyst metabolites). When conducting research involving germ cells, such as in vitro culture of mammalian blastocysts, strict adherence to relevant ethical and regulatory requirements is necessary. This includes ensuring the legality of the research, protecting the rights of research participants, and following relevant research norms and standards. These constraints may, to some extent, limit the implementation and application of the technology.

[0040] The present invention also provides a method for using the culture medium component for protecting the telomere length of embryonic cells in in vitro embryo culture as described above. The method includes: the culture medium component for protecting the telomere length of embryonic cells in in vitro embryo culture as described above can be directly prepared as a culture medium component in the above-mentioned base solution, or it can be prepared as an additive solution as a high-concentration liquid and added to the above-mentioned base solution for dilution during use.

[0041] The present invention also provides a method for protecting the telomere length of embryonic cells in in vitro embryo culture, the method comprising: using the culture medium as described above for in vitro culture of mammalian (including human) embryos; wherein the embryo culture includes gamete treatment culture, fertilization operation culture, mitotic embryo culture before the fertilized egg develops to about eight cells, and subsequent blastocyst culture, etc.

[0042] In one specific embodiment, the method includes the following steps:

[0043] (1) Optimization of culture medium

[0044] The parameters were optimized by adding NMN, Vitamin C, and / or α-KG to the culture medium after eight cells;

[0045] The supplement NMN is NAD. + A direct precursor to NAD+, supplementing NAD+ in embryos during in vitro culture. + The telomere shortening is salvaged by depletion and restoration of Sirt6 function.

[0046] The supplement Vitamin C is a powerful antioxidant that inhibits intracellular oxidative stress, eliminates ROS accumulated in in vitro culture, blocks the vicious cycle of "telomere shortening → ROS accumulation," reduces DNA damage, and thus reduces telomere loss.

[0047] The supplement α-KG is a key cofactor of TET family demethylases, which reduces the methylation level of the Sirt6 promoter region in blastocysts and progeny, restores long-term Sirt6 expression, and thus rescues telomere shortening.

[0048] The parameters, such as the pH and osmotic pressure of the culture medium, are crucial for improving mitochondrial function.

[0049] (2) Control of culture conditions

[0050] Precisely controlling cell culture conditions, including the temperature, humidity, and gas composition (such as oxygen and carbon dioxide concentration) of the incubator, to simulate the optimal environment for blastocyst development in vivo and reduce the stress response caused by in vitro culture, is key to improving mitochondrial function.

[0051] (3) Collection and processing

[0052] After the blastocysts develop to a certain stage, they are collected and tested, including telomere length measurement, mitochondrial membrane potential, mitochondrial reactive oxygen species level, cell number and apoptosis rate, to verify the effectiveness of the method of the present invention.

[0053] In step (1), the embryo is in the optimal initial state as follows: well-developed and with normal morphology.

[0054] In step (1), the culture medium is selected from any one of the culture media such as G2, CSC, G-TL, KSOM, and mHTF.

[0055] In step (1), the added NAD + The concentration of the NMN supplement is 1µM-1mM; preferably, it is 10µM.

[0056] In step (1), the concentration of added Vitamin C is 1µM-1mM; preferably, it is 50µM.

[0057] In step (1), the concentration of the added α-KG is 1µM-1mM; preferably, it is 150µM.

[0058] In step (1), the parameters include the pH value and osmotic pressure of the culture medium;

[0059] The culture medium has a pH of 7.2-7.3 and an osmotic pressure of 256 mOsmol.

[0060] In step (2), the composition and concentration of the cultured gas are: 5% oxygen, 6% carbon dioxide (G2, CSC, G-TL) or 5% (KSOM).

[0061] In step (2), the culture conditions include:

[0062] The culture temperature was 37°C;

[0063] The humidity during cultivation is 30%-95%.

[0064] The culture time is 1-2 days.

[0065] In step (2), the optimal environment for the blastocyst to develop in vivo is: suitable temperature and humidity, and a specific gas environment.

[0066] In step (3), the blastocyst develops to a certain stage and the blastocoel is completely filled with the embryo, the total volume of the embryo increases, and the zona pellucida becomes thinner.

[0067] The present invention also provides a biomarker for predicting the success rate of assisted reproductive technology (ART) treatment and / or the safety of offspring, said biomarker including NAD as described above. + and / or Sirt6 and / or NAD + -Sirt6 axis and / or mitochondrial reactive oxygen species and / or demethylases and / or mitochondrial membrane potential and / or telomere length, etc.

[0068] The present invention also provides a method for screening candidate drugs that protect telomere length in embryonic cells during in vitro embryo culture, the method comprising detecting the effect of the candidate drug on NAD in a sample of in vitro cultured embryos as described above. + and / or Sirt6 and / or NAD + The biological effects of the Sirt6 axis and / or mitochondrial reactive oxygen species and / or mitochondrial membrane potential and / or demethylases and / or telomere length, etc.

[0069] Among these, after using the candidate drug, it can produce an increase / regulation / promotion / activation of NAD as described above. + The effects of the candidate drug on the biological effects of levels, and / or Sirt6 expression and / or function, and / or mitochondrial membrane potential, and / or demethylase expression or function, and / or telomere length, etc., indicate that the candidate drug has the effect of protecting embryonic cell telomere length, etc. in in vitro embryo culture.

[0070] The fact that the candidate drug, after use, produces biological effects such as inhibiting / antagonizing / regulating the level of mitochondrial reactive oxygen species and / or epigenetic modifications of Sirt6 as described above indicates that the candidate drug has the effect of protecting the length of embryonic cells telomeres in in vitro embryo culture.

[0071] The present invention also provides a method for predicting the success rate of assisted reproductive technology (ART) treatment and / or the safety of offspring, the method comprising: determining the NAD content as described above in a sample of in vitro cultured embryos. + The levels of mitochondrial reactive oxygen species and / or mitochondrial membrane potential, and / or the expression and / or function of Sirt6 and / or the level of epigenetic modifications, and / or the expression or function of demethylases, are used to predict the success rate of assisted reproductive technology (ART) treatment for the patient and / or the safety of offspring.

[0072] The present invention also provides a method for protecting the telomere length of embryonic cells in in vitro embryo culture, the method comprising administering an effective amount of the regulator / promoter / activator as described above, and / or the inhibitor / antagonist / regulator as described above, and / or the drug / drug composition as described above, to a sample of in vitro cultured embryos.

[0073] Specifically, the embryo is preferably a mammal, including but not limited to humans, primates, livestock (such as sheep, cattle, horses, donkeys, and pigs), pets (such as dogs and cats), laboratory test animals (such as mice, rabbits, rats, guinea pigs, and hamsters), or captured wild animals (such as foxes and deer). Preferably, the object is a primate. Most preferably, the object is a human.

[0074] This invention also provides the following applications of the culture medium, method, regulator / promoter / activator, inhibitor / antagonist / regulator, drug / drug composition, or biomarker described above in in vitro culture to protect the telomere length of embryonic cells, protect the normal development of in vitro cultured embryos, promote the division, differentiation, and proliferation of blastocyst cells, improve the quality and developmental capacity of blastocysts, reduce DNA damage, maintain the integrity of the blastocyst genome, enhance the resistance of blastocysts to stress factors, reduce blastocyst developmental disorders and apoptosis caused by stress, reduce the negative impacts that may occur during the in vitro culture of mammalian blastocysts, effectively prolong the telomere length of blastocysts and the telomere length of subsequent offspring, improve the efficiency and success rate of ART treatment, reduce the genetic risks associated with ART treatment, and improve the success rate and safety of offspring in assisted reproductive technology (ART) treatment.

[0075] In this invention, the culture medium components that protect the telomere length of embryonic cells during in vitro embryo culture can effectively improve mitochondrial function in in vitro cultured embryos, reduce the production of reactive oxygen species, and increase mitochondrial membrane potential, thereby protecting the telomere length of embryonic cells. This effectively protects the normal development of in vitro cultured embryos, especially preventing shortening of telomere length in blastocysts and subsequent offspring. It also helps optimize in vitro embryo culture conditions, thereby improving the success rate of assisted reproductive technology (ART) treatment and the safety of offspring; and / or,

[0076] The epigenetic modification includes transient hypermethylation of the Sirt6 promoter region; the Sirt6 promoter methylation inhibits its expression, resulting in telomere shortening.

