A method for activating plant mRNA translation with tetrahedral framework nucleic acids loaded with antisense oligonucleotides

Abstract

The application relates to the field of DNA nanotechnology, in particular to a method for realizing mRNA translation activation of a plant body by using a tetrahedral framework nucleic acid loaded with antisense oligonucleotide. In the method, a 16nt or 20nt antisense oligonucleotide (ASO) sequence is extended from an A chain of a tetrahedral framework nucleic acid (tFNA) to form A-ASO. Then, four DNA dry powders are dissolved and diluted into a DNA solution by using enzyme-free water, and the A-ASO, B, C and D four chains of the tetrahedral framework nucleic acid are combined into the tetrahedral framework nucleic acid loaded with antisense oligonucleotide through a polymerase chain reaction. A complete tFNA-ASO structure with a controllable size and a translation regulation function is prepared. A delivery system developed based on the tFNA-ASO shows a good application prospect in aspects of regulating plant gene expression, drug delivery, activating plant immunity and enhancing disease and pest resistance.

Description

Technical Field

[0001] This invention relates to the field of DNA nanotechnology, specifically to a method for activating plant mRNA translation using a tetrahedral framework nucleic acid loaded with antisense oligonucleotides. Background Technology

[0002] In the field of materials science, the precise design and construction of functional materials enables the development of novel materials suitable for specific applications such as plasma technology, catalytic reactions, drug delivery, and tissue engineering. The core of achieving this goal lies in the precise customization and control of nanoscale building blocks. DNA molecules, with their unique advantages such as sequence specificity, programmability, and addressability, can endow nanomaterials with controllable bonding properties. Using DNA, diverse material systems with unique physicochemical properties can be constructed from nanoscale to microscale. Currently, these structures mainly achieve close packing through strong interactions between building blocks, forming ordered three-dimensional lattice structures. Secondly, antisense oligonucleotide (ASO) technology plays an important role in regulating plant gene expression. Plant gene expression regulation is a multi-level, highly coordinated biological process, in which protein translation, as a key link in the transmission of genetic information, directly affects the plant's growth, development, and environmental adaptability. The upstream open reading frame (uORF), as a conserved element in the 5' untranslated region (5' UTR), can exert an inhibitory effect on the translation of the downstream main open reading frame (pORF) by affecting ribosome scanning and initiation efficiency. Cis-regulatory elements in the 3' untranslated region (3' UTR) can be specifically recognized by RNA-binding proteins, regulating mRNA stability and translation efficiency. Precise intervention in these translation regulatory elements holds promise for targeted activation of target gene expression levels. However, the application of antisense oligonucleotide (ASO) technology in plant systems is still in its early stages, and its delivery efficiency within plants remains a key bottleneck restricting its application. Therefore, how to utilize the construction of macroscopically scaled multi-level ordered structures to protect ASOs from degradation and achieve non-transgenic translation regulation remains a crucial scientific problem that urgently needs to be addressed in current research. Summary of the Invention

[0003] The purpose of this invention is to provide a method for activating plant mRNA translation using a tetrahedral framework nucleic acid loaded with antisense oligonucleotides, in order to solve the problems mentioned in the background art.

[0004] The present invention provides the following technical solution: a tetrahedral framework nucleic acid loaded with antisense oligonucleotides, comprising a tetrahedral framework nucleic acid and antisense oligonucleotides, wherein the tetrahedral framework nucleic acid contains four single strands of DNA, named DNA A, DNA B, DNA C, and DNA D, respectively, and their sequences are shown in SEQ ID NO. 5-8; the antisense oligonucleotide sequence is shown in any one of SEQ ID NO. 9-12; the 5' end of the antisense oligonucleotide is connected to the 3' end of the DNA A strand in the tetrahedral framework nucleic acid through five adenines.

