A recombinant feline herpesvirus strain, a vaccine composition comprising the same and use thereof in the preparation of a feline triple vaccine

Abstract

The application provides a recombinant feline herpesvirus (FHV) strain expressing feline calicivirus (FCV) VP1 protein and feline parvovirus (FPV) VP2 protein and a construction method and application thereof. The method is realized by inserting a feline calicivirus VP1 gene expression cassette and a feline parvovirus VP2 gene expression cassette into specific positions of a feline herpesvirus genome through homologous recombination technology. The VP1 gene expression cassette is inserted between gI and gE genes, and the VP2 gene expression cassette is inserted into a TK gene. The constructed recombinant virus remains stable for more than 20 generations of continuous passage in vitro, and the VP1 protein and the VP2 protein can be efficiently and stably expressed. The recombinant feline herpesvirus strain as a live vector vaccine can provide protection against feline calicivirus and feline parvovirus virulent challenge, and has a good market application prospect.

Description

Technical Field

[0001] This invention belongs to the field of genetically engineered vaccines, and relates to a recombinant feline herpesvirus strain, a vaccine composition containing the virus, and its application in the preparation of a feline triple vaccine. Background Technology

[0002] Feline calicivirus disease (FCVD) is a common infectious disease in felines caused by feline calicivirus (FCV), primarily causing upper respiratory symptoms, oral ulcers, and conjunctivitis. FCV is a single-stranded positive-sense RNA virus with a genome containing three open reading frames (ORF2). The ORF2 encodes the major structural protein VP1, which is the virus's main immunogenic protein and induces the production of virus-neutralizing antibodies. In recent years, the emergence of highly pathogenic variants has attracted widespread attention, as these strains can cause systemic vasculitis and multiple organ failure. Notably, even in cats vaccinated with FCV (Fluoride Chemicals), the FCV positivity rate remains as high as 75%, indicating limitations in the protective efficacy of existing vaccines against currently circulating strains.

[0003] Feline panleukopenia (FP), commonly known as feline distemper, is a highly contagious and fatal infectious disease of felines caused by feline parvovirus (FPV). The disease is characterized by sudden onset of high fever, vomiting, diarrhea, severe dehydration, and a significant decrease in white blood cell count. Kittens (under 6 months of age) have the highest morbidity rate. FPV is a non-enveloped, single-stranded DNA virus whose genome encodes non-structural proteins (NS1 and NS2) and structural proteins (VP1 and VP2). VP2 is a major component of the viral particle, accounting for approximately 90% of the viral capsid protein, and plays a crucial role in viral assembly and inducing the host's immune response. Studies have found that specific amino acid substitutions in the VP2 gene can alter viral antigenicity and host tropism, thereby affecting viral infectivity and immune evasion capabilities, posing new challenges to the development of novel vaccines.

[0004] Feline herpesvirus type 1 (FHV-1) is the main pathogen of feline infectious rhinotracheitis and one of the most prevalent viral pathogens in feline upper respiratory tract infections, accounting for approximately 50% of all viral upper respiratory tract infections. FHV-1 belongs to the alpha-herpesvirus subfamily and possesses a large genome capacity and good immunogenicity, capable of accommodating multiple exogenous gene expression frames, making it an ideal platform for developing multivalent recombinant live vector vaccines. Compared to inactivated vaccines, live vector vaccines offer significant advantages: strong immunogenicity, stimulating a comprehensive immune response; typically requiring only a single dose to provide long-term protection; and the ability to be administered non-invasively via nasal drops, avoiding the pain and stress associated with injections. As a candidate platform for live vector vaccines, FHV-1 boasts significant advantages such as large genome capacity, good safety profile, and the ability to induce lifelong immunity, making it a hot topic in the development of next-generation multivalent feline vaccines. Summary of the Invention

