A method for improving seed size in brassica based on bna c09.ntm1 gene editing

Abstract

The application discloses a method for improving seed size of Brassica napus based on BnaC09.NTM1 A method for improving seed size of Brassica napus by gene editing, aiming at the problems of long traditional breeding cycle and linkage drag, the application provides a gene editing method based on CRISPR / Cas9, which is used for knocking out a specific gene of Brassica napus by CRISPR / Cas9 system. BnaC09.NTMN1 The gene is designed to be a specific sgRNA target point, the CRISPR / Cas9 system is used for carrying out site-specific knockout on the gene, and a homozygous mutant plant with a function loss is obtained. BnaC09.ntm1 Through phenotype identification, the hundred-seed weight of the mutant plant is obviously increased compared with that of the wild type. The method is simple in operation, high in editing efficiency, and can obtain mutant material with stable heredity within 2-3 generations, is not limited by genetic background, provides a new efficient and accurate way and excellent germplasm resource for improving seed size of Brassica napus, and has important application value in Brassica napus molecular breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and molecular breeding technology, specifically relating to a method based on BnaC09.NTM1 A method for improving rapeseed seed size through gene editing. Background Technology

[0002] While traditional hybridization and backcrossing breeding have achieved great success in the past few decades, they have inherent limitations: First, the breeding cycle is long, usually requiring multiple generations (6-8 generations or more) of self-crossing or backcrossing to obtain breeding materials with stable traits and homozygous genetic background, which is time-consuming and inefficient. Second, there is linkage burden, that is, the target trait gene is closely linked to nearby unfavorable genes (such as genes related to decreased stress resistance and deterioration in quality), which is difficult to separate through recombination during backcrossing and conversion breeding. As a result, while introducing excellent traits, genetic burden is also introduced, affecting the comprehensive agronomic traits of the variety.

[0003] The CRISPR / Cas9 system is a technique that uses sequence-specific nucleases to perform site-specific genome editing, characterized by low cost, simple operation, and high mutation efficiency. However, in rapeseed, an allotetraploid crop, due to its complex genome and redundant homologous gene functions, designing efficient and specific sgRNA targets for specific negative regulators of seed size and successfully creating stably inherited edited materials still faces many technical challenges. Although there are reports of using gene editing to improve crop traits, there are still many challenges regarding the use of gene editing to knock out specific types of negative regulators (such as...). BnaC09.NTM1 The technical solution for achieving directional enlargement of rapeseed seeds has not yet been publicly disclosed.

[0004] Rapeseed seeds are an important source of oil and play a vital role in food security. Previous studies have identified certain genes in rapeseed (e.g., ...). BnDA1 Genes that negatively regulate seed size can promote seed enlargement by knocking them out. However, it is difficult to obtain naturally occurring genetic variations with functional changes through traditional hybridization breeding techniques, and the breeding cycle is long and inefficient. Therefore, there is an urgent need in this field to develop a gene editing method that can overcome the complex genomic background of rapeseed, efficiently and accurately knock out specific negatively regulating genes, thereby directly improving rapeseed seed yield traits. Summary of the Invention

[0005] One of the objectives of this invention is to provide a method based on... BnaC09.NTM1 To achieve the above objective, the present invention employs a technical solution for gene editing to improve the sgRNA target sequence of rapeseed size: the sgRNA target sequence includes the nucleotide sequence shown in SEQ ID NO.1 and SEQ ID NO.2.

[0006] The second objective of this invention is to provide an sgRNA expression cassette. To achieve the above objective, the technical solution adopted by this invention is as follows: the sgRNA expression cassette contains the above-mentioned sgRNA target sequence and is expressed by the U6-26 promoter. The nucleotide sequence of the sgRNA expression cassette is shown in SEQ ID NO.3.

[0007] The third objective of this invention is to provide a CRISPR / Cas9 gene editing vector. To achieve the above objective, the technical solution adopted by this invention is as follows: the CRISPR / Cas9 gene editing vector contains the above-mentioned sgRNA expression cassette.

[0008] The fourth objective of this invention is to provide a method for constructing the CRISPR / Cas9 gene editing vector as described in claim 3. To achieve the above objective, the technical solution adopted by this invention is as follows: the above-mentioned sgRNA expression cassette is inserted into the pv58-K vector through the KpnI restriction site to obtain a CRISPR / Cas9 gene editing vector in which the expression of two sgRNAs is driven by the U6-26 promoter.

