A bovine dermatophilus strain and its use

Abstract

The application discloses a bovine tuberous skin disease virus strain, and a microbial preservation number of the bovine tuberous skin disease virus strain is CCTCC NO:V202537. The strain is obtained by passage attenuation. The virulence of the strain is significantly reduced relative to a parent strain. The strain has good immunogenicity and safety, and a bovine inoculated with the strain can generate good attack protection capability, and has application prospects.

Description

Technical Field

[0001] This invention belongs to the field of veterinary virology and relates to a bovine nodular skin disease virus strain and its application. Background Technology

[0002] Bovine lumpy skin disease (LSD) is an acute, febrile, and contagious disease in cattle caused by the lumpy skin disease virus (LSDV), belonging to the poxviridae family. It primarily affects bovine animals. The disease spreads rapidly, causing significant economic losses. Existing live vaccines mainly include attenuated Neethling strain vaccines, but these have the following drawbacks:

[0003] 1. High risk of virulence reversion: Some vaccine strains may regain virulence in the body, posing a safety risk.

[0004] 2. Doubts about cross-protection against newly emerging variants: Due to the high conservation of the LSDV genome, the whole genome homology among the published strains is greater than 99%, making it difficult for existing vaccines to effectively cover newly emerging variants.

[0005] 3. Lack of new strains with significant genetic differences: There is a lack of low-virulence, representative new LSDV strains for new vaccine development.

[0006] 4. Complex genome structure: The LSDV genome consists of variable regions at both ends and a conserved region in the middle. The ends contain inverted repeat sequences, and related virulence genes and immune regulatory genes are mostly distributed in the variable regions, which further increases the complexity of strain selection.

[0007] Therefore, there is an urgent need for a novel LSDV strain with a clear genetic background, stable and weakened virulence, and good immunogenicity to develop an efficient and safe live attenuated vaccine. Summary of the Invention

[0008] To address the problems existing in the prior art, the first aspect of the present invention provides a bovine nodular dermatitis virus strain, the microbial preservation number of which is CCTCC NO: V202537.

[0009] In some embodiments, the genome of the bovine nodular dermatitis virus strain contains genomic fragments with sequences as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, and SEQ ID NO.16.

[0010] The second aspect of this invention provides a method for culturing bovine nodular dermatitis virus, wherein the method comprises culturing the bovine nodular dermatitis virus strain or its passaged virus as described in the first aspect of this invention with susceptible cells of bovine nodular dermatitis virus to obtain proliferated bovine nodular dermatitis virus.

[0011] In some embodiments, the susceptible cells for the bovine nodular dermatosis virus are selected from MDBK cells, Vero cells, and LT cells.

[0012] A third aspect of the present invention provides a vaccine composition, wherein the vaccine composition uses the bovine nodular dermatitis virus strain or its passaged strain described in the first aspect of the present invention as an immunogen.

[0013] In some embodiments, the immunogen is a live virus.

[0014] In some embodiments, the vaccine composition also contains excipients.

[0015] The fourth aspect of the present invention provides the use of the bovine nodular dermatitis virus strain described in the first aspect of the present invention in the preparation of an agent for the prevention of bovine nodular dermatitis. Attached Figure Description

[0016] Figure 1 This is a comparison chart of the growth curves of LSDV-XJ and LSDV-125 strains.

[0017] Figure 2 vaccinate cattle 10 4 TCID 50 Figure showing the body temperature changes after LSDV-125 strain.

[0018] Figure 3 vaccinate cattle 10 5 TCID 50 Figure showing the body temperature changes after LSDV-125 strain.

[0019] Figure 4vaccinate cattle 10 4 TCID 50 Figure showing the results of neutralizing antibody production after LSDV-125 strain.

[0020] Figure 5 vaccinate cattle 10 5 TCID 50 Figure showing the results of neutralizing antibody production after LSDV-125 strain.

[0021] Figure 6 vaccinate cattle 10 6 TCID 50 Figure showing the body temperature changes of LSDV-125 strain and LSDV-XJ strain.