[0005] Furthermore, the method for preparing the tetrahedral framework nucleic acid loaded with antisense oligonucleotides includes the following steps:

[0006] S1: The 5' end of the antisense oligonucleotide is linked to the 3' end of the DNA A strand through five adenines to form DNA A-ASO; the antisense oligonucleotide sequence is shown in any one of SEQ ID NO.1~4;

[0007] S2: Dissolve and dilute DNA A-ASO, DNA B, DNA C, and DNA D with enzyme-free water to prepare the corresponding DNA solutions;

[0008] S3: Mix the DNA solutions corresponding to DNA A-ASO, DNA B, DNA C, and DNA D in 50mM TM buffer solution, with a final concentration of 5μM for each DNA strand; obtain the tetrahedral framework nucleic acid loaded with antisense oligonucleotides by polymerase chain reaction.

[0009] Furthermore, in S3, the polymerase chain reaction method is as follows: heating at 95°C for five minutes in a polymerase chain reaction thermal cycler, and then cooling to 4°C.

[0010] Furthermore, in S3, the TM buffer solution comprises 10 mM tris(hydroxymethyl)aminomethane hydrochloride and 50 mM magnesium chloride hexahydrate.

[0011] Furthermore, the tetrahedral framework nucleic acid loaded with antisense oligonucleotides is applied to:

[0012] (1) Improve the plant's resistance to disease, stress, or pressure;

[0013] (2) To prepare drugs that enhance the plant's resistance to disease, stress, or pressure;

[0014] Furthermore, the tetrahedral framework nucleic acid loaded with antisense oligonucleotides or the drug prepared therefrom is sprayed onto the surface of plant leaves or injected into plant leaves, thereby enabling the tetrahedral framework nucleic acid loaded with antisense oligonucleotides to achieve mRNA translation activation, thus improving the plant's disease resistance, stress resistance or anti-stress ability.

[0015] Furthermore, the plant species mentioned include, but are not limited to, tobacco and Arabidopsis thaliana.

[0016] Compared with existing technologies, the beneficial effects achieved by this invention are as follows: This invention provides a method for loading antisense oligonucleotides onto a tetrahedral framework nucleic acid. It achieves effective loading of antisense oligonucleotides onto DNA tetrahedra in a salt solution, thereby protecting the antisense oligonucleotides and creating a complete, size-controllable tFNA-ASO structure with translational regulatory functions. tFNA-ASO can effectively enter plant cells, bind to uORF, and regulate the translational activation of downstream pORF. The delivery system developed based on this tFNA-ASO shows promising application prospects in regulating plant gene expression, drug delivery, activating plant immunity, and enhancing resistance to pests and diseases. Attached Figure Description

[0017] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings:

[0018] Figure 1 This is a schematic diagram of a method for activating mRNA translation of a tetrahedral framework nucleic acid loaded with antisense oligonucleotides according to the present invention.

[0019] Figure 2 The results of characterization of tetrahedral framework nucleic acids loaded with antisense oligonucleotides by polyacrylamide gel electrophoresis in Example 1 are shown.

[0020] Figure 3 The results of characterization of the assembled tetrahedral framework nucleic acid loaded with antisense oligonucleotides using atomic force microscopy in Example 1 are shown.

[0021] Figure 4 The results of characterization of tetrahedral framework nucleic acids loaded with antisense oligonucleotides using dynamic light scattering in Example 2 are shown.

[0022] Figure 5 The disease symptoms of Arabidopsis leaves (infected by DC3000) that were injected with tFNA and tFNA-ASO (TBF1-3) respectively in Application Example 1;

[0023] Figure 6 For example 2, the expression 5' UTR NIP5;1 Characterization results of *Nicotiana benthamiana* leaves injected with tFNA, tFNA-ASO (NIP5;1-1), and tFNA-ASO (NIP5;1-3) respectively; where 6(a) is the fluorescence image under confocal microscopy, and 6(b) is the quantitative analysis result of the fluorescence intensity of eGFP. Detailed Implementation