[0077] In this invention, the drug has at least one of the following effects:

[0078] (1) Regulate, promote, or activate NAD as described above + The level of; and / or the expression and / or function of Sirt6, and / or the mitochondrial membrane potential, and / or the expression and / or function of the demethylase, and / or the telomere length;

[0079] (2) The inhibitor / antagonist / regulator can inhibit / antagonize / regulate the level of ROS as described in claim 1 or 2, and / or the epigenetic modification of Sirt6;

[0080] (3) Protecting the length of embryonic cell telomeres;

[0081] (4) To protect the normal development of in vitro cultured embryos;

[0082] (5) Avoid shortening the telomere length of the blastocyst and subsequent offspring;

[0083] (6) Optimization of in vitro embryo culture conditions;

[0084] (7) Improve the success rate of assisted reproductive technology (ART) treatment and the safety of offspring.

[0085] In summary, this invention provides a compound embryo culture medium additive, which is composed of NMN and α-kG mixed in a specific ratio and supplemented with antioxidants such as Vitamin C. When added to the embryo culture medium, it can significantly prolong the telomere length of the cell mass in the blastocyst stage and improve the telomere length of offspring. The above effects cannot be achieved by adding NMN, α-kG or Vitamin C alone.

[0086] This invention provides a novel and efficient method for improving the telomere length of mammalian blastocyst embryo cells in vitro. This method achieves mitochondrial homeostasis by optimizing the culture environment, precisely controlling culture conditions, and using dynamic monitoring and adjustment strategies, thereby effectively extending telomere length and providing a new technical approach for the in vitro culture of mammalian blastocysts.

[0087] The term "blastocyst" in this invention refers to a structure that forms during the early development of a mammal. It possesses an inner cell mass (ICM) and subsequently develops into an embryo. The outer layer of the blastocyst consists of cells collectively called the trophoblast, which surrounds the inner cell mass and a fluid-filled cavity called the blastocoel. The trophoblast produces the placenta.

[0088] The term "mitochondria" in this invention refers to a semi-autonomous organelle in eukaryotic cells, which has a double-membrane ultrastructure (the outer membrane and the highly folded inner membrane form a cristae system). It catalyzes the tricarboxylic acid cycle and electron transport chain reactions through oxidative phosphorylation to generate ATP, the cell's energy currency, and is the main site of aerobic respiration in cells.

[0089] The term "telomere" in this invention refers to the DNA-protein complex at the ends of eukaryotic chromosomes, whose main function is to prevent chromosome degradation or fusion during replication. Its length gradually shortens with cell division, and when it shortens to a critical value, it triggers cellular senescence or apoptosis.

[0090] The beneficial effects of this invention are as follows: In one specific embodiment, this invention proposes adding NMN and α-KG in a certain proportion to existing culture media suitable for blastocyst culture, supplemented with antioxidants such as Vitamin C. The beneficial effects are reflected in: First, NMN acts as NAD+... + The precursor to nicotinamide adenine dinucleotide (NAD) can effectively supplement NAD in embryos cultured in vitro. +The combined addition of these components significantly prolongs telomere length in offspring (1 week after birth). Firstly, it depletes Sirt6 and restores its functional activity, thereby inhibiting telomere shortening in the blastocyst inner cell mass. Secondly, Vitamin C, as a strong antioxidant, can scavenge ROS accumulated due to mitochondrial dysfunction during in vitro culture, while reducing DNA damage and breaking the vicious cycle of "telomere shortening → ROS accumulation → further telomere damage," maintaining mitochondrial membrane potential stability. Finally, α-KG, as a key cofactor of TET family demethylases, can reduce the methylation level of the Sirt6 promoter region in blastocysts and progeny, alleviating the inhibition of Sirt6 by in vitro culture and restoring its regulatory function on telomere length. The multi-target combination of NMN, α-KG, and Vitamin C achieves the dual goals of "short-term repair of mitochondrial function and maintenance of telomere homeostasis" and "long-term improvement of offspring's epigenetic and health risks." It effectively solves key problems such as mitochondrial dysfunction and telomere shortening caused by insufficient energy metabolism in existing embryo culture media, providing important support for improving the success rate of ART and the safety of offspring.

[0091] The beneficial effect of this invention also lies in the fact that telomere length is important for maintaining individual health in a species. Recent studies have shown that in vitro fertilization therapy may significantly reduce telomere length in offspring, but the underlying molecular mechanisms remain unclear. Sirt6 is a NAD+ receptor agonist. + NAD+, an epigenetic regulator, has recently been found to play a crucial role in maintaining telomere stability. This invention proposes that NAD+ in cultured blastocysts... + A deficiency can impair Sirt6 function, leading to telomere shortening in inner cell mass and potentially affecting newborns. Supplementation with nicotinamide mononucleotide (NAD) during in vitro culture is recommended. + Precursor (mtROS) can effectively alleviate this phenotype. Furthermore, the accumulation of mtROS and epigenetic modifications may also be involved in this process; the addition of Vitamin C and α-KG can correspondingly eliminate these adverse changes. The results of this invention reveal the mechanism of in vitro culture-induced telomere shortening in preimplantation embryos, providing potential targets for improving in vitro culture conditions. Attached Figure Description

[0092] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0093] Figure 1The preimplantation telomere lengths of embryonic cells in Examples 1, 2, 1, 2, 3, and 4 of this invention are shown, wherein: Figure 1 A represents the blastocyst images of Examples 1, 2, 1, 2, 3, and 4 of this invention. Figure 1 B represents the telomere length of blastocyst cells in Examples 1, 2, 1, 2, 3, and 4 of this invention.

[0094] Figure 2 The reactive oxygen species (ROS) levels (2B) and mitochondrial membrane potentials (2D) of blastocyst cells in Examples 1, 2, 1, 2, 3, and 4 of this invention are shown. Figure 2 A represents the reactive oxygen species staining images of blastocysts from Examples 1, 2, Comparative Examples 1, 2, 3, and 4 of this invention. Figure 2 C. Representative images of mitochondrial membrane potential staining in blastocyst cells from Examples 1, 2, 1, 2, 3, and 4 of this invention.

[0095] Figure 3 The number of blastocyst cells (3B) and apoptosis rate (3C) of Examples 1, 2, 1, 2, 3, and 4 of the present invention are shown, wherein... Figure 3 A represents the apoptosis staining images of blastocysts in Examples 1, 2, 1, 2, 3, and 4 of this invention.

[0096] Figure 4 This invention shows a comparison of the birth rate (4A) and telomere length (4B) of offspring born from blastocyst transfer in Examples 1, 1, and 2 of the present invention.

[0097] Figure 5 This invention shows a comparison of telomere length in human blastocyst cells from Examples 3, 4, 5, 6, and 7.

[0098] Figure 6 The NAD values ​​shown in Comparative Examples 1 and 2 of this invention are... + (6D) and Sirt6 expression (6A-B) and their effect on telomere length (6F), among which Figure 6 C is a representative image of Sirt6 immunofluorescence staining of the inner cell mass of the blastocyst in Comparative Examples 1 and 2 of this invention. Figure 6E represents the blastocyst images of Comparative Examples 1, 2, 3 (KSOM+NMN optimized group), 8 (KSOM+low concentration Sirt6 inhibitor group), 9 (KSOM+high concentration Sirt6 inhibitor group), and 10 (KSOM+high concentration Sirt6 inhibitor+NMN group) of this invention.

[0099] Figure 7 The demethylation levels (7B) of Comparative Examples 1, 2, and 4 of this invention and the methylation levels (7C) of the Sirt6 promoter in 1-week-old F1 generation after blastocyst transfer are shown, wherein: Figure 7 A is a representative image of methylation staining of Comparative Examples 4, 1, and 2 of this invention. Detailed Implementation

[0100] The present invention will be further described in detail below with reference to the specific embodiments and accompanying drawings. Except for the contents specifically mentioned below, the processes, conditions, and experimental methods for implementing the present invention are all common knowledge and general knowledge in the art, and the present invention does not have any particular limitations.

[0101] The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the invention or its application or use. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.

[0102] In all examples shown and discussed herein, any specific values ​​should be interpreted as merely exemplary and not as limitations. Therefore, other examples of exemplary embodiments may have different values.

[0103] This invention discloses a culture medium for protecting telomere length in in vitro culture, along with its usage and applications. The aim is to address the issues of telomere shortening and offspring health risks associated with assisted reproductive technology (ART) by optimizing in vitro culture conditions. This invention proposes adding nicotinamide mononucleotide (NMN) and α-ketoglutarate (α-KG) in a specific ratio to existing embryo culture media, supplemented with antioxidants such as vitamin C (VitC). The combination of NMN and α-KG effectively enhances mitochondrial function in in vitro cultured embryos, improves DNA methylation levels of related genes, restores telomere length in in vitro cultured blastocysts, and prevents significant telomere shortening in offspring. Antioxidants such as Vitamin C reduce mitochondrial reactive oxygen species (mtROS) production, enhancing the stability of the effect. In this formulation, the specific ratio of NMN to α-KG is the core of improving telomere length, while antioxidant components such as Vitamin C enhance the stability of the effect.

