Nucleic acid molecules, conjugates thereof, and uses thereof

Abstract

The application belongs to the field of biological medicine, and relates to siRNA for ST2L, siRNA conjugates and application thereof. The siRNA molecule of the application is specifically directed to the intracellular domain coding region of ST2L, can specifically reduce the expression of ST2L, does not affect the function of sST2, and has a significant drug prospect.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to a nucleic acid molecule, more specifically, to a siRNA targeting ST2L. Background Technology

[0002] Growth stimulation expressed gene 2 (ST2), also known as interleukin 1 receptor-like 1 (IL1RL1), is a member of the Toll-like / IL-1 receptor superfamily and the only receptor protein for IL-33. ST2 can be expressed by different transcripts of the same gene in four different isoforms with different structures and functions. The two most important isoforms are the transmembrane receptor ST2 (ST2L) and the soluble ST2 (sST2). Numerous studies have confirmed that the IL-33 / ST2 signaling pathway is closely related to Th2-type inflammation and plays an important role in respiratory diseases such as asthma and chronic obstructive pulmonary disease. When respiratory epithelial cells are stimulated by allergens, viruses, tissue damage, etc., they release IL-33. Mature IL-33 binds to the transmembrane ST2L and then to the IL-1 receptor cofactor (IL-1RAcP) to form a ternary complex, thereby triggering downstream inflammatory cascade responses, regulating the expression of immune factors such as IL-4, IL-5, and IL-13, and thus activating the Th2-type inflammatory pathway.

[0003] From a protein structure perspective, ST2L, as a transmembrane receptor, consists of three parts: an extracellular domain, a transmembrane domain, and an intracellular domain, encoding a total of 556 amino acids. The extracellular domain comprises three IgG-like structures that bind to IL-33, while the intracellular domain is the Toll-IL1 receptor domain (TIR domain), which binds to IL-1 receptor accessory proteins and initiates downstream inflammatory pathways. Soluble sST2, on the other hand, consists of only 323 amino acids identical to the ST2L extracellular domain, plus 5 substituted amino acids. It can only competitively bind to IL-33 and cannot initiate inflammatory pathways; therefore, sST2 is a decoy receptor and plays a negative regulatory role in the IL-33 / ST2 pathway. Currently, several monoclonal antibody drugs targeting ST2 have entered the clinical research stage globally. However, since the extracellular domain structures of sST2 and ST2L are completely identical, small molecule and antibody drugs and other inhibitors cannot effectively distinguish between the two subtypes of ST2. While inhibiting ST2L, which plays a key role in the inflammatory pathway, they also inhibit sST2, which has an antagonistic effect, thus affecting the therapeutic effect to some extent. Summary of the Invention

[0004] This application utilizes small nucleic acids based on RNA interference mechanisms to specifically target the intracellular domain coding region of ST2L. While specifically reducing ST2L expression, it does not affect the function of sST2, thus preserving its negative feedback regulatory mechanism. A series of siRNAs targeting the human ST2L gene have been designed, specifically targeting the intracellular domain coding region of ST2L, making them a more promising new therapeutic approach for the IL-33 / ST2 pathway.

[0005] In a first aspect, the present invention provides an siRNA comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand are at least partially anti-complementary to form a double-stranded region, and the length and composition of the antisense strand enable the siRNA to inhibit the expression of ST2L mRNA via an RNAi mechanism.

[0006] In some implementations, the justice chain and the antisense chain may be the same length or different lengths.

[0007] In some embodiments, the length of the sense strand and the antisense strand may each be 15 to 35 nucleotides. In some embodiments, the length of the sense strand and the antisense strand may each be 18 to 30 nucleotides.

[0008] In some embodiments, the ST2L mRNA sequence is shown in SEQ ID NO: 137.

[0009] In some embodiments, the length difference between the sense and antisense strands is 0 to 5 nucleotides. In some embodiments, the length of the sense strand is no greater than the length of the antisense strand. In some embodiments, the length of the antisense strand is 1 to 3 nucleotides greater than the length of the sense strand; or the length of the antisense strand is 2 nucleotides greater than the length of the sense strand.

[0010] In some embodiments, the length of the sense strand is 19-23 nucleotides, and the length of the antisense strand is 19-26 nucleotides. In some embodiments, the length of the sense strand is 15, 16, 17, 18, 19, 20, or 21 nucleotides, and the length of the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.

[0011] In some implementations, the justice chain and the antisense chain are substantially opposite complementary, substantially opposite complementary, or completely opposite complementary.

[0012] In some implementations, the justice chain and the antisense chain are mutually complementary to form a dual-chain region, and the dual-chain region has no more than 3, no more than 2, and no more than 1 mismatches.

[0013] In some embodiments, the sense strand and the antisense strand are inversely complementary to form a double-stranded region, the length of which is 15 to 30 base pairs; in some embodiments, the length of which is 15 to 21 base pairs; in some preferred embodiments, the length of which is 19 to 21 base pairs.

[0014] In some embodiments, the sense strand or antisense strand has a protruding end. In some embodiments, the 5' end of the sense strand or the 3' end of the antisense strand is a protruding end. In some embodiments, the protruding end is 1 to 3 nucleotides long. In some embodiments, the protruding end is a 2-nucleotide protruding end.

[0015] In some embodiments, the siRNA molecule has blunt ends.

[0016] In some embodiments, the antisense strand is substantially anticomplementary, substantially anticomplementary, or completely anticomplementary to a continuous nucleotide sequence m in the ST2L mRNA. In some embodiments, the antisense strand is the same length as the nucleotide sequence m, and at least the nucleotide sequence other than the terminal nucleotide of the antisense strand is completely anticomplementary to the nucleotide sequence m; in some embodiments, all nucleotides of the antisense strand are completely anticomplementary to the nucleotide sequence m.

[0017] In some embodiments, the length of the nucleotide sequence m is not greater than the length of the antisense strand; in some embodiments, the length of the nucleotide sequence m is the same as the length of the antisense strand. In some embodiments, the nucleotide sequence m differs from the antisense strand by no more than 8 nucleotides. In some embodiments, the nucleotide sequence m differs from the antisense strand by 1 to 5 nucleotides.

[0018] In some embodiments, the length of the nucleotide sequence m is at least 15 nucleotides, or 15-23 nucleotides, or 15-21 nucleotides, or 19-21 nucleotides.

[0019] In some embodiments, the antisense strand is substantially anticomplementary, substantially anticomplementary, or completely anticomplementary to a continuous nucleotide sequence m in the ST2L mRNA. In some embodiments, the nucleotide sequence m is located in both the transmembrane and intracellular coding regions of the ST2L mRNA. In some embodiments, the nucleotide sequence m is located at positions 1183-1855 of the ST2L mRNA sequence. In some embodiments, the nucleotide sequence m is located at positions 1416-1730 of the ST2L mRNA sequence. In some embodiments, the nucleotide sequence m is located at positions 1416-1447, or 1510-1730 of the ST2L mRNA sequence.