[0024] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] All reagents used in this invention are commercially available; all DNA sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequences used in this specific embodiment are shown below:

[0026] DNA A-ASO(TBF1-1) ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTAAAAAACATACTTCGCCGGAGC 1 DNA A-ASO(TBF1-3) ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTAAAAAACATACTTCGCCGGAGCTAAT 2 DNA A-ASO(NIP5;1-1) ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTAAAAAATTACATGCTTTGAAAG 3 DNA A-ASO(NIP5;1-3) ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTAAAAAATTACATGCTTTGAAAGATTT 4 DNA A ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTA 5 DNA B ACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCT 6 DNA C TCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACC 7 DNA D TCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCAT 8 ASO(TBF1-1) CATACTTCGCCGGAGC 9 ASO(TBF1-3) CATACTTCGCCGGAGCTAAT 10 ASO(NIP5;1-1) TTACATGCTTTGAAAG 11 ASO(NIP5;1-3) TTACATGCTTTGAAAGATTT 12

[0027] The following examples all employ the following steps to prepare tetrahedral framework nucleic acids loaded with antisense oligonucleotides:

[0028] S1: The 5' end of the antisense oligonucleotide is linked to the 3' end of the DNA A strand through five adenines to form DNA A-ASO;

[0029] S2: Dissolve and dilute DNA A-ASO, DNA B, DNA C, and DNA D with enzyme-free water to prepare the corresponding DNA solutions;

[0030] S3: Mix the DNA solutions corresponding to DNA A-ASO, DNA B, DNA C, and DNA D in 50 mM TM buffer solution, with a final concentration of 5 μM for each DNA strand; obtain the tetrahedral framework nucleic acid loaded with antisense oligonucleotides through polymerase chain reaction; the polymerase chain reaction method is as follows: heat at 95°C for five minutes in a polymerase chain reaction thermal cycler, and then cool to 4°C; the TM buffer solution consists of 10 mM tris(hydroxymethyl)aminomethane hydrochloride and 50 mM magnesium chloride hexahydrate.

[0031] Example 1: The DNA A-ASO described in this example is shown in SEQ ID No. 1~2. The corresponding tetrahedral framework nucleic acids loaded with antisense oligonucleotides are obtained and are denoted as tFNA-ASO (TBF1-1) and tFNA-ASO (TBF1-3), respectively.

[0032] Example 2: The DNA A-ASO described in this example is shown in SEQ ID No. 3~4. The corresponding tetrahedral framework nucleic acids loaded with antisense oligonucleotides are obtained and are denoted as tFNA-ASO (NIP5;1-1) and tFNA-ASO (NIP5;1-3), respectively.

[0033] The aforementioned tetrahedral framework nucleic acid (tFNA) consists of four single-stranded DNA molecules: DNA A, DNA B, DNA C, and DNA D, with sequences shown in SEQ ID NO. 5-8, respectively.

[0034] The tFNA-ASO(TBF1-1) and tFNA-ASO(TBF1-3) prepared in Example 1 were tested.

[0035] (1) The tetrahedral framework nucleic acid loaded with antisense oligonucleotides in Example 1 was characterized by polyacrylamide gel electrophoresis.

[0036] A 10% polyacrylamide gel was prepared and electrophoresed for 100 minutes at 80 V using a Bio-Rad electrophoresis apparatus in 1×TAEM buffer (40 mM Tris-acetate, 1 mM EDTA, 12.5 mM Magnesi μm acetate, pH 8.0–8.6). After electrophoresis, the gel was stained with 1×Gel Red nucleic acid dye for 10–15 minutes. The gel was imaged using a Tanon 2500B gel imaging system to characterize the formation of DNA nanostructures. The results are as follows: Figure 2 As shown, the bands of tFNA-ASO (TBF1-1) and tFNA-ASO (TBF1-3) in lanes 3 and 4 are positioned higher than tFNA in lane 2, indicating that they migrate slowly and have a high molecular weight, suggesting the formation of a tetrahedral framework nucleic acid structure loaded with antisense oligonucleotides.