[0104] In the embodiments of the present invention described below, PMSG and hCG were purchased from Ningbo Sansheng Biotechnology Co., Ltd., mice were purchased from Jessage Laboratory Animal Co., Ltd., NMN (N3501) was purchased from Sigma-Aldrich, Inc., USA, α-KG (328-50-7) was purchased from MedChemExpress, Inc., USA, VitC (BD151371) was purchased from Huade Pharmaceutical Co., Ltd., KSOM (MR-107) was purchased from Merck Group Darmstadt, Germany, and G2 was purchased from Vitrolife, Sweden.

[0105] Experimental methods in the following embodiments of the present invention:

[0106] blastocyst cell telomere length detection

[0107] The average telomere length of blastocysts was determined using qPCR. First, individual blastocysts were collected and lysed in 0.2 ml PCR tubes, heated at 95°C for 10 minutes, and then allowed to stand at room temperature for 5 minutes to obtain blastocyst genomic DNA. Next, pre-amplification was performed using Phanta Flash Super Fidelity DNA polymerase by aliquoting 18 μL of premixed buffer into 0.2 ml PCR tubes, each containing 2 μL of mouse single-cell genomic DNA, to construct the reaction system. Each reaction consisted of 10 µL of 2×Phanta Flash Master Mix, 1 µL each of 10 µM telomere forward and reverse primers (mB1: F / GCACCTTTAATCCCAGCAC (SEQ ID NO.1), R / TGAGACAGGGTTTCTCTGTA (SEQ ID NO.2)), and 1 µL each of 10 µM internal control gene forward and reverse primers (Tel: F / CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGGTTT (SEQ ID NO.3); R / GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT (SEQ ID NO.4)), and sufficient water to form a final volume of 20 µL. The thermal cycler reaction conditions were: 98 °C for 30 seconds, followed by 16 cycles of 98 °C for 10 seconds, 60 °C for 5 seconds, 72 °C for 10 seconds, and a final extension at 72 °C for 1 minute. The PCR products were purified according to the purification kit (D4014; Zymo Research) and eluted in 100 μL of double-distilled water. Finally, a reaction was constructed in a 384-well plate using SYBR Green I. For each reaction, 5 μL of 2× SYBR Green mix (VazymeBiotech), 1 μL each of the aforementioned 10 μM telomere and internal control forward and reverse primers (as shown in SEQ ID NO. 1-4), 2 μL of molecularly filtered water, and 1 μL of genomic DNA were added to obtain 10 μL of reaction solution. DNA samples were placed in three adjacent wells of the 384-well plate, one for telomere primers and the other for the internal control gene primers (as shown in SEQ ID NO. 1-4). Using a Bio-Rad thermal cycler (CFX system for testing), the reaction conditions were 95°C for 10 minutes. Data was then collected 40 times at 95°C for 15 seconds, followed by annealing at 60°C for 30 seconds, an extension at 72°C for 30 seconds, and 80 melting curve cycles from 60°C to 95°C. After thermal cycling, standard curves and Ct values ​​for telomere and internal reference gene signals were generated using the CFX Manager software. The average telomere length of blastocyst cells is referred to as the telomere / reference gene (T / R) ratio.

[0108] Blastocyst reactive oxygen species detection

[0109] Blastocysts were stained by incubating them with ROS orange working solution (Abcam) at 37°C for 30 minutes. The total fluorescence intensity of the blastocysts was detected using a confocal microscope at Ex / Em = 540 / 570 nm. After background signal correction, the fluorescence intensity was normalized to 100% relative to the control group, and the experimental group fluorescence intensity was expressed as a percentage relative to the control group.

[0110] Detection of mitochondrial membrane potential in blastocysts

[0111] JC-1 was diluted by adding 200 µl of JC-1 staining buffer to every 1 µl of JC-1 (200X). The JC-1 staining working solution was prepared by repeatedly pipetting and mixing. Then, the culture medium and JC-1 staining working solution were mixed at a 1:1 ratio, inverting several times to ensure thorough mixing. The blastocysts were then stained with this mixture and incubated at 37°C for 20 minutes. After staining, the blastocysts were washed three times with culture medium and observed under a fluorescence microscope. Changes in mitochondrial membrane potential could be assessed by analyzing the relative proportions of red and green fluorescence.

[0112] Blastocyst apoptosis rate detection

[0113] Blastocysts were transferred to PBS supplemented with 2% paraformaldehyde for fixation, followed by permeabilization in 0.25% Triton X-100 at 37°C for 20 minutes. Using a one-step TUNEL apoptosis detection kit (Beyotime), after washing with PBS, the fixed blastocysts were placed in TUNEL detection solution and incubated at 37°C in the dark for 60 minutes. After the reaction, the blastocysts were washed three times with PBS, mounted with a 1:10 anti-fluorescence quenching mounting medium containing DAPI (H-1200; Vector Laboratories), and observed under a fluorescence microscope. Quantitative analysis of apoptotic cell nuclei and the total number of nuclei was performed using confocal microscopy.

[0114] offspring birth rate

[0115] Before each blastocyst transfer, pseudopregnant mice were anesthetized, and the uterine horn was removed from behind. Thirty blastocysts from each group were transferred to a single uterine horn, and the number of F1 pups born 19-21 days later was recorded. The total number of F1 pups born divided by the total number of blastocysts transferred equals the offspring birth rate.

[0116] Detection of telomere length in offspring cells

[0117] Total genomic DNA was extracted using the TIANamp Genomic DNA Kit (DP304; TIANGEN) according to the manufacturer's instructions. Animal tissue was treated with 200 μL of buffer GA and 20 μL of proteinase K, mixed thoroughly, and incubated at 56°C until tissue lysis. After a brief centrifugation, 200 μL of buffer GB was added, and the mixture was thoroughly inverted and incubated at 70°C for 10 min. After a brief centrifugation, 200 μL of anhydrous ethanol was added, and the mixture was thoroughly vortexed for 15 sec. After a brief centrifugation, the solution and any resulting flocculent precipitate were added to an adsorption column and centrifuged at 12,000 rpm for 30 sec. The waste liquid was discarded, and the adsorption column was returned to the collection tube. 500 μL of buffer GD was added to the adsorption column, and the column was centrifuged at 12,000 rpm for 30 sec. The waste liquid was discarded, and the column was returned to the collection tube. 600 μL of wash buffer PW was added to the adsorption column, and the column was centrifuged at 12,000 rpm for 30 sec. The waste liquid was discarded, and the column was returned to the collection tube. After repeating the PW cleaning, place the adsorption column back into the collection tube, centrifuge at 12,000 rpm for 2 min, discard the waste liquid, and let the adsorption column stand at room temperature for 3-4 min. Transfer the adsorption column to a clean centrifuge tube, add 100 μL of ddH2O dropwise to the center of the adsorption membrane, let stand at room temperature for 2 min, centrifuge at 12,000 rpm for 2 min, and collect the solution in the centrifuge tube.

[0118] Reactions were constructed using SYBR Green I in 384-well plates. For each reaction, 5 μL of 2×SYBR Greenmix (Bio-Rad), 1 μL each of 10 μM forward and reverse primers, 2 μL of molecularly filtered water, and 1 μL of genomic DNA were added to obtain 10 μL of reaction solution. DNA samples were placed in three adjacent wells of the 384-well plate, one for telomere primers and the other for the internal control gene primers. A Bio-Rad thermal cycler (CFX system) was used at 95°C for 10 minutes. Data was then collected 40 times at 95°C for 15 seconds, followed by annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, and 80 melting curve cycles from 60°C to 95°C. After thermal cycling, standard curves and Ct values ​​for telomere and internal control gene signals were generated using the CFX manager software. The average telomere length is referred to as the T / R ratio.

[0119] Real-time quantitative PCR analysis of genes

[0120] After mouse blastocysts were collected, RNA transcriptome amplification was performed using a single-cell sequence-specific amplification kit (P621; Vazyme Biotech, Nanjing, China), amplifying cDNA through 18 PCR cycles. Subsequently, 10-fold diluted cDNA was used as a template for qPCR. qPCR was performed on a QuantStudio 6-Flex real-time PCR system (AppliedBiosystems, Life Technologies) using TB Green Premix Ex Taq (R420Q; Takara) according to the manufacturer's instructions. 10 μM Actin (Actin: F / CCTAGGCACCAGGGTGTGAT (SEQ ID NO. 5), R / AGCAGGGTGCTCCTCA (SEQ ID NO. 6)) was used as an internal control, and primers for other genes were as follows (Sirt6: F / ACGCAGTACGTCAGAGACAC (SEQ ID NO. 7), R / GTCTCTCAGCTCCCCTCTACA (SEQ ID NO. 8)).