[0020] In some embodiments, the nucleotide sequence m is 21 nucleotides in length and is located at positions 1416-1436, 1419-1439, 1427-1447, 1510-1530, 1707-1727, or 1710-1730 of the ST2L mRNA sequence.

[0021] In this invention, the sequence of the ST2L mRNA is as shown in Genbank NM_016232.5, or as shown in SEQ ID NO: 137.

[0022] In some embodiments, the siRNA antisense strand comprises a nucleotide sequence differing from the antisense strand of any siRNA in Table 1 by 0, 1, 2, or 3 nucleotides. In some embodiments, the siRNA antisense strand comprises a nucleotide sequence differing from the antisense strand of any siRNA in Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the siRNA antisense strand comprises a nucleotide sequence differing from the sequences shown in SEQ ID NO: 139, SEQ ID NO: 141, or SEQ ID NO: 143 by 0, 1, 2, or 3 nucleotides.

[0023] In some embodiments, the siRNA sense strand and antisense strand respectively comprise the nucleotide sequences of the sense strand and antisense strand of any siRNA in Table 1, or nucleotide sequences that differ from the sense strand and antisense strand of any siRNA shown in Table 1 by 0, 1, 2, or 3 nucleotides respectively.

[0024] In some embodiments, the siRNA sense strand and antisense strand respectively comprise the nucleotide sequences of the sense strand and antisense strand of any siRNA in Table 3, or nucleotide sequences that differ from the sense strand and antisense strand of any siRNA shown in Table 3 by 0, 1, 2, or 3 nucleotides respectively.

[0025] In some embodiments, the sense and antisense strands of the siRNA respectively comprise:

[0026] (i) The nucleotide sequences shown in SEQ ID NO: 138 and SEQ ID NO: 139;

[0027] (ii) The nucleotide sequences shown in SEQ ID NO: 140 and SEQ ID NO: 141;

[0028] (iii) The nucleotide sequences shown in SEQ ID NO: 142 and SEQ ID NO: 143; or

[0029] (iv) Nucleotide sequences that differ from the sense and antisense strands shown in (i), (ii) or (iii) by 0, 1, 2 or 3 nucleotides, respectively.

[0030] In some embodiments, some nucleotides in the sense and antisense strands are modified nucleotides.

[0031] In some embodiments, all nucleotides in the sense and antisense strands are modified nucleotides.

[0032] In some embodiments, the modified nucleotide is a fluorinated nucleotide or a non-fluorinated nucleotide.

[0033] In specific embodiments, the fluorinated nucleotide refers to a nucleotide formed by replacing the hydroxyl group at the 2'-position of the ribosyl group with fluorine, having the structure shown in formula (1). The non-fluorinated nucleotide refers to a nucleotide or nucleotide analog formed by replacing the hydroxyl group at the 2'-position of the ribosyl group with a non-fluorinated group. In some embodiments, each non-fluorinated nucleotide is independently selected from one of the nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2'-position of the ribosyl group with a non-fluorinated group. These nucleotides formed by replacing the hydroxyl group at the 2'-position of the ribosyl group with a non-fluorinated group are well known to those skilled in the art, and these nucleotides may be selected from one of 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, and 2'-deoxynucleotides.

[0034] In some embodiments, the 2'-alkoxy-modified nucleotide is a methoxy-modified nucleotide (2'-OMe), as shown in formula (2). In some embodiments, the 2'-substituted alkoxy-modified nucleotide may be, for example, a 2'-O-methoxyethyl-modified nucleotide (2'-MOE), as shown in formula (3). In some embodiments, the 2'-amino-modified nucleotide (2'-NH2) is shown in formula (4). In some embodiments, the 2'-deoxynucleotide (DNA) is shown in formula (5).

[0035]

[0036] The aforementioned nucleotide analogues refer to groups that can replace nucleotides in nucleic acids, but whose structure differs from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine ribonucleotide. In some embodiments, the nucleotide analogue may be an isonucleotide, threonucleotide, reverse nucleotide, locked nucleotide, 5'-vinyl phosphate nucleotide, bridged nucleotide, or acyclic nucleotide.

[0037] The aforementioned bridging nucleotides refer to restricted or inaccessible nucleotides. Bridging nucleotides may contain a five-membered, six-membered, or seven-membered ring with a bridging structure that has a fixed C3-endoglucan condensation. In some embodiments, the bridging nucleotide may be LNA, ENA, cET BNA, etc.; wherein LNA is shown in formula (6), ENA is shown in formula (7), and cET BNA is shown in formula (8).

[0038]

[0039] The aforementioned acyclic nucleotides are a class of nucleotides formed by opening the sugar ring of a nucleotide. In some embodiments, the acyclic nucleotide can be an unlocked nucleic acid (UNA) or a glycerol nucleic acid (GNA), wherein UNA is shown as in formula (9) and GNA is shown as in formula (10).

[0040]

[0041] In formulas (9) and (10) above, R is selected from H, OH, or alkoxy (O-alkyl).

[0042] Isonucleotides are compounds formed by altering the position of a base on the ribose ring in a nucleotide. In some embodiments, an isonucleotide can be a compound formed by moving a base from the 1'-position to the 2' or 3' position on the ribose ring, as shown in formula (11) or formula (12).

[0043]

[0044] In the compounds of formulas (11) and (12) above, R is selected from H, OH, F or non-fluorine groups as described above;

[0045] In the compounds of formulas (1) to (12) above, Base represents a base, such as A, U, G, C or T.

[0046] In some embodiments, the modified nucleotide is selected from the group consisting of: 2'-deoxynucleotides, 2'-fluoromodified nucleotides, 2'-O-methylmodified nucleotides, 2'-O-methoxyethylmodified nucleotides, phosphate-thioester-modified nucleotides, and any combination thereof.

[0047] In some embodiments, the positive strand contains fewer than 15 2'-fluorinated nucleotides; in specific embodiments, the positive strand contains 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 2'-fluorinated nucleotide.

[0048] In some embodiments, the antisense strand contains fewer than 15 2'-fluorinated nucleotides; in specific embodiments, the sense strand contains 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 2'-fluorinated nucleotide.

[0049] In some embodiments, one or more nucleotides at positions 1, 3, 5, 7, 9, 10, 11, 13, 15, 17, 19, or 21 of the sense strand are 2'-fluorinated nucleotides, following the 5'-to-3'-end direction; and one or more nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, or 22 of the antisense strand are 2'-fluorinated nucleotides, following the 5'-to-3'-end direction.

[0050] In some embodiments, positions 1, 3, 5, 7, 9-11, 13, 15, 17, 19, and 21 of the sense strand are 2'-fluorinated nucleotides, with the direction from 5'-end to 3'-end; and positions 2, 4, 6, 8, 10, 14, 16, 18, 20, and 22 of the antisense strand are 2'-fluorinated nucleotides, with the direction from 5'-end to 3'-end.