[0037] (2) The tetrahedral framework nucleic acid loaded with antisense oligonucleotides prepared in Example 1 was characterized by atomic force microscopy.

[0038] 10 μL of 25 nM prepared tFNA-ASO (TBF1-1) and tFNA-ASO (TBF1-3) were dropped onto the mica surface, followed by 20 μL of 1×TM buffer. Images were obtained using Bruker multimode 8. Results are shown below. Figure 3 As shown in the figure, the size is approximately 20 nm.

[0039] (3) Dynamic light scattering was used to characterize the tetrahedral framework nucleic acid loaded with antisense oligonucleotides prepared in Example 2.

[0040] 300 μL of 1 μm prepared tFNA-ASO (NIP5;1-1), tFNA-ASO (NIP5;1-3), and tFNA were placed in separate plastic test tubes, and the hydrodynamic diameters were measured using a Malvern Zetasizer Nano-ZS instrument equipped with a 633 nm He-Ne laser. The results are as follows: Figure 4As shown in the figure, the particle size of the tetrahedral framework nucleic acid is approximately 13 nm, while the particle size of the tetrahedral framework nucleic acid structure loaded with antisense oligonucleotides is approximately 15-17 nm.

[0041] The tetrahedral framework nucleic acids loaded with antisense oligonucleotides prepared in Examples 1 and 2 were applied respectively.

[0042] Application Example 1: The tetrahedral framework nucleic acids tFNA-ASO (TBF1-1) and tFNA-ASO (TBF1-3) loaded with antisense oligonucleotides from Example 1 were applied to plants to achieve disease resistance.

[0043] In this application example, the steps for preparing and inoculating DC3000 bacterial culture are as follows:

[0044] 1) Strain activation: Take the DC3000 strain (containing rifampicin resistance) stored at -80℃, streak it on an LM medium plate containing rifampicin (50μg / mL), and incubate at 28℃ for 48 hours;

[0045] 2) Preparation of bacterial culture: Streaking the bacterial culture stored at -80℃ onto LM solid medium containing antibiotics and incubating at 30℃ for 2 days. Single colonies are picked and transferred to 4-6 mL of LM liquid medium containing the appropriate antibiotics, and incubated at 30℃ and 200 rpm until the bacterial concentration reaches the OD value. 600 ≈0.6~1.0;

[0046] 3) Bacterial cell collection and resuspension: Take 1.5 mL of bacterial suspension, centrifuge at 2,500 × g for 5 min, collect the bacterial cells, discard the supernatant, resuspend and wash twice with sterile water, and finally adjust the OD with sterile water. 600 To 0.001~0.002 (≈5×10) 5 ~1×10 6 (CFU / mL), used for disease detection;

[0047] 4) Inoculation method: Use a needleless syringe to inject DC3000 bacterial solution into the same Arabidopsis leaf area (or adjacent area) that has been treated with ASO. Inject about 50~100μL at each point, and ensure that the injection area overlaps with the tFNA-ASO treatment area.

[0048] 100 μL of 1 μm tFNA-ASO (TBF1-3) and tFNA were injected into Arabidopsis thaliana plants that had been previously infected with the pathogenic strain DC3000 of Pseudomonas syringae pv. tomato DC3000 (the DC3000 cells that had been cultured overnight were resuspended in water and gently injected from the back of the leaf using a needleless syringe) to test whether they could improve the plant’s resistance to bacterial infection.

[0049] The results are as follows Figure 5 As shown, from Figure 5 It was observed that tFNA-ASO(TBF1-3) targeting Arabidopsis thaliana TBF1 uORF significantly enhanced TBF1 protein accumulation, activated downstream defense responses, and significantly alleviated leaf disease symptoms. These results indicate that tFNA-ASO(TBF1-3) can effectively enter plant cells, bind to uORF, and regulate the translational activation of downstream pORF.