[0005] Based on the needs and shortcomings of existing technologies, this invention, through experimental research, employs homologous recombination technology to insert the independent expression cassettes of the feline calicivirus protective antigen gene (VP1 gene) and the feline parvovirus protective antigen gene (VP2 gene) into specific locations in the feline herpesvirus genome. These insertion sites were obtained through screening using fluorescent protein insertion experiments. This invention experimentally validates two methods: a "cross-gene insertion method" and an "internal gene insertion method." Specifically, the gI gene is inserted at the 5' end of the feline calicivirus VP1 gene, and the gE gene is inserted at the 3' end, resulting in the inability to normally express both the feline herpesvirus gI and gE genes, thus achieving gene silencing. Similarly, the feline parvovirus VP2 gene is inserted into the TK gene of the feline herpesvirus, preventing normal expression of the TK gene and achieving gene silencing. Inactivation of the virulence gene TK facilitates the attenuation of the parental vector virus FHV, making it an ideal parent strain for attenuated vaccines. Inserting the exogenous genes VP1 and VP2 into the FHV parent strain yields the recombinant virus strain. The constructed recombinant virus remained stable after more than 20 passages in vitro, and both VP1 and VP2 proteins were expressed efficiently and stably. This recombinant feline herpesvirus strain, as a live vector vaccine, can provide protection against virulent challenges from feline calicivirus and feline parvovirus, and has promising market application prospects.

[0006] This invention provides a recombinant feline herpesvirus strain that co-expresses feline calicivirus VP1 protein and feline parvovirus VP2 protein.

[0007] Specifically, the feline calicivirus VP1 gene expression cassette was inserted between the gI and gE genes of feline herpesvirus, and the feline parvovirus VP2 gene expression cassette was inserted inside the TK gene of feline herpesvirus.

[0008] More preferably, the 5' end of the feline calicivirus VP1 gene is inserted into the gI gene, and the 3' end of the VP1 gene is inserted into the gE gene, causing both the feline herpesvirus gI and gE genes to be unable to be expressed normally, thereby achieving the effect of gene silencing; the feline parvovirus VP2 gene is inserted into the TK gene of the feline herpesvirus, causing the TK gene to be unable to be expressed normally, thereby achieving the effect of gene silencing.

[0009] More specifically, the feline calicivirus VP1 was constructed by creating a CAG complex promoter-VP1-RBG polyA expression cassette between the gI and gE genes of feline herpesvirus; and the feline parvovirus VP2 was constructed by creating an hCMV promoter-VP2 gene-SV40 polyA expression cassette inside the TK gene of feline herpesvirus.

[0010] The amino acid sequence of the feline calicivirus VP1 protein is shown in SEQ ID NO: 1, and the amino acid sequence of the feline parvovirus VP2 protein is shown in SEQ ID NO: 2.

[0011] This invention also provides the application of the recombinant feline herpesvirus strain in the preparation of live vector vaccines.

[0012] The present invention also provides a feline triple vaccine comprising the recombinant feline herpesvirus strain described above. Specifically, it also includes an adjuvant.

[0013] The present invention also provides a method for preparing the feline triple vaccine, which includes the following steps:

[0014] Construction of S1TK site transfer vector and gI / gE site transfer vector and verification of FHV-1 gene insertion site;

[0015] Construction and identification of recombinant FHV virus expressing dual fluorescent proteins eGFP and mCherry in S2;

[0016] Construction and identification of transfer plasmids expressing FCV VP1 and FPV VP2, respectively, in S3;

[0017] Construction of S4 recombinant virus rFHV-VP1-VP2 and screening of reverse dual fluorescent proteins;

[0018] Rescue, in vitro replication characteristics, and genetic stability analysis of S5 recombinant virus rFHV-VP1-VP2;

[0019] Evaluation of the in vivo immunogenicity of S6 recombinant virus rFHV-VP1-VP2.

[0020] Specifically, in S1, based on the FHV-1 genome sequence, specific sgRNAs were designed for the gI, gE, and TK genes, with the following targets selected: the sgRNAs for the TK gene are TK-sgRNA1 and TK-sgRNA2, with target sequences of CGGTGGTATCTATGCCGTCC and CGAGCCTATTCCGTTCATAG, respectively, and corresponding PAMs of AGG and TGG, respectively; the sgRNAs for the gI and gE genes are gI-sgRNA1 and gE-sgRNA2, with target sequences of GTTTACTCATTCGATACGCG and AGTTCGTCGGGATCGTTACT, respectively, and corresponding PAMs of TGG and AGG, respectively.

[0021] The present invention particularly provides the use of the recombinant feline triple virus in the preparation of medicaments (e.g., vaccines) for the prevention of feline herpesvirus, feline calicivirus and / or feline parvovirus infection.

[0022] The recombinant virus constructed in this invention remains stable after more than 20 consecutive passages in vitro, and both VP1 and VP2 proteins can be expressed efficiently and stably. As a live vector vaccine, the recombinant feline herpesvirus strain of this invention can provide protection against virulent challenges from feline calicivirus and feline parvovirus, and has promising market application prospects. Attached Figure Description

[0023] Figure 1 The image shows the PCR identification results of the FHV-1 gene-deleted strain FHV-ΔTK / gI / gE-eGFP-mCherry.