[0051] In some embodiments, positions 7, 9, 10, and 11 of the sense strand are 2'-fluorinated nucleotides, following the direction from the 5'-end to the 3'-end; and positions 2, 6, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides.

[0052] In some embodiments, positions 7, 9, 10, and 11 of the sense strand are 2'-fluorinated nucleotides in the direction from 5'-end to 3'-end; and positions 2, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides in the direction from 5'-end to 3'-end, and positions 5 and 7 of the antisense strand are 2'-deoxynucleotides.

[0053] In some embodiments, positions 9, 11, and 13 of the sense strand are 2'-fluorinated nucleotides in the direction from 5'-end to 3'-end; and positions 2, 12, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides in the direction from 5'-end to 3'-end, and positions 5 and 7 of the antisense strand are 2'-deoxynucleotides.

[0054] In some embodiments, positions 9-11 of the sense strand are 2'-fluorinated nucleotides in the direction from 5'-end to 3'-end; and positions 2, 6, 12, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides in the direction from 5'-end to 3'-end, and positions 5 and / or 7 of the antisense strand are 2'-deoxynucleotides.

[0055] In some embodiments, positions 9 to 11 of the sense strand are 2'-fluorinated nucleotides in the direction from 5'-end to 3'-end; and positions 2, 6, 10, 12, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides in the direction from 5'-end to 3'-end, and positions 5 and / or 7 of the antisense strand are 2'-deoxynucleotides.

[0056] In some embodiments, at least a portion of the phosphate ester groups in the phosphate-sugar backbone of at least one single strand of the sense and antisense strands of the siRNA provided by the present invention are phosphate ester groups with modifying groups. In some embodiments, the phosphate ester group with modifying groups is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphodiester bond of the phosphate ester group with a sulfur atom; in some embodiments, the phosphate ester group with modifying groups is a thiophosphate ester group having the structure shown in formula (13):

[0057]

[0058] In some embodiments, the siRNA provided by the present invention comprises, independently, one, two, or three thiosulfate groups on the sense and antisense strands. In some embodiments, the thiophosphate groups are present at the 5'-terminus and / or 3'-terminus of the sense and / or antisense strands.

[0059] In some embodiments, the thiophosphate group is present at at least one of the following positions: between the first and second nucleotides of the sense and / or antisense strands; between the second and third nucleotides of the sense and / or antisense strands; between the 19th and 20th nucleotides of the antisense strand; between the 20th and 21st nucleotides of the sense and / or antisense strands; between the 21st and 22nd nucleotides of the antisense strand; between the 22nd and 23rd nucleotides of the antisense strand; or any combination thereof.

[0060] In some embodiments, the 5'-terminal nucleotide of the siRNA's sense or antisense strand is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide, as shown in formulas (14), (15), and (16):

[0061] ,

[0062] Where Base represents a base.

[0063] In specific embodiments, the siRNA is as shown in Table 1, or has no more than 3 nucleotide differences from the sense strand and / or antisense strand of the molecules shown in Table 1, such as 3, 2 or 1 nucleotide differences.

[0064] In specific embodiments, the siRNA is as shown in Table 2, or has no more than 3 nucleotide differences from the sense strand and / or antisense strand of the molecules shown in Table 2, such as 3, 2 or 1 nucleotide differences.

[0065] In a specific embodiment, the sense strand and antisense strand of the siRNA comprise the sense strand and antisense strand sequences selected from any of the siRNAs shown in Table 2, or nucleotide sequences that differ from the sense strand and antisense strand of any of the siRNAs shown in Table 2 by 0, 1, 2, or 3 nucleotides, respectively.

[0066] In a specific implementation, the sense and antisense strands of the siRNA comprise:

[0067] (i) The nucleotide sequences shown in SEQ ID NO: 91 and SEQ ID NO: 92;

[0068] (ii) The nucleotide sequences shown in SEQ ID NO: 93 and SEQ ID NO: 94;

[0069] (iii) The nucleotide sequences shown in SEQ ID NO: 97 and SEQ ID NO: 98;

[0070] (iv) The nucleotide sequences shown in SEQ ID NO: 99 and SEQ ID NO: 100;

[0071] (v) The nucleotide sequences shown in SEQ ID NO: 101 and SEQ ID NO: 102;

[0072] (vi) The nucleotide sequences shown in SEQ ID NO: 107 and SEQ ID NO: 108;

[0073] or

[0074] ( The nucleotide sequences shown in (i) to (vi) are the sense and antisense strands that differ by 0, 1, 2, and 3 nucleotides, respectively.

[0075] In a second aspect, the present invention provides an siRNA conjugate comprising the siRNA molecule described above and a conjugating group conjugated to the siRNA.

[0076] In some embodiments, the conjugation group comprises at least one pharmaceutically acceptable target group. In some embodiments, the conjugation group further comprises a linker, and the siRNA, the linker, and the target group are sequentially linked. In some embodiments, there are 1-6 target groups. In some embodiments, there are 2-4 target groups.

[0077] In some embodiments, the siRNA molecule can be non-covalently or covalently conjugated to the conjugation group, for example, it can be covalently conjugated to the conjugation group. The conjugation site of the siRNA and the conjugation group can be at the 3' or 5' end of the siRNA's sense strand, at the 5' end of the antisense strand, or within the siRNA's internal sequence. In some embodiments, the conjugation site of the siRNA and the conjugation group is at the 3' end of the siRNA's sense strand. In some embodiments, the conjugation group can be attached to a phosphate group, a 2'-hydroxyl group, or a base of a nucleotide. In some embodiments, the conjugation group can also be attached to a 3'-hydroxyl group, in which case the nucleotides are linked by a 2'-5' phosphodiester bond. When the conjugation group is attached to the end of the siRNA strand, it is usually attached to a phosphate group of a nucleotide; when the conjugation group is attached to the internal sequence of the siRNA, it is usually attached to a ribose ring or a base. For various connection methods, please refer to the following: Muthiah Manoharan et al. siRNA conjugates carrying sequentially assembledtrivalent N-acetylgalactosamine linked through nucleosides elicit robust genesilencing in vivo in hepatocytes. ACS Chemical biology, 2015, 10 (5): 1181-7.

[0078] In some embodiments, the siRNA and the conjugate group are linked by acid-labile or reducible chemical bonds. These bonds can degrade in the acidic environment of the endosomes, thus freeing the siRNA. For non-degradable conjugates, the conjugate group can be attached to the positive and negative strands of the siRNA to minimize the impact of the conjugate on the siRNA's activity.