[0121] Immunofluorescence staining

[0122] After removing the zona pellucida with acidic stroma solution, mouse blastocysts were placed in 2% paraformaldehyde PBS solution and fixed at room temperature for 60 minutes or overnight at 4°C. Subsequently, the blastocysts were transferred to 0.25% Triton X-100 solution and permeabilized at room temperature for 20 minutes. The blastocysts were washed three times with PBS containing 1% BSA, and then blocked in PBS containing 1% BSA at room temperature for 1 hour. Sirt6 antibody (ab191385; Abcam), Oct3 / 4 antibody containing Alexa Fluor™ 488 (53-5841-82, invirogen), and γ-H2A.X antibody (05-636, EMD Millipore) were diluted in PBS containing 1% BSA at ratios of 1:200, 1:50, and 1:150, respectively, and then the blastocysts were incubated overnight at 4°C. The following day, the blastocysts were washed three times with PBS containing 1% BSA. Then, DyLight 594 / 647-conjugated goat anti-rabbit immunoglobulin G (H & L) antibody (bs-0295D-BF594, bs-0296G-AF647; Bios) was diluted 1:200 in PBS containing 1% BSA, and the blastocysts were incubated at room temperature for 1 hour. After mounting with a DAPI-containing anti-fluorescence quenching mounting medium (1:10), the slides were observed under a fluorescence microscope. In this study, all signals were normalized to DAPI fluorescence intensity and analyzed using ImageJ software.

[0123] 5mC and 5hmC immunofluorescence staining

[0124] After removing the zona pellucida with acidic stroma solution, mouse blastocysts were placed in 2% paraformaldehyde PBS solution and fixed at room temperature for 60 minutes or overnight at 4°C. The blastocysts were washed three times with PBS containing 1% BSA and then transferred to 0.2% Triton X-100 solution for permeabilization at room temperature for 20 minutes. Subsequently, the blastocysts were transferred to 4M HCl for denaturation for 10 minutes, followed by neutralization in PBS containing 1% BSA for 10 minutes. The blastocysts were then blocked at room temperature for 1 hour in PBS containing 0.2% Triton X-100 and 5% BSA. 5mC and 5hmC antibodies were diluted 1:100 with PBS containing 1% BSA, and the blastocysts were incubated overnight at 4°C. The following day, the blastocysts were washed three times with PBS containing 1% BSA. Next, the DyLight 594-conjugated goat anti-rabbit immunoglobulin G (H&L) antibody was diluted 1:200 with PBS solution containing 1% BSA, and the blastocysts were incubated at room temperature for 1 hour. Subsequently, the DyLight 488-conjugated goat anti-rabbit immunoglobulin G (H+L) antibody was also diluted 1:200 and incubated at room temperature for 1 hour. Finally, the blastocysts were stained with Hoechst 33342 staining solution (1:10 dilution) for 10 minutes, and the results were observed and recorded under a fluorescence microscope.

[0125] Whole genome methylation sequencing

[0126] First, genomic DNA was sonicated and then subjected to end repair, adenine tailing, and adapter ligation. Following the manufacturer's instructions, the genomic DNA was bisulfite-treated using the EZ-DNA Methylation Gold Kit (D5001; Zymo Research) before PCR amplification. Next, Trimmomatic (version 0.33) was used to remove adapters and low-quality bases from all bisulfite-treated sequencing reads. Then, quality-controlled paired-end reads were mapped to the mouse reference genome (GRCm39) in paired-end mode using bismark (version 0.16.3). Quality-controlled single-end reads were mapped to the reference genome in single-end mode. Reads were then sorted using Samtools and Picard, and PCR duplicates were removed. Finally, all incompletely transformed non-CpG cytosine sequencing reads were removed before determining DNA methylation status. To extract cytosine methylation status, bismark_methylation_extractor was applied to both paired-end and single-end reads. For each CpG site, the methylation level is determined by the ratio of the proportion of methylated cytosine in the reads covering that CpG to the total number of reads covering that CpG. The DNA methylation level of the Sirt6 gene promoter region is determined by the average DNA methylation level of all covered CpG sites.

[0127] Example 1

[0128] Example 1 of this invention provides a method and culture medium for protecting the telomere length of mouse blastocyst cells in vitro, labeled as the KSOM+NMN+α-KG optimized group, including the following steps:

[0129] 1. Female mice were injected intraperitoneally with 10 IU of pregnant mare serum gonadotropin (PMSG), and 48 hours later, human chorionic gonadotropin (hCG) was injected intraperitoneally. The mice were then placed in the same cage as male mice. The next morning at 7:00, the female mice were examined at the vaginal opening to determine whether mating had occurred.

[0130] 2. Nineteen hours after hCG treatment, in vivo fertilized eggs were collected from the fallopian tubes and treated with hyaluronidase for 3-5 minutes. The fertilized eggs were rinsed with mHTF-SSS and cultured in 20 µL KSOM medium until cleavage. Then, they were transferred to 20 µL KSOM medium supplemented with NMN and α-KG for in vitro culture until D4.5 blastocysts. The culture conditions were 37℃, humidity 30%-95%, and 5% CO2. During the culture process, the development of the blastocysts was monitored regularly.

[0131] Preparation method of KSOM culture medium with added NMN and α-KG: Prepare 10mM and 150mM concentrated stock solutions by diluting NMN and α-KG with water respectively. Then add NMN and α-KG to the KSOM culture medium at final concentrations of 10µM and 150µM respectively. Make 20µL microdroplets of KSOM culture medium containing NMN and α-KG, cover with mineral oil and equilibrate overnight. On the third day, transfer mouse blastocysts cultured to eight cells to the culture medium with added NMN and α-KG for further culture.

[0132] The KSOM culture medium consisted of NaCl (5.55 g / L), KCl (0.19 g / L), KH₂PO₄ (0.05 g / L), and MgSO₄. 7H2O (0.05 g / L), CaCl2 2H2O (0.25 g / L), NaHCO3 (2.1 g / L), sodium lactate (1.12 g / L), sodium pyruvate (0.02 g / L), glucose (0.04 g / L), glutamine (0.146 g / L), EDTA (0.004 g / L), BSA (1 g / L), potassium penicillin G (0.06 g / L), phenol red (0.001 g / L), streptomycin sulfate (0.05 g / L).

[0133] 3. Observe changes in telomere length, mitochondrial membrane potential, reactive oxygen species level, cell number, apoptosis rate, offspring birth rate, and telomere length in blastocyst cells. Results are shown in […]. Figure 1-4 .

[0134] Example 2

[0135] Example 2 of this invention provides a method and culture medium for protecting the telomere length of mouse blastocyst cells in vitro, labeled as the KSOM+NMN+α-KG+VitC optimized group, including the following steps:

[0136] 1. Female mice were injected intraperitoneally with 10 IU of pregnant mare serum gonadotropin (PMSG), and 48 hours later, human chorionic gonadotropin (hCG) was injected intraperitoneally. The mice were then placed in the same cage as male mice. The next morning at 7:00, the female mice were examined at the vaginal opening to determine whether mating had occurred.

[0137] 2. Nineteen hours after hCG treatment, in vivo fertilized eggs were collected from the fallopian tubes and treated with hyaluronidase for 3-5 minutes. The fertilized eggs were washed with mHTF-SSS and cultured in 20 µL KSOM medium until cleavage. Then, they were transferred to 20 µL KSOM medium supplemented with NMN, α-KG and Vitamin C for in vitro culture until D4.5 blastocysts. The culture conditions were 37℃, humidity 30%-95%, and 5% CO2. During the culture process, the development of the blastocysts was monitored regularly.

[0138] Preparation method of KSOM culture medium with added NMN, α-KG and Vitamin C: Prepare a 10mM concentrated stock solution by diluting NMN and Vitamin C with water, and prepare a 150mM concentrated stock solution by diluting α-KG with water. Then, add NMN, α-KG and Vitamin C to the KSOM culture medium at final concentrations of 10µM, 150µM and 50µM respectively. Prepare 20µL droplets of KSOM culture medium containing NMN, α-KG and Vitamin C, cover with mineral oil and allow to equilibrate overnight. On the third day, transfer mouse blastocysts cultured to eight cells to the culture medium with added NMN, α-KG and Vitamin C for further culture.