[0024] Figure 2 The image shows the PCR identification results of the recombinant virus rFHV-VP1+VP2.

[0025] Figure 3 The replication kinetics curve of the recombinant virus rFHV-VP1+VP2.

[0026] Figure 4 The figure shows the results of indirect immunofluorescence detection of recombinant viral VP1 and VP2 protein expression.

[0027] Figure 5 The figure shows the results of Western blot detection of VP1 and VP2 protein expression in different generations of recombinant viruses.

[0028] Figure 6 The results show the protection against FCV(a) or FPV(b) challenge by the recombinant virus rFHV-VP1+VP2. Detailed Implementation

[0029] The present invention will be described below through specific embodiments in order to better understand the present invention, but this does not constitute a limitation on the present invention.

[0030] Example 1: Construction of the FHV-1 gene-deleted strain FHV-ΔTK / gI / gE-eGFP-mCherry

[0031] 1.1 Construction of sgRNA expression vector

[0032] Based on the FHV-1 genome sequence (GenBank No. NC_013590.1), specific sgRNAs were designed targeting the gI, gE, and TK genes. The following targets were selected: for the TK gene, two sgRNAs, TK-sgRNA1 and TK-sgRNA2, were designed; for the gI and gE genes, two sgRNAs, gI-sgRNA1 and gE-sgRNA2, were designed across the gene boundaries.

[0033] ;

[0034] Complementary oligonucleotide chains to the above-mentioned sgRNA were synthesized and annealed to form double strands. The pX459 plasmid was digested with enzymes, and the linearized vector was recovered. The annealed double strands were ligated into the recovered pX459 vector, transformed, and sequenced to verify positive clones, yielding plasmids pX459-TK-sgRNA1, pX459-TK-sgRNA2, pX459-gI-sgRNA1, and pX459-gE-sgRNA2, respectively.

[0035] 1.2 Construction of homologous recombination transfer vectors

[0036] (1) Construction of TK site transfer vector (pMD-18T-HR-mCherry)

[0037] Using FHV-1 genomic DNA as a template, primers were designed to amplify a 1000-1500 bp fragment upstream of the TK gene. Using the same FHV-1 genomic DNA as a template, primers were also designed to amplify a 1000-1500 bp fragment downstream of the TK gene. Using pIRES2-mCherry as a template, the complete mCherry expression cassette containing the promoter and polyA was amplified. The TK-L, mCherry expression cassette, and TK-R fragments were fused using overlap PCR. The fused fragment was ligated into the pMD-18T vector and sequenced for verification.

[0038] (2) Construction of gI / gE site transfer vector (pMD-18T-HR-eGFP)

[0039] Using FHV-1 genomic DNA as a template, the upstream fragment of the gI / gE gene was amplified. The downstream fragment of the gI / gE gene was also amplified using FHV-1 genomic DNA as a template. The complete eGFP expression cassette was amplified using pIRES2-eGFP as a template. The gI / gE-L, eGFP expression cassette, and gI / gE-R fragments were fused. The resulting fragments were cloned into the pMD-18T vector and sequenced for verification.

[0040] 1.3 Construction of Recombinant Viruses

[0041] CRFK cells were seeded into 6-well plates. When the cell density reached 70%-80%, pX459-TK-sgRNA1, pX459-TK-sgRNA2, and pMD-18T-HR-mCherry were co-transfected into the cells. 24 hours post-transfection, the FHV-1 parental strain was inoculated at an MOI of 0.01. 72 hours post-infection, cells and supernatant were collected, subjected to three freeze-thaw cycles, and centrifuged to collect the supernatant. The harvested viral supernatant was inoculated into CRFK cells, and after 2 hours, the medium was replaced with a medium containing 1% low-melting-point agarose. After 3 days of culture, mCherry-positive (red fluorescence) plaques were picked under a fluorescence microscope. The above steps were repeated 3-5 times until purified FHV-ΔTK-mCherry recombinant virus was obtained.

[0042] Using purified FHV-ΔTK-mCherry as a backbone, the above steps were repeated: co-transfected with pX459-gI-sgRNA1, pX459-gE-sgRNA2, and pMD-18T-HR-eGFP. FHV-ΔTK-mCherry was then infected, and double-positive plaques expressing both mCherry (red) and eGFP (green) were selected. Plaque purification was performed for 5-7 consecutive rounds. Recombinant viral DNA was extracted, and specific primers were used to detect the deletion of gI, gE, and TK genes and the insertion of eGFP and mCherry genes. Figure 1 ).