[0079] In some embodiments, the pharmaceutically acceptable targeting group may be a ligand conventionally used in the field of siRNA delivery. In some embodiments, each ligand is independently selected from a ligand capable of binding to a cell surface receptor. These ligands are known to those skilled in the art and function to bind to specific receptors on the surface of target cells, mediating the delivery of ligand-linked siRNA to the target cells. In some embodiments, at least one of the targeting groups is selected from known delivery ligands with lung delivery small nucleic acid functions. In some embodiments, at least one targeting group is a ligand targeting a receptor on the surface of lung cells. In some embodiments, each targeting group is a ligand targeting a receptor on the surface of lung cells. In some ways, at least one targeting group is a group capable of targeting integrin αvβ3. In some embodiments, each targeting group is a group capable of targeting integrin αvβ3. In some embodiments, at least one targeting group is a group capable of targeting integrin αvβ6. In some embodiments, each targeting group is a group capable of targeting integrin αvβ6. In some embodiments, at least one targeting group is a lipid nanoparticle, a specific antibody, or a targeting peptide.

[0080] In a third aspect, a composition is provided comprising the siRNA molecule or siRNA conjugate of the present invention.

[0081] In some embodiments, the composition is a pharmaceutical composition containing siRNA or siRNA conjugates as described above as the active ingredient, and a pharmaceutically acceptable carrier.

[0082] The pharmaceutically acceptable carrier can be a carrier commonly used in the field of siRNA delivery, such as, but not limited to, magnetic nanoparticles (e.g., Fe3O4 or Fe2O3-based nanoparticles), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), and poly(2-aminoethyl ethylene phosphate). One or more of the following: phosphate), PPEEA, and poly(2-dimethylaminoethylmethacrylate) (PDMAEMA) and their derivatives.

[0083] In some embodiments, there are no particular requirements for the content of siRNA and pharmaceutically acceptable carrier in the pharmaceutical composition.

[0084] In some embodiments, the pharmaceutical composition may further comprise other pharmaceutically acceptable excipients, which may be one or more of a variety of formulations or compounds conventionally used in the art. For example, such other pharmaceutically acceptable excipients may include at least one of pH buffers, protectants, and osmotic pressure regulators. Those skilled in the art can select suitable excipients based on existing technology.

[0085] The pH buffer solution can be tris(hydroxymethyl)aminomethane hydrochloride buffer, phosphate buffer, etc.

[0086] The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose.

[0087] The osmotic pressure regulator may be, for example, sodium chloride and / or potassium chloride.

[0088] In some embodiments, the pharmaceutical composition may be a liquid formulation, such as an injection; or it may be a lyophilized powder for injection, which is mixed with liquid excipients to form a liquid formulation for administration. The liquid formulation may be used, but is not limited to, for subcutaneous, intramuscular, or intravenous administration, or may be delivered via, but is not limited to, aerosol administration to the lungs, aerosol administration to other organs (such as the liver), or oral inhalation, or nasal administration. In some embodiments, the pharmaceutical composition is used for aerosol administration.

[0089] In some embodiments, the pharmaceutical composition may be in the form of a liposomal formulation. In some embodiments, the pharmaceutically acceptable carrier used in the liposomal formulation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), a cofactor lipid, and / or a polyethylene glycol-modified lipid. The organic amine, cofactor lipid, and polyethylene glycol-modified lipid may be selected from one or more of the amine-containing transfection compounds or their pharmaceutically acceptable salts or derivatives, cofactor lipids, and polyethylene glycol-modified lipids described in Chinese patent application CN103380113A (which is incorporated herein by reference in its entirety).

[0090] In a fourth aspect, the present invention provides a kit comprising an effective amount of at least one of the siRNA of the present invention, a pharmaceutical composition, and an siRNA conjugate.

[0091] In some embodiments, the kit described herein may provide siRNA in a single container. In some embodiments, the kit described herein may include a container providing pharmaceutically acceptable excipients. In some embodiments, the kit may also contain other components, such as stabilizers or preservatives. In some embodiments, the kit described herein may contain at least one other therapeutic agent in a container other than the one providing the siRNA described herein. In some embodiments, the kit may include instructions for mixing the siRNA with a pharmaceutically acceptable carrier and / or excipients or other components (if any).

[0092] In the kits of the present invention, the siRNA, siRNA conjugates, compositions, and pharmaceutically acceptable carriers and / or excipients may be provided in any form, such as liquid, dry, or lyophilized. In some embodiments, the siRNA, siRNA conjugates, compositions, pharmaceutically acceptable carriers, and / or excipients are substantially pure and / or sterile. In some embodiments, sterile water may be provided in the kits of the present invention.

[0093] In a fifth aspect, the invention provides the use of siRNAs, siRNA conjugates, compositions, and kits in the preparation of medicaments for treating and / or preventing diseases or conditions related to the inflammatory pathway caused by the IL-33 / ST2 pathway. In some embodiments, the disease or condition related to the inflammatory pathway caused by the IL-33 / ST2 pathway is a lung-related disease. In some embodiments, the disease or condition is selected from chronic obstructive pulmonary disease, acute respiratory infection, noncystic bronchiectasis, or asthma.

[0094] In a sixth aspect, a method is provided for treating and / or preventing diseases or conditions associated with the inflammatory pathway caused by the IL-33 / ST2 pathway, the method comprising administering an effective amount of the siRNA or siRNA conjugate or composition of the present invention to a subject in need.

[0095] In some embodiments, the disease or condition associated with the inflammatory pathway caused by the IL-33 / ST2 pathway is a lung-related disease. In some embodiments, the disease or condition is selected from chronic obstructive pulmonary disease, acute respiratory infection, noncystic bronchiectasis, or asthma.

[0096] As used herein, the term "administration" refers to the placement of the siRNA, siRNA conjugate, or composition of the present invention into a subject by means of a method or route that at least partially positions the siRNA, siRNA conjugate, or composition of the present invention at a desired site to produce a desired effect. Routes of administration suitable for the methods of the present invention include local administration and systemic administration. In some embodiments, a route of administration capable of delivering the drug to the lungs is employed.

[0097] The medication may be administered to the subject via any suitable route known in the art, including but not limited to: oral or parenteral routes, such as intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, airway administration (aerosol), pulmonary administration, nasal administration, rectal administration, and local administration (including oral and sublingual administration). Administration frequency may be once or more daily, weekly, bi-weekly, tri-weekly, monthly, or annually.

[0098] The dosage of the siRNA, siRNA conjugate, or composition described in this invention can be a conventional dosage in the art, and the dosage can be determined based on various parameters, especially the age, weight, and sex of the subject. Toxicity and efficacy can be determined in cell culture or laboratory animals using standard pharmaceutical procedures, such as determining the LD50. 50 (Lethal dose that causes 50% mortality in the population) and ED 50(In quantitative responses, this refers to the dose that elicits 50% of the maximum response intensity; in qualitative responses, it refers to the dose that elicits a positive response in 50% of the subjects.) The range of human dosages can be determined based on data obtained from cell culture analysis and animal studies. In some embodiments, the dosage of the formulation made from the siRNA, siRNA conjugate, or pharmaceutical composition is adjusted during administration depending on the route of administration.