[0009] To further realize the present invention, based on BnaC09.NTM1 A method for improving rapeseed seed size through gene editing includes the following steps: S1, based on BnaC09.NTM1 The genome sequence was designed and the target sequence containing sgRNA was synthesized, and its nucleotide sequence is shown in SEQ ID NO.4; S2. The CRISPR / Cas9 expression vector pv58-K was linearized by digesting it with KpnI restriction endonuclease and then purified by gel extraction. S3. The nucleotide fragment synthesized in S1 is ligated into the vector linearized in S2 to obtain the recombinant expression vector; S4. Transform the recombinant expression vector obtained in S3 into E. coli, screen for positive clones, extract plasmids and sequence them for verification. S5. Transform the plasmid verified in S4 into Agrobacterium tumefaciens (S5). Agrobacterium tumefaciens In the process, engineered bacteria were obtained, and rapeseed hypocotyl explants were transformed using engineered bacteria. After callus induction, differentiation and hygromycin screening, transgenic regenerated plants were obtained. S6. Extract genomic DNA from the transgenic regenerated plants obtained in S5, amplify the genomic fragment containing the target sites of SEQ ID NO.1 and SEQ ID NO.2, and sequence them to screen and identify the target sites. BnaC09.NTM1 Positive plants with target mutations in the gene were used to obtain rapeseed mutant materials with significantly increased seed size.

[0010] To further realize this invention, the sgRNA target sequence described in S1 is designed in... BnaC09.NTM1The first or second exon region of the genome sequence.

[0011] To further realize the present invention, the mutation described in S6 is the deletion, insertion, and / or substitution of one or more bases, resulting in BnaC09.NTM1 Loss of function.

[0012] To further realize the present invention, the rapeseed mentioned in S5 is Brassica napus.

[0013] The advantages of this invention compared to the prior art are as follows: (1) Successfully identified new targets and achieved significant improvement in seed size. This invention is the first to utilize the C genome of Brassica napus. BnaC09.NTM1 The gene (ZS11 Gene ID: BnaC09G0003000ZS) was identified as a negative regulator of seed size, and precise editing of this specific single copy using CRISPR / Cas9 technology resulted in a significant increase of approximately 42% in 100-seed weight. Compared with previously disclosed rapeseed yield-increasing targets such as BnaARF2, BnaTT8, BnaRSL, NGAL3, and BnRLK7, BnaC09.NTM1 As a new member of the NAC transcription factor family, its function in regulating rapeseed seed size has not been publicly reported, making its target novel.

[0014] (2) The editing strategy is concise and clear, and the technical approach is unique. Unlike existing technologies that simultaneously edit multiple homologous copies by targeting conserved sequences, this invention employs a specific editing scheme targeting a single copy of the C genome. This approach is simpler and more explicit, effectively avoiding the uncertainties arising from the functional differentiation of homologous copies in the A / C genome. Compared to known simultaneous multi-copy editing strategies, this invention's single-copy editing scheme also achieves significant yield increases, exhibiting clear advantages in terms of editing efficiency certainty and ease of implementation.

[0015] (3) Overcoming the limitations of traditional breeding, the operation cycle is greatly shortened. This invention utilizes CRISPR / Cas9-mediated gene editing technology to directly knock out target genes within the genetic background of recipient varieties. This overcomes the problems of long cycles (6-8 generations or more) and linkage redundancy inherent in traditional hybridization breeding, allowing for the acquisition of stably inherited mutant materials within 2-3 generations. This provides a highly efficient and precise new approach for molecular breeding of rapeseed. Furthermore, the sgRNA target sequence provided by this invention exhibits high specificity, high editing efficiency, and does not significantly alter other major agronomic traits of the recipient parent.