[0022] Figure 7 vaccinate cattle 10 6 TCID 50 Statistical chart of blood virus content after LSDV-125 strain and LSDV-XJ strain.

[0023] Figure 8 Comparative photographs of intradermal nodules after cattle were inoculated with LSDV-125 and LSDV-XJ strains.

[0024] Figure 9 The attack dose was 10. 6.5 TCID 50 The result of the change in body temperature in the cow.

[0025] Figure 10 The attack dose was 10. 7.5 TCID 50 The result of the change in body temperature in the cow.

[0026] Figure 11 The attack dose was 10. 8.5 TCID 50 The result of the change in body temperature in the cow.

[0027] Figure 12 The attack dose was 10. 6.5 TCID 50 The results of the detoxification process in the cow are shown in the image.

[0028] Figure 13 The attack dose was 10. 7.5 TCID 50 The results of the detoxification process in the cow are shown in the image.

[0029] Figure 14 The attack dose was 10. 8.5 TCID 50 The results of the detoxification process in the cow are shown in the image.

[0030] Figure 15 The attack dose was 10. 8.5 TCID 50 The results of LSDV antibody detection were then obtained using the IPMA method. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of the present invention clearer, the embodiments of the present invention will be described in further detail below with reference to the accompanying drawings.

[0032] The bovine nodular dermatitis virus strain LSDV-XJ is described in reference 1, where it is referred to as LSDV / China / Xinjiang / 2019 (Xinjiang / 2019).

[0033] Reference 1: Zhang Minmin, Sun Yajie, Liu Wenxing, et al. First isolation and identification of bovine nodular dermatitis virus in my country [J]. Chinese Journal of Preventive Veterinary Medicine, 2020(010):042.

[0034] The method for obtaining bovine nodular dermatitis virus LSDV-75 is described in Chinese patent application No. 202510065202.2. Its microbial accession number is CCTCC NO: V2024114.

[0035] Example 1: Obtaining bovine nodular dermatitis virus strain LSDV-125.

[0036] I. Obtaining Passaged Virus Strains

[0037] The LSDV-XJ virus strain was continuously passaged in Vero cells, and the specific procedures were as follows:

[0038] The LSDV-XJ virus strain was inoculated into Vero cells at a volume ratio of 1:100 in DMEM (Dulbecco's Modified Eagle Medium) containing 2% fetal bovine serum. On day 5 post-inoculation, the cell culture was subjected to three freeze-thaw cycles, and then fresh Vero cells were inoculated again at a volume ratio of 1:100 in DMEM (containing 2% fetal bovine serum). This process was repeated for passage. At passage 25, the virus was purified using plaque formation, and the plaque size was observed. Passage continued at passages 50 and 75, with further plaque purification performed at each passage. After passage 125 using the same method, plaque purification was performed again. Multiple small plaques were observed to form. These small plaques were picked, and the virus was propagated. Plaque purification was then repeated until small plaques could be consistently and stably formed. The corresponding virus was then propagated to obtain a bovine nodular skindisease virus (LSDV) strain, which was aliquoted and cryopreserved at -70°C. This passaged strain was named Bovine Nodular Skindisease Virus LSDV-125, also known as Sheeppox Virus LSDV-125. Because it was attenuated to generation 125 in Heilongjiang Province in 2023, and because bovine nodular skindisease virus is a type of sheeppox virus (all bovine nodular skindisease viruses are sheeppox viruses), it was named Sheeppox Virus LSDV-HLJ-2023 during preservation. It will be consistently referred to as LSDV-125 thereafter.

[0039] II. Preservation of Microbial Materials

[0040] The sheep poxvirus LSDV-125 strain was isolated and deposited with a patent-approved depository. The depository is the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China. The accession number is CCTCC NO: V202537; the culture name is: Sheep Pox Virus LSDV-HLJ-2023; the Chinese classification name is: Sheep Pox Virus; the English classification name is: Capripoxvirus; the deposit date is May 13, 2025; and the identification viability date is May 19, 2025.