[0099] This invention provides a series of siRNA molecules and their conjugates that specifically target the intracellular coding region of ST2L, and can significantly reduce the expression of ST2L gene at the in vitro cellular level, while having no or weak inhibition on the expression of sST2 gene, showing significant potential for drug development. Detailed Implementation

[0100] The following provides a detailed description of specific embodiments of this disclosure. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit this disclosure.

[0101] definition

[0102] In this invention, ST2L mRNA refers to the sequence shown in GenBank accession number NM_016232.5. Further, unless otherwise specified, the term "target gene" as used herein refers to the gene encoding the aforementioned ST2L mRNA, and the term "target mRNA" refers to the aforementioned ST2L mRNA.

[0103] In the context of this invention, unless otherwise specified, uppercase letters C, G, U, and A represent the base composition of nucleotides; lowercase letter m indicates that the nucleotide adjacent to the left of letter m is a methoxy-modified nucleotide; lowercase letter f indicates that the nucleotide adjacent to the left of letter f is a fluorinated nucleotide; and lowercase letter s indicates that the two nucleotides adjacent to the left and right of letter s are linked by thiophosphate groups.

[0104] In the context of this invention, "fluorinated nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosome with fluorine, and "non-fluorinated nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the 2'-hydroxyl group of the ribosome with a non-fluorinated group. "Nucleotide analog" refers to a group that can replace a nucleotide in nucleic acids but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Examples include isonucleotides, bridged nucleic acids (BNAs), or acyclic nucleotides. "Methoxylated nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosome with a methoxy group.

[0105] In the context of this invention, the terms "complementary" and "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired complementaryly with the bases of the other strand. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair comprises one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the complementary strand can be inferred from its sequence. Correspondingly, "mismatch" in the art means, in a double-stranded nucleic acid, that the bases at corresponding positions are not paired complementaryly.

[0106] In the context of this invention, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially reverse complementary" means that there are no more than 1 base mismatch between the two nucleotide sequences; and "completely reverse complementary" means that there are no base mismatches between the two nucleotide sequences.

[0107] In the context of this invention, a "nucleotide difference" between two nucleotide sequences refers to a change in the type of bases at the same position of the nucleotides compared to the latter. For example, if a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G, or T, then a nucleotide difference at that position is considered to exist between the two nucleotide sequences. In some embodiments, replacing the nucleotide at the original position with a baseless nucleotide or its equivalent can also be considered a nucleotide difference at that position.

[0108] In the context of this invention, particularly when describing methods for preparing siRNA, pharmaceutical compositions, or siRNA conjugates, unless otherwise specified, the nucleoside monomer refers to the unmodified or modified RNA phosphoramidites (sometimes also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the desired siRNA or siRNA conjugate. Phosphoramidite solid-phase synthesis is a method known to those skilled in the art for RNA synthesis. All nucleoside monomers used in this invention are commercially available.

[0109] In the context of this invention, unless otherwise stated, "conjugation" refers to the covalent connection between two or more chemical parts, each having a specific function; correspondingly, "conjugated compound" refers to a compound formed by the covalent connection of these chemical parts. Further, "siRNA conjugated compound" refers to a compound formed by the covalent attachment of one or more chemical parts having a specific function to siRNA. siRNA conjugated compound should be understood, depending on the context, as a collective term for multiple siRNA conjugated compounds or a siRNA conjugated compound represented by a specific chemical formula. In the context of this invention, "conjugated molecule" should be understood as a specific compound that can be reactively conjugated to siRNA to ultimately form the siRNA conjugated compound of this disclosure.

[0110] As used herein, "alkoxy" refers to an alkyl group with a specified number of carbon atoms connected by oxygen bridges, such as methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentooxy, 2-pentoxy, isopentoxy, neopentoxy, hexoxy, 2-hexoxy, 3-hexoxy, 3-methylpentoxy, etc. Alkoxy groups typically have 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms connected by oxygen bridges.

[0111] The term “subject” as used herein refers to any animal, such as a mammal or marsupial. Subjects of this disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, rabbits, sheep, rats, and any kind of poultry.

[0112] As used herein, “treatment” refers to a method of achieving a beneficial or desired outcome, including but not limited to treatment benefits. A “treatment benefit” means the eradication or improvement of the underlying disorder being treated. Furthermore, a treatment benefit is achieved by eradicating or improving one or more physical symptoms associated with the underlying disorder, thereby observing improvement in the subject, even though the subject may still be suffering from the underlying disorder.

[0113] As used herein, “prevention” refers to methods for obtaining a beneficial or desired outcome, including but not limited to preventive benefits. To obtain a “preventive benefit,” siRNA, pharmaceutical compositions, or siRNA conjugates may be given to subjects at risk of developing a specific disease, or to subjects who report one or more physiological symptoms of a disease, even if a diagnosis of the disease may not have been made.

[0114] Example

[0115] Unless otherwise specified, the reagents and culture media used in the following examples are all commercially available products, and the nucleic acid electrophoresis, real-time PCR and other operations used are all performed in accordance with the methods described in Molecular Cloning (Cold Spring Harbor LBboratory Press (1989)).

[0116] Unless otherwise specified, all reagent ratios provided below are calculated on a volume basis (v / v). Data analysis was performed using Graphpad Prism 8.0 statistical analysis software.

[0117] Materials and equipment information:

[0118] All siRNA sequences were synthesized using the solid-phase phosphoramidite method commonly used in this field, and were sourced from Nanjing Genscript Biotech Co., Ltd.

[0119] KU812 cells: human peripheral blood basophilic leukemia cells, sourced from Nanjing Kebai Biotechnology Co., Ltd.;

[0120] HUVEC cells: human umbilical vein epithelial cells, sourced from Nanjing Kebai Biotechnology Co., Ltd.;

[0121] Lipofectamine RNAiMax Reagent transfection reagent, sourced from ThermoFisher;

[0122] Real-time PCR instrument, model QuantStudio 6 Pro, source: ThermoFisher;

[0123] Primer information:

[0124] Human ST2L primers:

[0125] Upstream (5'-3') GGCTTTTCTCTGTTTCCAGTAATCGG (SEQ ID NO: 133);

[0126] Downstream (5'-3') CAGTGACACAGAGGGAGTTCATAAAGTTAGA (SEQ ID NO: 134);

[0127] Human sST2 primers:

[0128] Upstream (5'-3') GGGCCAGTCGTGTAGAGCAC (SEQ ID NO: 135);

[0129] Downstream (5'-3') TGCACATCACAGCAGGCACT (SEQ ID NO: 136);

[0130] Human GAPDH primers:

[0131] Upstream (5'-3') GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 150);

[0132] Downstream (5'-3') ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 151).

[0133] The negative control used in the following examples is siNC.

[0134] SS: UUCUCCGAACGUGUCACGUTT (SEQ ID NO: 152),

[0135] AS: ACGUGACACGUUCGGAGAATT (SEQ ID NO: 153).