[0139] The KSOM culture medium consisted of NaCl (5.55 g / L), KCl (0.19 g / L), KH₂PO₄ (0.05 g / L), and MgSO₄. 7H2O (0.05 g / L), CaCl2 2H2O (0.25 g / L), NaHCO3 (2.1 g / L), sodium lactate (1.12 g / L), sodium pyruvate (0.02 g / L), glucose (0.04 g / L), glutamine (0.146 g / L), EDTA (0.004 g / L), BSA (1 g / L), potassium penicillin G (0.06 g / L), phenol red (0.001 g / L), streptomycin sulfate (0.05 g / L).

[0140] 3. Select robust male mice (over 10 weeks old), perform vasectomy, and mate them with sexually mature female mice (10-12 weeks old) 2-3 weeks after recovery, 3.5 days before blastocyst transfer. Check the female mice for vaginal plugs the next morning; mice with vaginal plugs are considered pseudopregnant.

[0141] 4. The pseudopregnant mice were anesthetized. The uterine horn was pulled out from behind, and 30 blastocysts from the KSOM+NMN+α-KG+VitC optimized group were transferred to a single uterine horn. The surrogate mother mice were placed in a clean cage with sufficient water and high-fat food, and gave birth to their F1 pups 19-21 days later.

[0142] The changes in telomere length, mitochondrial membrane potential, reactive oxygen species levels, cell number, and apoptosis rate of blastocyst cells were observed. The results are shown in [Table / Reference]. Figure 1-3 .

[0143] Example 3

[0144] This embodiment 3 provides a method and culture medium for protecting the telomere length of human blastocyst cells cultured in vitro, labeled as the G2+NMN+α-KG optimized group, including the following steps:

[0145] 1. All human embryos collected in this experiment were donated by research volunteers. Fertilized eggs were cultured in G1 medium at 37°C and 6% CO2.

[0146] 2. Human cleavage embryos were replaced with G2 medium supplemented with NMN (10µM) and α-KG (150µM) on day 3 (after eight cells per cell line). The culture conditions were 37°C and 6% CO2. The aforementioned concentrated NMN / α-KG stock solutions were added to the G2 culture medium at final concentrations of 10µM and 150µM, respectively. After adding mineral oil, the culture was incubated overnight for equilibration. On the third day, the D3 human cleavage embryos were cultured in G2 culture medium containing NMN and α-KG. The specific operation was the same as in Example 1 of this invention.

[0147] 3. Observe the changes in telomere length in blastocyst cells; the results are shown in [the table below]. Figure 5 .

[0148] Example 4

[0149] This embodiment 4 provides a method and culture medium for protecting the telomere length of human blastocyst cells cultured in vitro, labeled as the G2+NMN+α-KG+VitC optimized group, including the following steps:

[0150] 1. All human embryos collected in this experiment were donated by research volunteers. Fertilized eggs were cultured in G1 medium at 37°C and 6% CO2.

[0151] 2. Human cleavage embryos were replaced with G2 medium supplemented with NMN (10µM), α-KG (150µM), and Vitamin C (50µM) on day 3 (after eight cells). The culture conditions were 37°C and 6% CO2. The aforementioned concentrated NMN / α-KG / VitC stock solutions were added to the G2 culture medium at final concentrations of 10µM / 150µM / 50µM, respectively. After adding mineral oil, the culture was incubated overnight for equilibration. On the third day, the D3 human cleavage embryos were cultured in G2 culture medium containing NMN, α-KG, and Vitamin C. The specific operation was the same as in Example 2 of this invention.

[0152] 3. Observe the changes in telomere length in blastocyst cells; the results are shown in [the table below]. Figure 5 .

[0153] Comparative Example 1

[0154] The difference between Comparative Example 1 and Examples 1-2 of this invention is that: after ovulation induction treatment in mice, they were caged and examined for follicle adhesions, and D3.5 blastocysts were collected from in vivo development and labeled as the in vivo group. The process includes the following steps:

[0155] 1. Female mice were injected intraperitoneally with 10 IU of pregnant mare serum gonadotropin (PMSG), and 48 hours later, human chorionic gonadotropin (hCG) was injected intraperitoneally. The mice were then placed in the same cage as male mice. The next morning at 7:00, the female mice were examined at the vaginal opening to determine whether mating had occurred.

[0156] 2. D3.5 blastocysts were obtained by flushing the uterus of female mice with plugged fallopian tubes with modified human oviduct culture medium mHTF-SSS.

[0157] 3. Select robust male mice (over 10 weeks old), perform vasectomy, and mate them with sexually mature female mice (10-12 weeks old) 2.5 days before embryo transfer, 2-3 weeks after recovery. Check the female mice for vaginal plugs the next morning; mice with vaginal plugs are considered pseudopregnant.

[0158] 4. The pseudopregnant mice are anesthetized. The uterine horn is pulled out from behind, and 30 blastocysts from the internal embryonic set are transferred to a single uterine horn. The surrogate mother mice are placed in a clean cage with sufficient water and high-fat food, and give birth to their F1 pups 19-21 days later.

[0159] 5. Observe changes in telomere length, mitochondrial membrane potential, reactive oxygen species levels, cell number, apoptosis rate, Sirt6 expression, and NAD in blastocyst (inner cell mass and trophectoderm) cells. + NADH expression, 5hmC / 5mC level, Sirt6 promoter methylation level, progeny birth rate, and telomere length were measured. Figure 1-4 And 6-7.

[0160] Comparative Example 2

[0161] The difference between Comparative Example 2 and Examples 1-2 of this invention is that: after ovulation induction treatment, mice were caged and examined to obtain D0.5 fertilized eggs, which were then cultured in vitro to collect D4.5 blastocysts, which is the most common method for mouse blastocyst culture and is labeled as the KSOM group. The process includes the following steps:

[0162] 1. Female mice were injected intraperitoneally with 10 IU of pregnant mare serum gonadotropin (PMSG), and 48 hours later, human chorionic gonadotropin (hCG) was injected intraperitoneally. The mice were then placed in the same cage as male mice. The next morning at 7:00, the female mice were examined at the vaginal opening to determine whether mating had occurred.

[0163] 2. Nineteen hours after hCG treatment, in vivo fertilized eggs were collected from the fallopian tubes and treated with hyaluronidase for 3-5 minutes. The fertilized eggs were then rinsed with mHTF-SSS and cultured in 20 µl KSOM medium under in vitro conditions of 37°C and 5% CO2. The specific procedures were the same as in Example 1 of this invention.

[0164] 3. Select robust male mice (over 10 weeks old), perform vasectomy, and mate them with sexually mature female mice (10-12 weeks old) 2-3 weeks after recovery, 3.5 days before embryo transfer. Check the female mice for vaginal plugs the next morning; mice with vaginal plugs are considered pseudopregnant.

[0165] 4. The pseudopregnant mice were anesthetized. The uterine horn was pulled out from behind, and 30 blastocysts from the KSOM group were transferred to a single uterine horn. The surrogate mother mice were placed in a clean cage with sufficient water and high-fat food, and gave birth to their F1 pups 19-21 days later.

[0166] 5. Observe changes in telomere length, mitochondrial membrane potential, reactive oxygen species levels, cell number, apoptosis rate, Sirt6 expression, and NAD in blastocyst cells. + NADH expression, 5hmC / 5mC level, Sirt6 promoter methylation level, progeny birth rate, and telomere length were measured. Figure 1-4 And 6-7.

[0167] Comparative Example 3

[0168] The difference between Comparative Example 3 and Examples 1-2 of this invention is that only NMN was added to the in vitro culture medium. After ovulation induction treatment in mice, follicles were examined to obtain D0.5 fertilized eggs, which were then cultured in vitro to collect D4.5 blastocysts, which were labeled as the KSOM+NMN optimized group. The process includes the following steps:

[0169] 1. Female mice were injected intraperitoneally with 10 IU of pregnant mare serum gonadotropin (PMSG), and 48 hours later, human chorionic gonadotropin (hCG) was injected intraperitoneally. The mice were then placed in the same cage as male mice. The next morning at 7:00, the female mice were examined at the vaginal opening to determine whether mating had occurred.

[0170] 2. 19-21 h after hCG treatment, collect in vivo fertilized eggs from the fallopian tubes and treat with hyaluronidase for 3-5 min. The fertilized eggs are then rinsed with mHTF-SSS and cultured in 20 µL KSOM medium until cleavage. After that, they are transferred to 20 µL KSOM medium supplemented with 10 µM NMN and cultured in vitro until D4.5 blastocysts. The culture conditions are 37℃, humidity 30%-95%, and 5% CO2. During the culture process, the development of the blastocysts is monitored regularly.