[0041] III. Genome Analysis

[0042] (a) Genome sequencing

[0043] The genome of sheep poxvirus LSDV-125 was sequenced using third-generation sequencing methods. The genome sequence was then assembled using software provided with the sequencer to obtain the complete genome of sheep poxvirus LSDV-125. The full genome sequence of LSDV-125 is approximately 151,000 bp in length.

[0044] (II) Genomic differences between LSDV-125 and LSDV-XJ strains

[0045] The differences between LSDV-125 and LSDV-XJ strains are shown in Table 1.

[0046] Table 1. Genomic differences between LSDV-125 and LSDV-XJ strains

[0047] The mutation corresponds to the genomic location of the LSDV-XJ strain. Mutation details The genome sequence of the LSDV-125 strain containing the mutation (SEQ ID NO.) Mutation results 1796 T→G TAGTTACTTGATCACAAGAA(1) 003ORF 135 K→Q 2427 A→C ATAAGGATTCATTAACCCT(2) 004ORF 5 I→M 2715 A→C CAAGTTGACGAGTCGCATAGGATGTA (3) A point mutation occurs in 005ORF75 S→R. 2815 A→C AAAATAACTTCAATAGGAGAAA(4) The 005ORF stop codon mutation, a frameshift mutation in the coding region, failed to terminate translation at aa108, resulting in an extra 63aa. 3301 A→C CTTCTTTATCCAAAAAAGTTA(5) The 006ORF underwent a point mutation 27C→G. 5657 T→G ATATCTTTAGGAAAAGAATA(6) 008ORF undergoes a point mutation T→P 20669 T→G GTTTCAGTGTCGACTTCGTCAAT(7) Point mutations occur in the intergenic spacer region. 21678 T→G AATAATACTCCCGGATCGTTATCTC (8) 030 ORF shows a point mutation K→Q 53048 A→G GGATGTCTTGCGACGACGAATCTA (9) 059ORF undergoes a point mutation N→D 85220 A→T TAACAAAAGATTCATAATCA(10) 090ORF undergoes a point mutation D→E. 125558 Three extra bases TTG GTTGAGGCTTTTGGAAGCAGATA(11) 134 ORF insertion mutations increased L 128617 G→A AGGATGATTATAAAATAAATGG (12) A mutation E→K occurs in 135ORF. 31331，31333 Each has one more T base CGTTACTGTTTTCATTAAATTTTCA (13) This leads to a frameshift mutation in 037ORF. 36100 There is one more base A after this position. ATTTATTTCCTCTAATATAGTAGTA (14) This leads to the 047 frameshift mutation. 11280，11281，11353 Each of these three sites is followed by multiple T bases. CATTAACAACTTCATTGTTTTCACTTTTTTCTT (15) This leads to a frameshift mutation in 017ORF. 46686，46680 Each has an A base inserted and a T base removed. ACAAATTTTGATGGATCAAAAGTGAT (16) Causes 050 frameshift mutation

[0048] As shown in Table 1, the LSDV-125 strain genome has undergone multiple mutations compared to its parent strain LSDV-XJ. These multiple frameshift mutations may significantly alter the strain's virulence and other genetic characteristics.

[0049] (II) Comparison of LSDV-125 strain gene sequence with typical strain sequence

[0050] Recombination analysis: Recombination events were analyzed using RDP and SimPlot software. The results showed that the LSDV-125 strain was a natural recombinant between the African Neethling strain (KX764644.1) and the Morocco strain (MW631933.1). The recombination region was mainly located in the LSDV007–LSDV010 gene region, corresponding to nucleotide positions of 4428–7708 bp and 134903–139888 bp.