[0136] Example 1: Design and preparation of siRNA molecules

[0137] Forty-two pairs of siRNA molecules were designed based on the original sequence of the ST2L gene (NM_016232.5, SEQ ID NO: 137), and their sequences are shown in Table 1. The sense and antisense strands of the siRNA molecules listed in Table 1 were synthesized separately. Equal molar amounts of complementary sense and antisense strands were dissolved in DEPC water, followed by annealing to obtain the siRNA molecules. The siRNA was diluted to a concentration of 0.2 g / mL (based on siRNA) using ultrapure water (Milli-Q ultrapure water system, resistivity 18.2 MΩ*cm (25℃)). Molecular weight was then determined using liquid chromatography-mass spectrometry (LC-MS, Waters Corporation, model: LCT Premier). The measured values ​​were consistent with the theoretical values, indicating that the synthesized siRNA was the designed double-stranded nucleic acid sequence.

[0138] Modified siRNA molecules were prepared using the same method, and their sequences and modification methods are shown in Table 2. Identification was performed, and the obtained modified siRNA molecules were consistent with the target designed molecules. The base sequences of the modified siRNA molecules are shown in Table 3.

[0139] Table 1: siRNA molecules targeting the ST2L gene (42 pairs)

[0140]

[0141]

[0142] Table 2: Modified siRNA molecules

[0143]

[0144]

[0145] In this context, the lowercase letter m indicates that the nucleotide adjacent to the left of the letter m is a nucleotide modified with 2'-methoxy; the lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a nucleotide modified with 2'-fluoride; the lowercase letter s indicates that the two nucleotides to the left and right of the letter are linked by a thiophosphate group; and dA, dG, dC, and dU represent 2'-deoxynucleotides.

[0146] Table 3 Modified siRNA molecular base sequences

[0147]

[0148] Note: If the first two digits of the siRNA ID in Table 3 are the same as the first two digits of the siRNA ID in Table 2, it means that the positive and antisense strand sequences shown in Table 3 are the base sequences of the positive and antisense strands of the siRNA modified in Table 2. For example, the positive and antisense sequences shown in 25-1 in Table 3 correspond to the base sequences of the positive and antisense strands of the modified siRNAs 25-01, 25-02, 25-03, and 25-06 in Table 2.

[0149] Example 2: In vitro activity assay of siRNA targeting the ST2L gene

[0150] KU812 cells were loaded at 1.5*10 5 Cells were seeded at a density of 100 cells per well in 24-well plates. Using the Lipofectamine RNAiMax Reagent transfection reagent, the siRNA molecules listed in Table 1 were transfected according to the kit instructions, resulting in siRNA concentrations of 10 nM and 1 nM in the wells. A negative control (siNC) was also included. 24 h after transfection, the expression level of ST2L mRNA in each group relative to untreated negative cells was detected by qPCR. The results are shown in Table 4. Of the 42 pairs of original sequences, 31 pairs showed activity in inhibiting ST2L gene expression.

[0151] Table 4: Relative gene expression rate of ST2L

[0152]

[0153]

[0154]

[0155] The relative expression was calculated as follows: using GAPDH expression level as an internal reference, the relative activity of the ST2L gene in each group of cells compared to the negative control was calculated using 2^-ΔΔCt. The same applies below.

[0156] Example 3: In vitro activity assay of siRNA targeting the ST2L gene

[0157] HUVEC cells were loaded at 3.5*10 4 Cells were seeded at a density of 100 cells per well in 24-well plates and cultured overnight. Then, using the Lipofectamine RNAiMax Reagent transfection reagent, 31 siRNA molecules with inhibitory activity from Example 2 were transfected according to the kit instructions, resulting in siRNA concentrations of 10 nM and 1 nM in the wells. A negative control was also included. 24 hours after transfection, the expression level of ST2L mRNA in each group of cells relative to untreated negative cells was detected by qPCR. The results are shown in Table 5, further confirming that all 31 pairs of siRNA sequences in this series have significant inhibitory activity against ST2L gene expression.

[0158] Table 5: Relative gene expression rate of ST2L

[0159]

[0160]

[0161] Example 4: In vitro activity assay of siRNA targeting the ST2L gene

[0162] HUVEC cells were loaded at 3.5*10 4 Cells were seeded at a density of 100 cells per well in 24-well plates and cultured overnight. Then, using the Lipofectamine RNAiMax Reagent transfection reagent, the eight most potent siRNAs selected in Example 3 were transfected according to the kit instructions, resulting in siRNA concentrations of 10, 1, 0.1, 0.01, 0.005, 0.001, and 0.0001 nM in the wells. A negative control was also included. Twenty-four hours after transfection, the expression level of ST2L mRNA in each group relative to untreated negative cells was detected by qPCR, and the IC50 of the relative expression of the sequence repressor genes in each group was calculated. The results are shown in Table 6.

[0163] Table 6: IC50 of siRNA sequences in each group inhibiting ST2L gene expression

[0164]

[0165]

[0166] The IC50 was calculated as follows: using GAPDH expression level as an internal reference, and employing 2^-ΔΔCt, the relative activity of the ST2L gene in each group of cells compared to the negative control was calculated using the log (inhibitor) vs. response–Variable slope of Graphpad Prism. The same applies below.

[0167] Example 5: In vitro activity assay of siRNA targeting the sST2 gene

[0168] HUVEC cells were loaded at 3.5*10 4 Cells were seeded at a density of 100 cells per well in 24-well plates and cultured overnight. Then, using the Lipofectamine RNAiMax Reagent transfection reagent, the eight most potent siRNA molecules selected in Example 3 were transfected according to the kit instructions, resulting in siRNA concentrations of 10 nM and 1 nM in the wells. A negative control was also included. 24 hours after transfection, the expression level of sST2 mRNA in each group of cells relative to untreated negative cells was detected by qPCR. The results are shown in Table 7. Cells 26, 27, 38, and 39 showed no significant inhibition of sST2 gene expression; cells 25 and 33 showed weak inhibition; and cells 17 and 41 showed strong inhibition.

[0169] Table 7: Relative gene expression rate of sST2

[0170]

[0171] Example 6: In vitro activity assay of siRNA targeting the ST2L gene

[0172] HUVEC cells were loaded at 3.5*10 4 Cells were seeded at a density of 100 cells per well in 24-well plates and cultured overnight. Then, the modified siRNAs listed in Table 2 were transfected using the Lipofectamine RNAiMax Reagent transfection reagent, following the kit instructions. The concentrations of siRNAs in each well were 10 nM and 1 nM, respectively. A negative control was also included. Twenty-four hours after transfection, the expression level of ST2L mRNA in each group relative to untreated negative cells was detected by qPCR. The results are shown in Table 8.