[0016] (4) Prospects for cross-species application Previous studies have shown extensive collinearity at the genomic level among Brassica crops and between Brassica and Arabidopsis, with gene regions controlling the same trait often exhibiting high conservation across different species (Li et al., 2012). For example, QTL mapping of agronomic traits such as flowering time and plant morphology has revealed that gene regions controlling the same traits in Brassica crops such as rapeseed, Chinese cabbage, and kale show collinear arrangement at the genome level (Li et al., 2012; Luo et al., 2012). This invention… BnaC09.NTM1 The gene originates from the C genome of Brassica napus. Homologous gene alignment analysis revealed highly homologous orthologous genes in the genomes of other Brassica species, such as Brassica oleracea and Brassica rapa. Given the extensive collinearity and gene conservation among Brassica species, those skilled in the art can reasonably expect its functional conservation in regulating seed size development.

[0017] Given the widespread gene collinearity and sequence conservation among Brassica crops, those skilled in the art can apply the information disclosed in this invention. BnaC09.NTM1 Genetic information can be obtained by using conventional sequence alignment methods (such as BLAST) to identify corresponding homologous genes and their homologous target sequences in other Brassica crops such as cabbage, Chinese cabbage, and mustard greens. Figure 4 (A and B). The function of this gene family has been verified in Arabidopsis thaliana, a model plant of the Brassicaceae family. NTM1 (AT4G01540) encodes a membrane-bound NAC transcription factor, and its mutant seed weight is significantly increased by approximately 36% compared to the wild type. Figure 4 (C, D, and E). The above results provide crucial verification of the functional conservation of this invention within the Brassicaceae family. Based on this, it is reasonable to expect that, using the same CRISPR / Cas9 gene editing vector construction strategy as this invention, site-specific editing of corresponding homologous genes in other Brassica crops such as cabbage and Chinese cabbage can also achieve the same seed size improvement effect. Attached Figure Description

[0018] Figure 1 This is a schematic diagram of the target gene structure and sgRNA location in this invention, where A represents Brassica napus. BnaC09.NTM1 Gene structure diagram; B is BnaC09.NTM1 Gene sequence; C is a schematic diagram of the complete expression cassette of sgRNA; D is the complete expression cassette sequence of sgRNA; Figure 2 This is a map of the gene editing vector in this invention (including Cas9 and sgRNA expression frames); Figure 3The images show the sequencing verification diagram of the mutant in this invention and a comparison of seed size between the mutant and the wild type, where A represents Brassica napus (ZS11). BnaC09.NTM1 Mutant material generated by a 5 bp deletion near the target site in the second exon of a gene. BnaC09.ntm1 Sequencing results; B represents wild-type (ZS11) and mutant materials. BnaC09.ntm1 Seed size display; C represents wild-type (ZS11) and mutant materials. BnaC09.ntm1 Results of comparison of the weight of 100 seeds; Figure 4 In this invention BnaC09.NTM1 Homologous sequence alignment results of the gene in other Brassica species such as Brassica napus and Chinese cabbage, and the phenotype after knocking out the homologous gene in Arabidopsis thaliana. A shows the phylogenetic tree of the amino acid sequences of BnaC09.NTM1 and its ortholog in Brassica napus; B shows the comparison of the amino acid sequences of BnaC09.NTM1 and its ortholog; C shows the ortholog in Arabidopsis thaliana, a model plant of the Brassica genus. NTM1 A schematic diagram of the target site locations and sequencing results for two knockout lines of (AT4G01540); D represents Arabidopsis thaliana. NTM1 Seed representations of two knockout lines; E represents Arabidopsis thaliana. NTM1 The results of comparing seed size of the two knockout lines. Detailed Implementation

[0019] The present invention will be further described below with reference to the accompanying drawings and specific embodiments.

[0020] Example 1 rape BnaC09.NTM1 Construction of gene editing vectors 1. Based on the rapeseed gene sequence, select BnaC09.NTM1 On the first exon of the gene 5′-ACAAGAATCTTGATAAACCA-3′(SEQ ID NO.1) The target sites are 5′-TACTACGAACCTGAGAAGAA-3′ (SEQ ID NO.2), such as... Figure 1 As shown in A and 1B.