[0171] Preparation method of KSOM culture medium with 10 µM NMN: First, dilute NMN with water to prepare a 10 mM concentrated stock solution, add it to the KSOM culture medium at a final concentration of 10 µM, make 20 µL microdroplets of KSOM culture medium containing NMN, cover with mineral oil and equilibrate overnight, the next day, transfer mouse embryos cultured to eight cells to culture medium with added NMN for further culture.

[0172] The KSOM culture medium consisted of NaCl (5.55 g / L), KCl (0.19 g / L), KH₂PO₄ (0.05 g / L), and MgSO₄. 7H2O (0.05 g / L), CaCl2 2H2O (0.25 g / L), NaHCO3 (2.1 g / L), sodium lactate (1.12 g / L), sodium pyruvate (0.02 g / L), glucose (0.04 g / L), glutamine (0.146 g / L), EDTA (0.004 g / L), BSA (1 g / L), potassium penicillin G (0.06 g / L), phenol red (0.001 g / L), streptomycin sulfate (0.05 g / L).

[0173] 3. Observe changes in telomere length, mitochondrial membrane potential, reactive oxygen species levels, cell number, and apoptosis rate in blastocyst cells. The results are shown in [Table missing]. Figure 1-3 .

[0174] Comparative Example 4

[0175] The difference between Comparative Example 4 and Examples 1-2 of this invention is that only α-KG was added to the in vitro culture medium. After ovulation induction treatment in mice, follicles were examined to obtain D0.5 fertilized eggs, which were then cultured in vitro to collect D4.5 blastocysts, which were labeled as the KSOM+α-KG optimized group. The process includes the following steps:

[0176] 1. Female mice were injected intraperitoneally with 10 IU of pregnant mare serum gonadotropin (PMSG), and 48 hours later, human chorionic gonadotropin (hCG) was injected intraperitoneally. The mice were then placed in the same cage as male mice. The next morning at 7:00, the female mice were examined at the vaginal opening to determine whether mating had occurred.

[0177] 2. Nineteen hours after hCG treatment, in vivo fertilized eggs were collected from the fallopian tubes and treated with hyaluronidase for 3-5 minutes. The fertilized eggs were rinsed with mHTF-SSS and cultured in 20 µL KSOM medium until cleavage. Then, they were transferred to 20 µL KSOM medium supplemented with 150 µM α-KG and cultured in vitro until D4.5 blastocysts. The culture conditions were 37℃, humidity 30%-95%, and 5% CO2. During the culture, the development of the blastocysts was monitored regularly.

[0178] Preparation method of KSOM culture medium with 150 µM α-KG: First, dilute α-KG with water to prepare a 150 mM concentrated stock solution, add it to the KSOM culture medium at a final concentration of 150 µM, make 20 µL microdrops of KSOM culture medium containing α-KG, cover with mineral oil and equilibrate overnight, the next day, transfer mouse embryos cultured to eight cells to culture medium with α-KG added for culture.

[0179] The KSOM culture medium consisted of NaCl (5.55 g / L), KCl (0.19 g / L), KH₂PO₄ (0.05 g / L), and MgSO₄. 7H2O (0.05 g / L), CaCl2 2H2O (0.25 g / L), NaHCO3 (2.1 g / L), sodium lactate (1.12 g / L), sodium pyruvate (0.02 g / L), glucose (0.04 g / L), glutamine (0.146 g / L), EDTA (0.004 g / L), BSA (1 g / L), potassium penicillin G (0.06 g / L), phenol red (0.001 g / L), streptomycin sulfate (0.05 g / L).

[0180] 3. Observe the changes in telomere length, mitochondrial membrane potential, reactive oxygen species level, cell number, apoptosis rate, and 5hmC / 5mC level in blastocyst cells. The results are shown in […]. Figure 1-3 and Figure 7 .

[0181] Comparative Example 5

[0182] The difference between Comparative Example 5 and Examples 3-4 of the present invention is that no additives are made to the culture medium, and human fertilized eggs are cultured in vitro to the blastocyst stage, which is the most conventional method for human blastocyst culture, and is designated as group G2. The following steps are included:

[0183] 1. All human embryos collected in this experiment were donated by research volunteers. Fertilized eggs were cultured in G1 medium at 37°C and 6% CO2.

[0184] 2. Human cleavage embryos are replaced with G2 embryos on day 3, and cultured under conditions of 37°C and 6% CO2. The specific operation is the same as in Example 1 of this invention.

[0185] 3. Observe the changes in telomere length in blastocyst cells; the results are shown in [the table below]. Figure 5 .

[0186] Comparative Example 6

[0187] The difference between Comparative Example 6 and Examples 3-4 of the present invention is that only NMN was added to the culture medium, and human fertilized eggs were cultured in vitro to the blastocyst stage and labeled as the G2+NMN optimized group. The following steps were included:

[0188] 1. All human embryos collected in this experiment were donated by research volunteers. Fertilized eggs were cultured in G1 medium at 37°C and 6% CO2.

[0189] 2. Human cleavage embryos are replaced with G2+NMN on day 3, and cultured under conditions of 37°C and 6% CO2. The specific operation is the same as in Example 1 of this invention.

[0190] 3. Observe the changes in telomere length in blastocyst cells; the results are shown in [the table below]. Figure 5 .

[0191] Comparative Example 7

[0192] The difference between Comparative Example 7 and Examples 3-4 of the present invention is that only α-KG was added to the culture medium, and human fertilized eggs were cultured in vitro to the blastocyst stage and labeled as the G2+α-KG group. The following steps were included:

[0193] 1. All human embryos collected in this experiment were donated by research volunteers. Fertilized eggs were cultured in G1 medium at 37°C and 6% CO2.

[0194] 2. Human cleavage embryos are replaced with G2+α-KG on day 3, and cultured under conditions of 37°C and 6% CO2. The specific operation is the same as in Example 1 of this invention.

[0195] 3. Observe the changes in telomere length in blastocyst cells; the results are shown in [the table below]. Figure 5 .

[0196] Comparative Example 8

[0197] The difference between Comparative Example 8 and Examples 1-2 of this invention is that a low concentration of Sirt6 inhibitor was added to the in vitro culture medium. After ovulation induction treatment in mice, follicles were examined to obtain D0.5 fertilized eggs, which were then cultured in vitro to collect D4.5 blastocysts, which were labeled as the KSOM + low concentration Sirt6 inhibitor group. The process included the following steps:

[0198] 1. Female mice were injected intraperitoneally with 10 IU of pregnant mare serum gonadotropin (PMSG), and 48 hours later, human chorionic gonadotropin (hCG) was injected intraperitoneally and they were placed in the same cage with male mice. The next morning at 7:00, the female mice were examined at the vaginal opening to determine whether mating had occurred.

[0199] 2. Nineteen hours after hCG treatment, in vivo fertilized eggs were collected from the fallopian tubes and treated with hyaluronidase for 3-5 minutes. The fertilized eggs were washed with mHTF-SSS and cultured in 20 µL KSOM medium until cleavage. Then, they were transferred to 20 µL KSOM medium supplemented with Sirt6 inhibitor (10 µM) for in vitro culture until D4.5 blastocysts. The culture conditions were 37℃, humidity 30%-95%, and 5% CO2. During the culture process, the development of the blastocysts was monitored regularly.

[0200] Preparation method of KSOM culture medium with 10µM Sirt6 inhibitor: First, dissolve Sirt6 in DMSO to prepare a 10mM concentrated stock solution, add it to KSOM culture medium at a final concentration of 10µM, make 20µL microdroplets of KSOM culture medium containing Sirt6 inhibitor, cover with mineral oil and equilibrate overnight. On the third day, transfer mouse embryos cultured to eight cells to culture medium with Sirt6 inhibitor added for further culture.

[0201] 3. Observe the changes in telomere length in blastocyst cells; the results are shown in [the table below]. Figure 6 .

[0202] Comparative Example 9

[0203] The difference between Comparative Example 9 and Examples 1-2 of this invention is that a high concentration of Sirt6 inhibitor was added to the in vitro culture medium. After ovulation induction treatment in mice, follicles were examined to obtain D0.5 fertilized eggs, which were then cultured in vitro to collect D4.5 blastocysts, which were labeled as the KSOM + high concentration Sirt6 inhibitor group. The process included the following steps:

[0204] 1. Female mice were injected intraperitoneally with 10 IU of pregnant mare serum gonadotropin (PMSG), and 48 hours later, human chorionic gonadotropin (hCG) was injected intraperitoneally. The mice were then placed in the same cage as male mice. The next morning at 7:00, the female mice were examined at the vaginal opening to determine whether mating had occurred.