[0051] Mutation analysis: Specific mutations were found in several genes related to virulence and immune regulation in the LSDV-125 strain, such as immune regulation (LSDV005), inhibition of host cell apoptosis (LSDV004, LSDV017), and regulation of viral gene expression and replication (LSDV037, LSDV047, LSDV058). These mutations are all located in inverted repeat regions of the viral genome. Furthermore:

[0052] (1) The results showed that the protein encoded by the ORF005 gene did not terminate at the 108th amino acid, and encoded 63 more amino acids than the LSDV-75 strain.

[0053] (2) The results showed that compared with the LSDV-75 strain, the ORF055 gene terminated prematurely, encoding 7 fewer amino acids, which led to a decrease in virulence.

[0054] This demonstrates that the LSDV-125 strain has a unique genomic structure.

[0055] Example 2. Study on the basic biological characteristics of LSDV-125 strain

[0056] I. Growth Curve

[0057] LSDV-125 and LSDV-XJ strains were inoculated into LT cells and cultured in MEM medium containing 2% serum. CPE was observed and statistically analyzed, and TCID was calculated at different time points within one week using the Reed-Muench method. 50 The TCID of this invention 50 All of them were measured using this method.

[0058] See the statistical results. Figure 1 Therefore, the growth curves of LSDV-125 and LSDV-XJ are similar, and the passage of LSDV-XJ does not significantly affect the reproductive capacity of the strain, nor does it affect the reproduction of LSDV-125. From a reproductive capacity perspective, LSDV-XJ has the potential to be used for vaccine development.

[0059] II. Security Assessment

[0060] All experimental cattle were LSDV serum antigen and antibody negative Holstein cows.

[0061] The experiment was divided into four groups, with four cattle in each group. The first group was injected subcutaneously with LSDV-125 strain at a dose of 1×10⁻⁶ mg / ml. 4 TCID 50 One injection was given. The second group received a subcutaneous injection of LSDV-125 into the neck of the cattle, at a dose of 1×10⁻⁶ oz per ml. 5 TCID 50 The first group (control group of the first group) received a single intradermal injection of 1 ml of sterile PBS in the neck. The second group (control group of the second group) received a single intradermal injection of 1 ml of sterile PBS in the neck.

[0062] See the statistical charts showing the changes in body temperature of cattle after vaccination in groups one and three. Figure 2 .

[0063] See the statistical charts showing the changes in body temperature of cattle after vaccination in groups two and four. Figure 3 .

[0064] according to Figure 2 and Figure 3 As can be seen, the absence of adverse clinical manifestations such as high fever (body temperature <40℃) and systemic nodular reaction after inoculation indicates that the strain has good safety. No clinical symptoms of disease, such as high fever >40℃ or systemic nodules, were observed in the experimental cattle after inoculation with either of the two high doses, indicating that the LSDV-125 strain was sufficiently attenuated and has good safety.

[0065] Use LSDV-125 strain 1×10 4 TCID 50 With 1×10 5 TCID 50The inoculation dose is safe for cattle, and from a safety perspective, the LSDV-125 strain has the potential to be used to produce a live attenuated vaccine.

[0066] II. Immunogenicity Assessment

[0067] The detection method for LSDV neutralizing antibodies is as follows: each serum sample is serially diluted twofold with sterile PBS, and then an equal volume of solution containing 100 TCID50 molecules is added. 50 The LSDV-125 strain was added to LT cells, and the titer was calculated by observing and statistically analyzing CPE using the Reed-Muench method.

[0068] The neutralizing antibody titers for groups one and three are shown in [reference]. Figure 4 The neutralizing antibody titers for groups two and four are shown in [reference needed]. Figure 5 Therefore, LSDV neutralizing antibodies can be produced as early as day 10. The level of neutralizing antibodies, as detected by the serum neutralization assay, peaked at 1:75 in week 4 after vaccination.

[0069] Example 3. Comparison of biological characteristics between LSDV-125 and LSDV-XJ strains

[0070] The experiment was divided into two groups, with four cattle in each group. The first group was given a subcutaneous injection of LSDV-XJ strain in 1 ml of water. 6 TCID 50 One injection was given. The second group received a subcutaneous injection of LSDV-125 in the neck of the cattle, at a dose of 1 ml containing 10... 6 TCID 50 One injection.