[0043] Example 2: Construction of recombinant virus rFHV-VP1+VP2 expressing FCV VP1 and FPV VP2

[0044] Wherein, the amino acid sequence of feline calicivirus VP1 protein (SEQ ID NO: 1): MADGDGSITTPEQGTAVGGVIAEPSTQMSTAADMATGKSVDSEWEAFFSFHTSVNWSTSETQGKILFKQNLGPLLNPYLSHLSKLYVAWSGSIDVRFSISGSGVYGGKLAAIVVPPGIEPVQSTSMLQYPHVLFDARQVEPVIFSIPDLRSTLYHLMSDVDTTSLVIMIYNDLINPYASETNSSGCIVTVETKPGPDFKFHLLKPPGSMLTHGSVPSDLIPKSSSLWIGNRHWTDIVDFVIRPFVFQANRHFDFNQETAGWSTPRFRPLTINISQQKGATLGIGVATDYIVPGIPDGWPDTTIPEELIPAGDYAITTGSGNDIVSSAGYDGADVIKNNTNFRSMYICGSLQRAWGDKKISNTGFITTATIEKNKLKPSNTIDQTKIAVFQDNHVGADVQTSDVTLALLGYTGIGEQAIGADRDKVVRISILPETGARGGNHPIFYKNKMKLGYVIREIDVFNSQILHTSRQLSLNNYLLPPDSFAVYRIIDANGSWFDIGIDSDGFSFVGVSNIGKLEFPLTSSYMGIQLAKVRLASNIRSSMTKL.

[0045] The amino acid sequence of feline parvovirus VP2 protein (SEQ ID NO: 2):

[0046] 2.1 Construction of sgRNA expression vector

[0047] Referring to the genomic sequences of eGFP and mCherry in GenBank, sgRNA sequences targeting eGFP and mCherry were input into the online sgRNA design website (http: / / crispr.mit.edu) to search for sgRNA sequences with PAM (NGG). sgRNAs with low off-target rates were selected and cloned into the lentiCRISPR V2 vector.

[0048] 2.2 Construction of VP1 and VP2 transfer plasmids

[0049] PCR amplification was used to obtain the upstream and downstream homologous arms (approximately 1500 bp each) of the FHV-1 gI / gE insertion site. Simultaneously, a synthetically produced FCV VP1 gene sequence optimized with feline codons was inserted into the pCAGGS vector (codon optimization favors FCV VP1 protein expression), constructing the VP1 expression cassette: CAG complex promoter-VP1 gene-RBG polyA. The left homologous arm, VP1 expression cassette, and right homologous arm were sequentially assembled into the pBluescript SKII vector to construct the homologous recombination transfer plasmid, named pBlue-gI / gE-VP1.

[0050] PCR amplification was used to obtain the upstream and downstream homologous arms (approximately 1500 bp each) of the FHV-1 TK gene insertion site. Simultaneously, a synthetically produced FPV VP2 gene sequence optimized with feline codons was inserted into the pCI vector (feline codon optimization favors FPVVP2 protein expression), constructing the VP2 expression cassette: hCMV promoter-VP2 gene-SV40 polyA. The left homologous arm, VP2 expression cassette, and right homologous arm were sequentially assembled into the pBluescript SKII vector to construct the homologous recombination transfer plasmid, named pBlue-TK-VP2.

[0051] 2.3 Construction of recombinant virus rFHV-VP1+VP2

[0052] CRFP cells were co-transfected with Cas9 plasmid (containing sgRNA-eGFP and sgRNA-mCherry), transfer plasmids pBlue-gI / gE-VP1, and pBlue-TK-VP2, and then infected with FHV-1. When cytopathic effect reached 80%, cells were collected and subjected to three freeze-thaw cycles to harvest the recombinant virus. The viral stock solution was serially diluted with DMEM and evenly seeded onto six-well plates containing CRFK cells. After incubation for 3 hours, the viral solution was discarded. A 1:1 mixture of 2% low-melting-point agarose solution and 2× cell maintenance medium was added to each well, and the mixture was allowed to solidify into a capping layer upon cooling. Since the transfer plasmid did not contain a fluorescently labeled gene, recombinant viral plaques containing the exogenous gene were screened by PCR. After eight rounds of continuous plaque purification, a pure recombinant virus was obtained and named rFHV-VP1-VP2.