[0205] 2. Nineteen hours after hCG treatment, in vivo fertilized eggs were collected from the fallopian tubes and treated with hyaluronidase for 3-5 minutes. The fertilized eggs were washed with mHTF-SSS and cultured in 20 µL KSOM medium until cleavage. Then, they were transferred to 20 µL KSOM medium supplemented with Sirt6 inhibitor (20 µM) for in vitro culture until D4.5 blastocysts. The culture conditions were 37℃, humidity 30%-95%, and 5% CO2. During the culture process, the development of the blastocysts was monitored regularly.

[0206] Preparation method of KSOM culture medium with 20µM Sirt6 inhibitor: First, dissolve Sirt6 in DMSO to prepare a 10mM concentrated stock solution, add it to KSOM culture medium at a final concentration of 20µM, make 20µL microdroplets of KSOM culture medium containing Sirt6 inhibitor, cover with mineral oil and equilibrate overnight. On the third day, transfer mouse embryos cultured to eight cells to culture medium with Sirt6 inhibitor added for further culture.

[0207] 3. Observe the changes in telomere length in blastocyst cells; the results are shown in [the table below]. Figure 6 .

[0208] Comparative Example 10

[0209] The difference between Comparative Example 10 and Examples 1-2 of this invention is that: a high concentration of Sirt6 inhibitor and NMN were added to the in vitro culture medium; mice were subjected to ovulation induction treatment and then caged for examination; D0.5 fertilized eggs were obtained and collected into D4.5 blastocysts through in vitro culture, which were labeled as the KSOM + high concentration Sirt6 inhibitor + NMN group, including the following steps:

[0210] 1. Female mice were injected intraperitoneally with 10 IU of pregnant mare serum gonadotropin (PMSG), and 48 hours later, human chorionic gonadotropin (hCG) was injected intraperitoneally and they were placed in the same cage with male mice. The next morning at 7:00, the female mice were examined at the vaginal opening to determine whether mating had occurred.

[0211] 2. Nineteen hours after hCG treatment, in vivo fertilized eggs were collected from the fallopian tubes and treated with hyaluronidase for 3-5 minutes. The fertilized eggs were rinsed with mHTF-SSS and cultured in 20 µL KSOM medium until cleavage. Then, they were transferred to 20 µL KSOM medium supplemented with Sirt6 inhibitor (20 µM) + NMN (10 µM) for in vitro culture until D4.5 blastocysts. The culture conditions were 37℃, humidity 30%-95%, and 5% CO2. During the culture process, the development of the blastocysts was monitored regularly.

[0212] Preparation method of KSOM culture medium with added Sirt6 inhibitor (20µM) + NMN (10µM): First, the Sirt6 inhibitor was dissolved in DMSO to prepare a 10mM concentrated stock solution, and the NMN was diluted with water to prepare a 10mM concentrated stock solution. Then, the Sirt6 inhibitor and NMN were added to the KSOM culture medium at final concentrations of 20µM and 10µM, respectively. The KSOM culture medium containing Sirt6 inhibitor and NMN was made into 20µL microdroplets, covered with mineral oil and allowed to equilibrate overnight. On the third day, mouse embryos cultured to eight cells were transferred to the culture medium with added Sirt6 inhibitor and NMN for further culture.

[0213] 3. Observe the changes in telomere length in blastocyst cells; the results are shown in [the table below]. Figure 6 .

[0214] Explanation and analysis of experimental results of Examples 1-4 and Comparative Examples 1-10 of this invention

[0215] Figure 1 Image A shows blastocyst cells from the following groups in mice: the first group (Comparative Example 1 of this invention), the second group (Comparative Example 2 of this invention), the third group (Comparative Example 3 of this invention), the fourth group (Comparative Example 4 of this invention), the fifth group (Example 1 of this invention), and the sixth group (Example 2 of this invention). Figure 1 B shows that the telomere length of cells in the KSOM group (Comparative Example 2 of the present invention) was reduced compared with that in the in vivo group (Comparative Example 1 of the present invention). The telomere length of cells in the KSOM+NMN optimized group (Comparative Example 3 of the present invention) and the KSOM+α-KG optimized group (Comparative Example 4 of the present invention) was increased compared with that in the KSOM group (Comparative Example 2). The increase in the KSOM+NMN+α-KG optimized group (Example 1 of the present invention) and the KSOM+NMN+α-KG+VitC optimized group (Example 2 of the present invention) was more significant compared with that in the KSOM group (Comparative Example 2).

[0216] Figure 2 The results showed that, compared with the in vivo group (Comparative Example 1 of the present invention), the mitochondrial membrane potential of blastocyst cells in the mouse KSOM group (Comparative Example 2 of the present invention) was significantly reduced and the production of reactive oxygen species was significantly increased. This can be improved by the KSOM+NMN optimized group (Comparative Example 3 of the present invention), the KSOM+α-KG optimized group (Comparative Example 4 of the present invention), the KSOM+NMN+α-KG optimized group (Example 1 of the present invention), and the KSOM+NMN+α-KG+VitC optimized group (Example 2 of the present invention), among which the KSOM+NMN+α-KG optimized group (Example 1 of the present invention) and the KSOM+NMN+α-KG+VitC optimized group (Example 2 of the present invention) showed more significant improvement.

[0217] Figure 3 Compared with the in vivo group (Comparative Example 1 of the present invention), the number of blastocyst cells in the mouse KSOM group (Comparative Example 2 of the present invention) was significantly reduced and the apoptosis rate was significantly increased. This can be improved by the KSOM+NMN optimized group (Comparative Example 3 of the present invention), the KSOM+α-KG optimized group (Comparative Example 4 of the present invention), the KSOM+NMN+α-KG optimized group (Example 1 of the present invention), and the KSOM+NMN+α-KG+VitC optimized group (Example 2 of the present invention). Among them, the KSOM+NMN+α-KG optimized group (Example 1 of the present invention) and the KSOM+NMN+α-KG+VitC optimized group (Example 2 of the present invention) showed more significant improvement.

[0218] Figure 4 Compared with the in vivo group (Comparative Example 1 of the present invention), the KSOM group (Comparative Example 2 of the present invention) showed a decrease in the number of offspring born after blastocyst transfer and a significant decrease in telomere length, while the KSOM+NMN+α-KG optimized group (Example 1 of the present invention) could significantly improve the birth rate and telomere length of offspring.

[0219] Figure 5 The results showed that the G2+NMN+α-KG optimized group (Example 3 of the present invention) and the G2+NMN+α-KG+VitC optimized group (Example 4 of the present invention) significantly improved the telomere length of human embryos cultured in vitro. Furthermore, the G2+NMN+α-KG optimized group (Example 3 of the present invention) and the G2+NMN+α-KG+VitC optimized group (Example 4 of the present invention) significantly improved the development of human blastocysts, significantly increasing the proportion of well-developed and poorly developed blastocysts, while significantly reducing the proportion of blastocysts that did not develop into blastocysts.

[0220] Figure 6 The results showed that, compared with the in vivo group (Comparative Example 1 of this invention), the relative mRNA level of Sirt6 in the KSOM group (Comparative Example 2 of this invention) was significantly downregulated, and the immunofluorescence signal intensity was reduced by approximately 50%. Compared with the in vivo group (Comparative Example 1 of this invention), the NAD+ level in the KSOM group (Comparative Example 2 of this invention) was also significantly lower. + The NADH / NADH ratio decreased significantly. This invention hypothesizes that this may be due to the NAD+ / NADH ratio decreasing during in vitro culture. + The reduction of NADH leads to impaired Sirt6 function, resulting in shortened telomeres in in vitro blastocysts.

[0221] This invention further proposes that the telomere length of blastocyst cells in the KSOM + low-concentration Sirt6 inhibitor group (Comparative Example 8 of this invention) and the KSOM + high-concentration Sirt6 inhibitor group (Comparative Example 9 of this invention) was significantly reduced compared to the KSOM group (Comparative Example 2 of this invention), with the reduction becoming more pronounced as the Sirt6 inhibitor concentration increased. Furthermore, there was no significant difference in telomere length of blastocyst cells between the KSOM + NMN optimized group (Comparative Example 3 of this invention) and the in vivo group (Comparative Example 1 of this invention), while the telomere length of blastocyst cells in the KSOM + high-concentration Sirt6 inhibitor + NMN group (Comparative Example 10 of this invention) was not significantly different from that of the untreated KSOM group (Comparative Example 2 of this invention). These results indicate that NAD2 is a crucial factor in the preimplantation genetic development of mouse embryos. + The reduction of NADH affects telomere maintenance by mediating impaired Sirt6 function, leading to shorter telomeres. Adding NAD... + The biosynthetic precursor NMN can effectively improve [the condition].