[0071] I. Toxicity Comparison

[0072] The body temperature of cattle in groups one and two was measured within three weeks after vaccination. The results are shown in [reference needed]. Figure 6 .

[0073] This indicates that the LSDV-125 strain generally exhibits a lower body temperature, particularly between days 8 and 13, where its safety is significantly improved. This is primarily due to the numerous mutations in the LSDV-125 strain's genome compared to the LSDV-XJ strain.

[0074] The body temperature of cattle inoculated with the LSDV-125 strain did not exceed 39.5°C, and it was also able to produce neutralizing antibodies, thus possessing the potential to be used as a live attenuated vaccine.

[0075] II. Blood Detoxification Status

[0076] Using F1 (SEQ ID NO.17) and F2 (SEQ ID NO.18) as primers and P1 as a probe (the nucleic acid sequence is SEQ ID NO.19, with FAM linked at the 5' end and MGB linked at the 3' end), the copy number of the LSDV-125 genome template in the blood of the two groups was measured after inoculation.

[0077] F1: 5'-TGAATTAGTGTTGTTTCTTC-3'

[0078] F2: 5'-GGGAATCCTCAAGATAGTTCG-3'

[0079] P: 5'-FAM-TGCCGCAAAATGTCGA-MGB-3'

[0080] See the statistical results. Figure 7 .

[0081] This demonstrates that the LSDV-125 strain has a significantly reduced reproductive capacity in cattle compared to its parent, the LSDV-XJ strain, which can significantly improve the safety of virus inoculation.

[0082] Example 4. Comparison of intradermal nodule activation characteristics between LSDV-125 and LSDV-XJ strains

[0083] The hair on one side of the cow's chest and abdomen was shaved. The LSDV-125 and LSDV-XJ strains were pre-diluted with PBS (6 dilutions: 1×10⁻⁶). 6 TCID 50 / 0.1mL, 1×10 5 TCID 50 / 0.1mL, 1×10 4 TCID 50 / 0.1mL, 1×10 3 TCID 50 / 0.1mL, 1×10 2 TCID 50 / 0.1mL, 1×10 1 TCID 50 (0.1 mL), with 5 replicates for each dilution. Changes at the injection site were observed daily after intradermal inoculation, and nodules were observed at the injection site 7 days after inoculation. Results: Obvious nodules were produced at the inoculation sites of LSDV-XJ strain in all cases, especially in the first three dilutions, while nodules were produced at the inoculation sites of LSDV-125 strain in all six dilutions.

[0084] See some results Figure 8The left image shows photographs of the inoculation sites at six dilutions of the LSDV-XJ strain, indicating that at least three dilutions showed blistering (1×10⁻⁶). 6 1×10 5 1×10 4 TCID 50 (0.1mL) The right image shows photos of the inoculation sites of LSDV-125 strain at 6 dilutions. No blistering was observed at any dilution.

[0085] This demonstrates that the safety of LSDV-125 strain for cattle inoculation is significantly improved after weakening.

[0086] Example 5. Evaluation and determination of the protective efficacy of LSDV-125 strain

[0087] This embodiment uses LSDV seronegative cattle for the experiment, and the experimental animals are divided into 6 groups, with 4 animals in each group.

[0088] Each animal in groups one, two, and three received an intramuscular injection of LSDV-125 strain (solvent: PBS) into the neck, at a dose of 10... 3 TCID 50 Each of the three groups was paired with a control group (group 4, group 5, and group 6). Each head in the control group received a 1 mL injection of PBS into the neck muscle.

[0089] Four weeks after injection, challenge experiments were conducted with different doses of the drug. The first and fourth groups were challenged with a dose of 10... 6.5 TCID 50 The second and fifth groups were challenged with a dose of 10. 7.5 TCID 50 The third and sixth groups were challenged with a dose of 10. 8.5 TCID 50 The challenge method was intramuscular injection in the neck (solvent was PBS). The virus strain used for challenge was LSDV / China / Xinjiang / 2019. After challenge, changes in body temperature, clinical symptoms and virus shedding were observed.