[0173] Table 8: Relative gene expression rate of ST2L

[0174]

[0175]

[0176] Example 7: In vitro activity assay of siRNA targeting the ST2L gene

[0177] HUVEC cells were loaded at 3.5*10 4 Cells were seeded at a density of 100 cells per well in 24-well plates and cultured overnight. Then, using the Lipofectamine RNAiMax Reagent transfection reagent, the seven highly active siRNA modification sequences from Example 6 were transfected according to the kit instructions, resulting in siRNA concentrations of 10, 1, 0.1, 0.01, 0.005, 0.001, and 0.0001 nM in the wells. A negative control was also included. Twenty-four hours after transfection, the expression level of ST2L mRNA in each group relative to untreated negative cells was detected by qPCR, and the IC50 of the relative expression of the repressed genes in each group was calculated. The results are shown in Table 9.

[0178] Table 9: IC50 of each siRNA molecule inhibiting ST2L gene expression

[0179]

[0180] Example 8: In vitro activity assay of siRNA targeting the sST2 gene

[0181] HUVEC cells were loaded at 3.5*10 4 Cells were seeded at a density of 100 cells per well in 24-well plates and cultured overnight. Then, using the Lipofectamine RNAiMax Reagent transfection reagent, the seven highly active siRNA molecules from Example 6 were transfected according to the kit instructions, resulting in siRNA concentrations of 10 nM and 1 nM in the wells. A negative control was also included. 24 hours after transfection, the expression level of sST2 mRNA in each group of cells relative to untreated negative cells was detected by qPCR. The results are shown in Table 10. Cells 26-06 showed no significant inhibition of sST2 gene expression, while cells 25-06, 26-01, 26-03, 27-01, and 27-06 showed weak inhibition. Cell 27-03 showed strong inhibition of sST2 gene expression.

[0182] Table 10: Relative gene expression rate of sST2

[0183]

[0184] ST2L mRNA (SEQ ID NO: 137)

[0185]

Claims

1. An siRNA comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand are at least partially anticomplementary to form a double-stranded region, the length and composition of the antisense strand enabling the siRNA to inhibit the expression of ST2L mRNA via an RNAi mechanism; preferably, the length of each of the sense strand and the antisense strand is 15-35 nucleotides; more preferably, the length of each of the sense strand and the antisense strand is 18-30 nucleotides. The ST2L mRNA sequence is shown in SEQ ID NO: 137; Optionally, the length difference between the sense strand and the antisense strand is 0 to 5 nucleotides; preferably, the length of the sense strand is not greater than the length of the antisense strand; more preferably, the length of the antisense strand is 1 to 3 nucleotides longer than the length of the sense strand; or the length of the antisense strand is 2 nucleotides longer than the length of the sense strand. Optionally, the length of the positive strand is 19-23 nucleotides, and the length of the negative strand is 19-26 nucleotides; preferably, the length of the positive strand is 15, 16, 17, 18, 19, 20, or 21 nucleotides, and the length of the negative strand is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. Optionally, the justice chain and the antisense chain are substantially oppositely complementary, substantially oppositely complementary, or completely oppositely complementary; preferably, the justice chain and the antisense chain are oppositely complementary to form a dual-chain region, and the dual-chain region has no more than 3, no more than 2, and no more than 1 mismatches. Optionally, the sense strand and the antisense strand are inversely complementary to form a double-stranded region, the length of which is 15-30 base pairs; preferably, the length of which is 15-21 base pairs; more preferably, the length of which is 19-21 base pairs. Optionally, the sense strand or antisense strand has a protruding end; preferably, the 5' end of the sense strand or the 3' end of the antisense strand is a protruding end; preferably, the protruding end is 1 to 3 nucleotides; more preferably, the protruding end is a 2-nucleotide protruding end; Optionally, the antisense strand is substantially anticomplementary, substantially anticomplementary, or completely anticomplementary to a continuous nucleotide sequence m in the ST2L mRNA. Preferably, the length of the antisense strand is the same as that of the nucleotide sequence m, and at least the nucleotide sequence of the antisense strand other than the terminal nucleotide is completely anticomplementary to the nucleotide sequence m. Preferably, all nucleotides of the antisense strand are completely anticomplementary to the nucleotide sequence m. Optionally, the length of the nucleotide sequence m is not greater than the length of the antisense strand; preferably, the length of the nucleotide sequence m is the same as the length of the antisense strand; preferably, the nucleotide sequence m differs from the antisense strand by no more than 8 nucleotides; more preferably, the nucleotide sequence m differs from the antisense strand by 1 to 5 nucleotides. Optionally, the length of the nucleotide sequence m is at least 15 nucleotides, or 15-23 nucleotides, or 15-21 nucleotides, or 19-21 nucleotides.

2. The siRNA according to claim 1, wherein, The nucleotide sequence m is located in the transmembrane domain coding region and the intracellular domain coding region of the ST2L mRNA; preferably, the nucleotide sequence m is located at positions 1183-1855 of the ST2L mRNA sequence; more preferably, the nucleotide sequence m is located at positions 1416-1730 of the ST2L mRNA sequence; more preferably, the nucleotide sequence m is located at positions 1416-1447, or 1510-1730 of the ST2L mRNA sequence; most preferably, the nucleotide sequence m is 21 nucleotides in length and is located at positions 1416-1436, 1419-1439, 1427-1447, 1510-1530, 1707-1727, or 1710-1730 of the ST2L mRNA sequence. Preferably, the siRNA antisense strand contains a nucleotide sequence that differs from the antisense strand of any siRNA in Table 1 by 0, 1, 2, or 3 nucleotides; Preferably, the siRNA antisense strand contains a nucleotide sequence that differs from the antisense strand of any siRNA in Table 3 by 0, 1, 2, or 3 nucleotides. More preferably, the siRNA antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 139, SEQ ID NO: 141 or SEQ ID NO: 143 by 0, 1, 2 or 3 nucleotides. Preferably, the siRNA sense strand and antisense strand respectively contain the nucleotide sequences of the sense strand and antisense strand of any siRNA in Table 1, or nucleotide sequences that differ from the sense strand and antisense strand of any siRNA shown in Table 1 by 0, 1, 2, or 3 nucleotides respectively. Preferably, the siRNA sense strand and antisense strand respectively contain the nucleotide sequences of the sense strand and antisense strand of any siRNA in Table 3, or nucleotide sequences that differ from the sense strand and antisense strand of any siRNA in Table 3 by 0, 1, 2, or 3 nucleotides respectively. More preferably, the sense and antisense strands of the siRNA each comprise: (i) The nucleotide sequences shown in SEQ ID NO: 138 and SEQ ID NO: 139; (ii) The nucleotide sequences shown in SEQ ID NO: 140 and SEQ ID NO: 141; (iii) The nucleotide sequences shown in SEQ ID NO: 142 and SEQ ID NO: 143; or (iv) Nucleotide sequences that differ from the sense and antisense strands shown in (i), (ii) or (iii) by 0, 1, 2 or 3 nucleotides, respectively.