[0222] Figure 7The results showed that the 5hmC / 5mC ratio in the KSOM group (Comparative Example 2 of this invention) was significantly lower than that in the in vivo group (Comparative Example 1 of this invention), while the 5hmC / 5mC ratio in the KSOM+α-KG optimized group (Comparative Example 4 of this invention) was significantly higher than that in the KSOM group (Comparative Example 2 of this invention), but there was no difference from that in the in vivo group (Comparative Example 1 of this invention). Genome-wide methylation analysis of the offspring revealed that the methylation level of the Sirt6 promoter region in 1-week-old F1 mice born from blastocyst transfer in the KSOM group (Comparative Example 2 of this invention) was significantly higher than that in the in vivo group (Comparative Example 1 of this invention). These results indicate that abnormal blastocyst demethylation during in vitro culture leads to increased methylation levels and has a persistent impact on offspring after birth, while α-KG addition can effectively improve the abnormal methylation pattern.

[0223] As for other culture media, according to common knowledge in the field, antioxidants such as NMN, α-KG, and Vitamin C can be added to all culture media used for mammalian blastocysts after the eight-cell stage of the embryo to increase the telomere length of cells in the blastocyst stage and offspring.

[0224] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0225] As used in this invention, the terms "comprising" and "including" are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.

[0226] As used in this invention, the term "and / or" includes any one or more of the related listed items and all combinations thereof.

[0227] The scope of protection of this invention is not limited to the above embodiments. Any variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in this invention and are protected by the appended claims.

Claims

1. A culture medium for protecting the telomere length of embryonic cells during in vitro embryo culture, characterized in that, The culture medium contains culture medium components that protect the telomere length of embryonic cells during in vitro embryo culture; wherein, the components include nicotinamide mononucleotide (NMN) and α-ketoglutarate (α-kG), and the nicotinamide mononucleotide (NMN) and α-ketoglutarate (α-kG) synergistically protect the telomere length of embryonic cells.

2. The culture medium as described in claim 1, characterized in that, The ingredients further include vitamin C (VitC).

3. The culture medium as described in claim 1 or 2, characterized in that, The concentration range of NMN used in the culture medium is 1µM-1mM, the concentration range of α-kG used in the culture medium is 1µM-1mM, and / or the concentration range of Vitamin C used in the culture medium is 1µM-1mM.

4. The culture medium as described in claim 3, characterized in that, The concentration of NMN used is 10µM, the concentration of α-kG used is 150µM, and / or the concentration of VitC used is 50µM.

5. The culture medium as described in claim 1, characterized in that, The basal medium of the culture medium is a culture medium suitable for early in vitro embryonic development, which is selected from one of G2 culture medium, CSC culture medium, G-TL culture medium, KSOM culture medium, mHTF culture medium, or other culture media prepared according to specific embryonic development needs.

6. The culture medium as described in claim 5, characterized in that, The G2 culture medium comprises the following components and concentrations: HSA 5 mg / ml, citrate 0.08 mM, lactate 6.0 mM, pyruvate 0.07 mM, glucose 3.4 mM, calcium 1.1 mM, magnesium 1.7 mM, potassium 5.8 mM, chloride 127 mM, sodium 149 mM, phosphorus 0.3 mM, chromium 0.2 µg / L, cobalt 0.2 µg / L, manganese 0.6 µg / L, iron 3 µg / L, aluminum 1 µg / L, non-essential amino acids NEAA, and essential amino acids EAA; and / or, the CSC culture medium comprises the following components and concentrations: HSA 5 mg / ml, citrate 0.01 mM, lactate 5.6 mM, pyruvate 0.17 mM, glucose 0.5 mM, calcium 1.9 mM, magnesium 0.8 mM, potassium 2.8 mM, chloride 112 mM, sodium 135 mM, and phosphorus 0.2 mg / ml. mM, chromium 0.7 µg / L, cobalt 0.2 µg / L, manganese 0.8 µg / L, iron 4 µg / L, NEAA, EAA; and / or, the composition and content of the G-TL culture medium are HSA 5 mg / ml, octanoate 0.344 mM, citrate 0.01 mM, lactate 10.01 mM, pyruvate 0.55 mM, glucose 0.97 mM, glutamine 10 µM, calcium 1.0 mM, magnesium 1.62 mM, potassium 5.5 mM, chloride 106 mM, sodium 137 mM, phosphorus 0.25 mM, NEAA, EAA; and / or, the composition and content of the KSOM culture medium are BSA 1 g / L, NaCl 5.55 g / L, KCl 0.19 g / L, KH2PO4 0.05 g / L, MgSO4 7H2O 0.05 g / L, CaCl2 The mHTF culture medium consisted of the following components: 2H₂O 0.25 g / L, NaHCO₃ 2.1 g / L, sodium lactate 1.12 g / L, sodium pyruvate 0.02 g / L, glucose 0.04 g / L, glutamine 0.146 g / L, penicillin G potassium salt 0.06 g / L, phenol red 0.001 g / L, streptomycin sulfate 0.05 g / L, EDTA 0.004 g / L; The mHTF culture medium contained the following components: sodium chloride 97.6 mM, potassium chloride 4.7 mM, magnesium carbonate or magnesium sulfate 0.2 mM, calcium chloride 2.04 mM; sodium pyruvate 0.33 mM, sodium lactate 21.4 mM; gentamicin 50 µg / ml, phenol red 0.001% wt / vol; sodium bicarbonate 25.0 mM, 4-hydroxyethylpiperazine ethanesulfonic acid 25 mM.

7. A substance characterized in that, The substance includes one or two of the following: (1) A regulator / promoter / activator, wherein the regulator / promoter / activator is capable of regulating, promoting or activating NAD in in vitro cultured embryos. + The level of, and / or the expression and / or function of Sirt6, and / or the mitochondrial membrane potential, and / or the expression and / or function of the demethylase, and / or the telomere length; (2) An inhibitor / antagonist / regulatory agent that is capable of inhibiting / antagonizing / regulating the level of ROS in in vitro cultured embryos and / or the epigenetic modification of Sirt6.

8. A drug / drug composition, characterized in that, The drug / drug composition comprises the modulator / promoter / activator as described in claim 7, and / or the inhibitor / antagonist / modulator as described in claim 7.

9. The culture medium as described in any one of claims 1-6, or the substance as described in claim 7, or the drug / drug composition as described in claim 8, in the in vitro culture process, protects the telomere length of embryonic cells, protects the normal development of in vitro cultured embryos, promotes the division, differentiation and proliferation of blastocyst cells, improves the quality and developmental capacity of blastocysts, reduces DNA damage, maintains the integrity of the blastocyst genome, enhances the resistance of blastocysts to stress factors, reduces blastocyst developmental disorders and apoptosis caused by stress, reduces the negative impacts generated during the in vitro culture of mammalian blastocysts, effectively prolongs the telomere length of blastocysts and the telomere length of subsequent offspring, improves the efficiency and success rate of ART treatment, reduces the genetic risks associated with ART treatment, and improves the success rate and safety of offspring in assisted reproductive technology ART treatment.

10. The culture medium, substance, drug / drug composition, or application according to any one of claims 1-9, characterized in that, The culture medium components that protect telomere length in embryonic cells during in vitro embryo culture can effectively increase NAD+ in cultured embryos, especially blastocyst cells. + This reduces the production of reactive oxygen species in mitochondria, increases mitochondrial membrane potential, and thus protects mitochondrial function. This, in turn, effectively protects the normal development of in vitro cultured embryos, especially preventing shortened telomere length in blastocysts and subsequent offspring. It also helps optimize culture conditions, thereby improving the success rate of ART treatment and the safety of offspring; and / or, The epigenetic modifications include transient hypermethylation of the Sirt6 promoter region, which inhibits its expression, leading to telomere shortening; and / or, The in vitro embryo culture includes gamete treatment culture, fertilization-assisted culture, mitotic embryo culture before the fertilized egg develops to approximately eight cells, and subsequent blastocyst culture; and / or, The drug has at least one of the following effects: (1) Regulating, promoting, or activating NAD as described in claim 7 + The level of; and / or the expression and / or function of Sirt6, and / or the mitochondrial membrane potential, and / or the expression and / or function of the demethylase, and / or the telomere length; (2) The inhibitor / antagonist / regulator can inhibit / antagonize / regulate the level of mtROS as described in claim 7 and / or the epigenetic modification of Sirt6; (3) Protecting the length of embryonic cell telomeres; (4) To protect the normal development of in vitro cultured embryos; (5) Avoid shortening the telomere length of the blastocyst and subsequent offspring; (6) Optimization of in vitro embryo culture conditions; (7) Improve the success rate of ART treatment and the safety of offspring.

Images