[0090] The body temperature results for Group 1 and Group 4 are shown below. Figure 9 The temperature results for the second and fifth groups are shown in [reference]. Figure 10 The temperature results for groups three and six are shown in [reference]. Figure 11 This shows that the body temperature of the LSDV-125 immunized group remained within the normal range.

[0091] No typical nodule symptoms were observed in any of the first to sixth groups.

[0092] After challenge, whole blood was collected every two days to extract the virus and total DNA from the tissue. Using the same F1 and F2 primers as in Example 3 and P1 as the probe, the LSDV virus content in the animal blood was detected by qPCR.

[0093] For the viral load in the blood of groups one and four, please refer to [the provided text]. Figure 12 For the viral load in the blood of groups two and five, please refer to [reference needed]. Figure 13 For the viral load in the blood of groups three and six, please refer to [reference needed]. Figure 14 .

[0094] This shows that the amount of virus shed in the three immunized groups was significantly lower than that in the non-immunized control group.

[0095] The overall LSDV antibody production was determined using the IPMA method. The method is as follows:

[0096] First, MDBK cells were seeded into 96-well plates. After reaching a confluent monolayer the following day, LSDV-125 cells were infected at a 0.05 MOI. Four days later, the cells were fixed with 4% paraformaldehyde for 2 hours, then washed three times with sterile PBS for 5 minutes each time. The plates were then blotted dry and stored at 4°C for later use. The test serum (bovine serum from group 3) was serially diluted twofold and then 100 μL was added to the pre-treated 96-well plates. The plates were incubated at 37°C for 1 hour, then washed three times with PBST. HRP-labeled rabbit anti-bovine IgG monoclonal antibody (purchased from Sigma) was added, and the plates were incubated at 37°C for 30 minutes. After washing three times with PBST and blotting dry, the plates were developed with AEC chromogenic solution for 15-20 minutes. CPE cells with brown granules visible under a light microscope were the positive wells. Serum titers were calculated using the Reed-Muench method.

[0097] IPMA test results are as follows Figure 15 As shown, the antibody titer reached 1:1094 before challenge, and increased to a maximum of 1:2080 after challenge. These data suggest that LSDV-125 can produce a good immune response and therefore has good protective efficacy.

[0098] As is known from common technical knowledge, this invention can be implemented through other embodiments that do not depart from its spirit or essential characteristics. Therefore, the disclosed embodiments described above are merely illustrative in all respects and are not the only ones. All modifications within the scope of this invention or equivalent to the scope of this invention are included in this invention.

Claims

1. A bovine nodular dermatitis virus strain, wherein the microbial preservation number of the bovine nodular dermatitis virus strain is CCTCC NO: V202537.

2. The bovine nodular dermatitis virus strain as described in claim 1, characterized in that, The genome of the bovine nodular dermatitis virus strain contains genomic fragments with sequences as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO.

16.

3. A method for culturing bovine nodular dermatitis virus, wherein the method comprises culturing the bovine nodular dermatitis virus strain of claim 1 or its passaged virus in susceptible cells of bovine nodular dermatitis virus to obtain proliferated bovine nodular dermatitis virus.

4. The cultivation method as described in claim 3, characterized in that, The susceptible cells for the bovine nodular dermatosis virus were selected from MDBK cells, Vero cells, and LT cells.

5. A vaccine composition wherein the vaccine composition uses the bovine nodular dermatitis virus strain of claim 1 or its passaged strain as an immunogen.

6. The vaccine composition according to claim 5, characterized in that, The immunogen is a live virus.

7. The vaccine composition according to claim 6, characterized in that, The vaccine composition also contains excipients.

8. The use of the bovine nodular dermatitis virus strain according to claims 1 and 2 in the preparation of an agent for the prevention of bovine nodular dermatitis.

Images