[0050] Application Example 2: The two tetrahedral framework nucleic acids tFNA-ASO(NIP5;1-1) and tFNA-ASO(NIP5;1-3) loaded with antisense oligonucleotides prepared in Example 2 were applied to tobacco leaves.

[0051] 100 μL of Cy3-labeled tFNA-ASO (NIP5;1-1) and tFNA-ASO (NIP5;1-3), and Cy3-labeled tFNA were prepared as 1 μm solutions and injected into leaves of *Nicotiana benthamiana*, respectively. The results are as follows: Figure 6 As shown, from Figure 6 It was observed that tFNA had no translational activation effect, while tFNA-ASO(NIP5;1-1) and tFNA-ASO(NIP5;1-3) showed better translational activation effects. This demonstrates that the ASO sequence can specifically target the mRNA 5' uORF sequence through base complementarity pairing, thereby relieving its translational inhibition on downstream pORFs. This can activate the transient expression of disease resistance and stress resistance genes, thus enabling plants to resist disease and stress.

[0052] The preferred embodiments of this application have been described above with reference to the accompanying drawings, but this does not limit the scope of the claims of this application. Any modifications (including different species types, different gene targets), equivalent substitutions, and improvements (including different types of DNA nucleic acid structures, different lengths of ASOs and their design and modification) made by those skilled in the art without departing from the scope and substance of the embodiments of this application shall be within the scope of the claims of this application.

Claims

1. A tetrahedral framework nucleic acid loaded with antisense oligonucleotides, comprising a tetrahedral framework nucleic acid and antisense oligonucleotides, characterized in that: The tetrahedral framework nucleic acid comprises four single-stranded DNA molecules, named DNA A, DNA B, DNA C, and DNA D, respectively, and their sequences are shown in SEQ ID NO. 5-8, respectively; the antisense oligonucleotide sequence is shown in any one of SEQ ID NO. 9-12; the 5' end of the antisense oligonucleotide is connected to the 3' end of the DNA A strand in the tetrahedral framework nucleic acid through five adenines.

2. The method for preparing tetrahedral framework nucleic acids loaded with antisense oligonucleotides according to claim 1, characterized in that: Includes the following steps: S1: The 5' end of the antisense oligonucleotide is linked to the 3' end of the DNA A strand through five adenines to form DNA A-ASO; the antisense oligonucleotide sequence is shown in any one of SEQ ID NO.1~4; S2: Dissolve and dilute DNA A-ASO, DNA B, DNA C, and DNA D with enzyme-free water to prepare the corresponding DNA solutions; S3: Mix the DNA solutions corresponding to DNA A-ASO, DNA B, DNA C, and DNA D in 50mM TM buffer solution, with a final concentration of 5μM for each DNA strand; obtain the tetrahedral framework nucleic acid loaded with antisense oligonucleotides by polymerase chain reaction.

3. The preparation method according to claim 2, characterized in that: In S3, the polymerase chain reaction method is as follows: heat at 95°C for five minutes in a polymerase chain reaction thermal cycler, and then cool to 4°C.

4. The use of a tetrahedral framework nucleic acid loaded with antisense oligonucleotides as described in claim 1 in any of the following: (1) Application in improving the plant's resistance to disease, stress, or pressure; (2) Application in the preparation of drugs that improve the plant’s resistance to disease, stress or pressure.

5. A method for activating plant mRNA translation based on a tetrahedral framework nucleic acid loaded with antisense oligonucleotides as described in claim 1, characterized in that: The tetrahedral framework nucleic acid loaded with antisense oligonucleotides is sprayed onto the surface of plant leaves or injected into plant leaves to enhance the plant's resistance to disease, stress, or pressure.

6. The method according to claim 5, characterized in that: The plant in question is either tobacco or Arabidopsis thaliana.

Images