[0053] Recombinant viral DNA was extracted and identified by PCR using VP1 and VP2 specific primers and primers for the downstream homologous arm of the target gene. The results showed that the recombinant virus amplified approximately 3022 bp of the VP1 gene and its downstream homologous arm, and approximately 2700 bp of the VP2 gene and its downstream homologous arm, while the parent virus showed no corresponding bands. This demonstrates that the exogenous gene has been successfully inserted into the correct site in the FHV-1 genome (see [link to relevant documentation]). Figure 2 ).

[0054] 2.3 Analysis of the replication characteristics of recombinant virus rFHV-VP1+VP2

[0055] rFHV-VP1-VP2 strain and parental strain FHV-1 were inoculated into CRFK cells at an MOI ratio of 0.1. Viral fluid was collected every 24 hours to determine TCID. 50 The growth curves of rFHV-VP1-VP2 and the parental strain were plotted. The results showed that the growth curves of rFHV-VP1-VP2 were essentially identical, indicating that the insertion of the exogenous gene did not significantly affect the virus's replication ability (see [link to original text]). Figure 3 ).

[0056] 2.4 Indirect immunofluorescence (IFA) identification of exogenous protein expression

[0057] CRFK cells were infected with rFHV-VP1-VP2 at a 0.5 MOI. Once lesions appeared, indirect immunofluorescence was performed using FCV VP1 and FPV VP2 monoclonal antibodies as primary antibodies and FITC-labeled goat anti-mouse IgG as secondary antibody. The results showed that the lesion areas of CRFK cells inoculated with the recombinant virus emitted bright green fluorescence, while cells inoculated with the parental virus showed no fluorescence, indicating that both VP1 and VP2 proteins were effectively expressed (see [link to relevant documentation]). Figure 4 ).

[0058] 2.5 Genetic stability analysis of recombinant viruses

[0059] The recombinant virus rFHV-VP1-VP2 was passaged 20 times in CRFK cells. DNA was extracted from the 10th, 15th, and 20th passages for PCR detection, and protein expression was detected by Western blot. The results showed that the VP1 and VP2 genes were stably amplified in each passage, and both VP1 and VP2 proteins were expressed (see [link to relevant documentation]). Figure 5 This indicates that the recombinant virus has good genetic stability.

[0060] Example 3: Evaluation of the immunoprotective effect of recombinant viral vaccine against FCV and FPV

[0061] 3.1 Immunization regimen for recombinant virus vaccine

[0062] Twenty 2-3 month old kittens that were negative for FHV-1, FCV, and FPV antibodies were randomly divided into 4 groups of 5 kittens each. Group 1 (FHV-VP1-VP2 immunization + FCV challenge): subcutaneous injection of rFHV-VP1-VP2 (10) into the neck. 5 PFU / animal). Group 2 (rFHV-VP1-VP2 immunization + FPV challenge): subcutaneous injection of rFHV-VP1-VP2 (10 PFU / animal) into the neck.5 PFU / animal). Group 3 (negative control + FCV challenge): Inoculated with an equal volume of vaccine diluent (diluted with physiological saline to a concentration of 0.9%). Group 4 (negative control + FPV challenge): Inoculated with an equal volume of vaccine diluent.

[0063] 3.2 FCV challenge protection test

[0064] 28 days after immunization, kittens in groups 1 and 3 were challenged with a virulent strain of FCV via nasal drops (10 7 TCID 50 / each). Kittens were observed for 14 days after challenge, with daily temperature measurements and clinical symptoms (sneezing, nasal and ocular discharge, oral ulcers, etc.) recorded. Results showed that in Group 3 (challenge control group), all kittens developed typical FCV clinical symptoms 3-5 days after challenge, including sneezing, depression, loss of appetite, serous nasal and ocular discharge, coughing, and oral and lingual ulcers; some died later, resulting in a protection rate of 0 / 5. In Group 1 (immunization group): only one kitten showed mild sneezing on day 4 after challenge; the other four kittens had normal temperatures and no clinical symptoms, resulting in a protection rate of 4 / 5 (80%). Figure 6 As shown in (a).