3. The siRNA according to any one of claims 1 to 2, wherein, Some or all of the nucleotides in the sense and antisense strands are modified nucleotides; Preferably, the modified nucleotide is a fluorinated nucleotide or a non-fluorinated nucleotide; more preferably, the fluorinated nucleotide is a 2'-fluorinated nucleotide, and the non-fluorinated nucleotide is independently selected from 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, 2'-deoxynucleotides, isonucleotides, threonucleotides, reverse nucleotides, locked nucleotides, 5'-vinyl phosphate nucleotides, bridged nucleotides, or acyclic nucleotides. Preferably, the modified nucleotide is selected from the group consisting of: 2'-deoxynucleotides, 2'-fluoromodified nucleotides, 2'-O-methylmodified nucleotides, 2'-O-methoxyethylmodified nucleotides, phosphate-thioester-modified nucleotides, and any combination thereof.

4. The siRNA according to claims 1-3, wherein, The sense strand and antisense strand each independently contain fewer than 15 2'-fluorinated nucleotides, such as 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 2'-fluorinated nucleotide; Preferably, one or more nucleotides at positions 1, 3, 5, 7, 9, 10, 11, 13, 15, 17, 19, or 21 of the sense strand are 2'-fluorinated nucleotides, following the direction from the 5' end to the 3' end; and one or more nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, or 22 of the antisense strand are 2'-fluorinated nucleotides, following the direction from the 5' end to the 3' end. More preferably, positions 1, 3, 5, 7, 9-11, 13, 15, 17, 19, and 21 of the sense strand are 2'-fluorinated nucleotides, following the direction from the 5'-end to the 3'-end; and positions 2, 4, 6, 8, 10, 14, 16, 18, 20, and 22 of the antisense strand are 2'-fluorinated nucleotides, following the direction from the 5'-end to the 3'-end; or, Following the 5'-to-3'-end direction, positions 7, 9, 10, and 11 of the sense strand are 2'-fluorinated nucleotides; and, following the 5'-to-3'-end direction, positions 2, 6, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides; or Following the 5'-to-3'-end direction, positions 7, 9, 10, and 11 of the sense strand are 2'-fluorinated nucleotides; and following the 5'-to-3'-end direction, positions 2, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides, and positions 5 and 7 of the antisense strand are 2'-deoxynucleotides; or Following the 5'-to-3'-end direction, positions 9, 11, and 13 of the sense strand are 2'-fluorinated nucleotides; and following the 5'-to-3'-end direction, positions 2, 12, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides, and positions 5 and 7 of the antisense strand are 2'-deoxynucleotides; or Following the 5'-to-3'-end direction, positions 9-11 of the sense strand are 2'-fluorinated nucleotides; and, following the 5'-to-3'-end direction, positions 2, 6, 12, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides, and positions 5 and / or 7 of the antisense strand are 2'-deoxynucleotides; or, In the direction from 5'-end to 3'-end, positions 9 to 11 of the sense strand are 2'-fluorinated nucleotides; and in the direction from 5'-end to 3'-end, positions 2, 6, 10, 12, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides, and positions 5 and / or 7 of the antisense strand are 2'-deoxynucleotides.

5. The siRNA according to any one of claims 1 to 4, wherein, At least a portion of the phosphate groups in the phosphate-sugar backbone of at least one single strand of the sense and antisense strands of the siRNA are phosphate groups with modifying groups; preferably, the phosphate groups with modifying groups are thiophosphate groups; more preferably, the sense and antisense strands each independently contain one, two, or three thiosulfate groups; more preferably, the thiophosphate groups are present at the 5'-terminus and / or 3'-terminus of the sense and / or antisense strands; most preferably, the thiophosphate groups are present at at least one of the following positions: between the first and second nucleotides of the sense and / or antisense strands; between the second and third nucleotides of the sense and / or antisense strands; between the 19th and 20th nucleotides of the antisense strand; between the 20th and 21st nucleotides of the sense and / or antisense strands; between the 21st and 22nd nucleotides of the antisense strand; between the 22nd and 23rd nucleotides of the antisense strand; or any combination thereof. Preferably, the 5'-terminal nucleotide of the siRNA sense strand or antisense strand is a 5'-phosphate nucleotide or a nucleotide modified with a 5'-phosphate analogue.

6. The siRNA according to any one of claims 1 to 5, wherein, The sense and antisense strands of the siRNA contain sense and antisense strand sequences selected from any of the siRNAs shown in Table 2, or nucleotide sequences that differ from the sense and antisense strands of any of the siRNAs shown in Table 2 by 0, 1, 2, or 3 nucleotides, respectively. Preferably, the sense and antisense strands of the siRNA comprise: (i) The nucleotide sequences shown in SEQ ID NO: 91 and SEQ ID NO: 92; (ii) The nucleotide sequences shown in SEQ ID NO: 93 and SEQ ID NO: 94; (iii) The nucleotide sequences shown in SEQ ID NO: 97 and SEQ ID NO: 98; (iv) The nucleotide sequences shown in SEQ ID NO: 99 and SEQ ID NO: 100; (v) The nucleotide sequences shown in SEQ ID NO: 101 and SEQ ID NO: 102; (vi) The nucleotide sequences shown in SEQ ID NO: 107 and SEQ ID NO: 108; or ( The nucleotide sequences shown in (i) to (vi) are the sense and antisense strands that differ by 0, 1, 2, and 3 nucleotides, respectively.

7. An siRNA conjugate comprising the siRNA molecule according to any one of claims 1 to 6, and a conjugation group conjugated to the siRNA, the conjugation group comprising at least one pharmaceutically acceptable targeting group, and further comprising a linker, wherein the siRNA, the linker, and the targeting group are sequentially linked; preferably, there are 1 to 6 targeting groups; more preferably, the targeting group is a delivery ligand with lung delivery small nucleic acid function; more preferably, the targeting group is a group capable of targeting integrin αvβ6, or the targeting group is a lipid nanoparticle, a specific antibody, or a targeting peptide.

8. A composition comprising the siRNA molecule of any one of claims 1 to 6 or the siRNA conjugate of claim 18; preferably, the composition is a pharmaceutical composition, further comprising a pharmaceutically acceptable carrier.

9. A kit comprising an effective amount of the siRNA of any one of claims 1 to 6, the siRNA conjugate of claim 7, or the composition of claim 8.

10. The use of the siRNA of any one of claims 1 to 6, the siRNA conjugate of claim 7, the composition of claim 8, or the kit of claim 9 in the preparation of a medicament for treating and / or preventing diseases or conditions related to the inflammatory pathway caused by the IL-33 / ST2 pathway; preferably, the disease or condition related to the inflammatory pathway caused by the IL-33 / ST2 pathway is a lung-related disease; more preferably, the disease or condition is selected from chronic obstructive pulmonary disease, acute respiratory infection, noncystic fibrotic bronchiectasis, or asthma.

Images