[0065] 3.3 FPV attack protection test

[0066] 28 days after immunization, kittens in groups 2 and 4 were orally challenged with a virulent FPV strain (10). 5 TCID 50 / each). Kittens were observed for 14 days after challenge, with daily temperature measurements, white blood cell counts, and observation for clinical symptoms such as vomiting and diarrhea. Results showed that in group 4 (challenge control group), all kittens developed typical FPV clinical symptoms 3-6 days after challenge, including high fever, vomiting, diarrhea, and a sharp drop in white blood cell count; some kittens died, with a protection rate of 0 / 5. In group 2 (immunization group), all kittens had normal body temperature, good appetite, and white blood cell counts remained within the normal range; no vomiting, diarrhea, or other clinical symptoms were observed, with a protection rate of 5 / 5 (100%). Figure 6 As shown in (b).

[0067] The above results indicate that the recombinant virus rFHV-VP1-VP2 constructed in this invention has good safety for kittens and can provide effective protection against both virulent FCV and virulent FPV attacks.

Claims

1. A recombinant feline herpesvirus strain co-expressing feline calicivirus VP1 protein and feline parvovirus VP2 protein.

2. The recombinant feline herpesvirus strain as described in claim 1, characterized in that, The feline calicivirus VP1 gene expression cassette was inserted between the gI and gE genes of feline herpesvirus, and the feline parvovirus VP2 gene expression cassette was inserted into the TK gene of feline herpesvirus. Furthermore, the insertion of the gI gene at the 5' end of the feline calicivirus VP1 gene and the insertion of the gE gene at the 3' end of the VP1 gene result in the inability of both the feline herpesvirus gI and gE genes to be expressed normally, thereby achieving the effect of gene silencing; the insertion of the feline parvovirus VP2 gene into the TK gene of feline herpesvirus results in the inability of the TK gene to be expressed normally, thereby achieving the effect of gene silencing.

3. The recombinant feline herpesvirus strain as described in claim 1, characterized in that, A CAG complex promoter-VP1-RBG polyA expression cassette was constructed for feline calicivirus VP1 and placed between the gI and gE genes of feline herpesvirus; an hCMV promoter-VP2 gene-SV40 polyA expression cassette was constructed for feline parvovirus VP2 and placed inside the TK gene of feline herpesvirus.

4. The recombinant feline herpesvirus strain as described in claim 1, characterized in that, The amino acid sequence of the feline calicivirus VP1 protein is shown in SEQ ID NO:

1. The amino acid sequence of the feline parvovirus VP2 protein is shown in SEQ ID NO:

2.

5. The use of the recombinant feline herpesvirus strain as described in any one of claims 1 to 4 in the preparation of a live vector vaccine.

6. A feline triple vaccine, characterized in that, Including the recombinant feline herpesvirus strain as described in any one of claims 1 to 4.

7. The feline triple vaccine as described in claim 6, characterized in that, It also includes adjuvants.

8. The method for preparing the feline triple vaccine as described in claim 6, characterized in that, Its preparation method includes the following steps: Construction of S1TK site transfer vector and gI / gE site transfer vector and verification of FHV-1 gene insertion site; Construction and identification of recombinant FHV virus expressing dual fluorescent proteins eGFP and mCherry in S2; Construction and identification of transfer plasmids expressing FCV VP1 and FPV VP2, respectively, in S3; Construction of S4 recombinant virus rFHV-VP1-VP2 and screening of reverse dual fluorescent proteins; Rescue, in vitro replication characteristics, and genetic stability analysis of S5 recombinant virus rFHV-VP1-VP2; Evaluation of the in vivo immunogenicity of S6 recombinant virus rFHV-VP1-VP2.

9. The method for preparing the feline triple vaccine as described in claim 8, characterized in that, In S1, based on the FHV-1 genome sequence, specific sgRNAs were designed for the gI, gE, and TK genes. Specifically, the following targets were selected: the sgRNAs for the TK gene are TK-sgRNA1 and TK-sgRNA2, with target sequences of CGGTGGTATCTATGCCGTCC and CGAGCCTATTCCGTTCATAG, respectively, and corresponding PAMs of AGG and TGG, respectively; the sgRNAs for the gI and gE genes are gI-sgRNA1 and gE-sgRNA2, with target sequences of GTTTACTCATTCGATACGCG and AGTTCGTCGGGATCGTTACT, respectively, and corresponding PAMs of TGG and AGG, respectively.

10. The use of a recombinant feline triple virus in the preparation of a drug (e.g., a vaccine) for the prevention of feline herpesvirus, feline calicivirus and / or feline parvovirus infection.

Images