[0021] 2. Using a small amount of chemically synthesized SEQ ID NO.4 fragment as a template, PCR amplification was performed using primers gRTF (SEQ ID NO.5) and gRTR (SEQ ID NO.6) to obtain a sufficient amount of sgRNA expression cassette fragment containing dual targets. The PCR reaction system was as follows: 1 μL of chemically synthesized SEQ ID NO.4 fragment (concentration 10 ng / μL), 0.5 μL each of primers gRTF (SEQ ID NO.5) and gRTR (SEQ ID NO.6) (concentration 10 μM), 10 μL of 2×PCR Master Mix, and ddH2O to a final volume of 20 μL. The reaction conditions were: 95℃ pre-denaturation for 3 min; 28-30 cycles (94℃ denaturation for 10 s, 58℃ annealing for 15 s, 68℃ extension for 20 s); 72℃ final extension for 5 min. After separation by agarose gel electrophoresis, the target band was excised and purified to obtain the SEQ ID NO.4 expression cassette fragment.

[0022] The amplification primers are as follows: gRTF: 5′-GATTCCCGGCTGGGTGCAG-3′; SEQ ID NO.5 gRTR: 5′-CTATTTCTAGCTCTAAAAC-3′; SEQ ID NO.6 SEQ ID NO.4 is as follows: GATTCCCGGCTGGTGCAG ACAAGAATCTTGATAAACCA GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA TACTACGAACCTGAGAAGAA gttttagagctagaaatag 3. Enzyme digestion and ligation (1) KpnI single enzyme digestion: Take 1 μg of pv58-K vector, add 1 μL of FastDigest KpnI, 2 μL of 10×FastDigestBuffer, and add ddH2O to 20 μL. React at 37℃ for 10 min, and then clean the linearized vector by gel recovery.

[0023] (2) Homologous recombination ligation: The linearized vector (50-200 ng) was mixed with the SEQ ID NO.4 fragment obtained in step 2 (approximately 100 ng, which has 15-25 bp overlapping sequences homologous to the KpnI site on both sides of its ends), 10 μL of 2×Hieff Clone® Enzyme Premix was added, and ddH2O was added to a final volume of 20 μL. The mixture was incubated at 50°C for 30 min. The ligation product is the CRISPR / Cas9 recombinant vector containing a dual-target sgRNA expression cassette.

[0024] After inserting SEQ ID NO.4 into the CRISPR / Cas9 expression vector pv58-K via the KpnI restriction site, a CRISPR / Cas9 dual-target editing vector with expression of two sgRNAs (targets SEQ ID NO.1 and SEQ ID NO.2, respectively) driven by the U6-26 promoter can be obtained.

[0025] 4. Take 1-1.5 μl of the ligation product prepared in step 3 and transform it into E. coli DH5α competent cells by heat shock. After heat shock, add 1 ml of LB medium and incubate at 37°C for 1-1.5 h. The plating medium is LB + 50 μg / ml Kan.

[0026] 5. Extract plasmids and confirm the sequence of the complete expression cassette of U6-26-sgRNA (SEQ ID NO.3) using sequencing primer F: 5′-CTTCAAAAGTCCCACATCGC-3′ (SEQ ID NO.7).

[0027] SEQ ID NO.3 is as follows: tcgacttgccttccgcacaatacatcatttcttcttagctttttttcttcttcttcgttcatacagtttttttttgtttatcagcttacattttcttgaaccgtagctttcgttttcttcttttta actttccattcggagtttttgtatcttgtttcatagtttgtcccaggattagaatgattaggcatcgaaccttcaagaatttgattgaataaaacatcttcattcttaagatatgaagataatctt caaaaggcccctgggaatctgaaagaagagaagcaggcccatttatatgggaaagaacaatagtatttcttatataggcccatttaagttgaaaacaatcttcaaaagtcccacatcgcttagata agaaaacgaagctgagtttatatacagctagagtcgaagtagtgattgAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAG ACAAGAATCTTGATAAACCA GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA TACTACGAACCTGAGAAGAA gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc 6. Transform the plasmid, confirmed by sequencing, into Agrobacterium tumefaciens by heat shock. A. tumefaciens In GV3101 competent cells, plasmids were extracted from Agrobacterium tumefaciens clones. Approximately 5-10 ng of the plasmid was used as a template, and the inserted DNA fragment (SEQ ID NO.3) was amplified using gRTF (SEQ ID NO.5) and gRTR (SEQ ID NO.6) for PCR confirmation. The constructed vector is shown below. Figure 1 C, 1D and Figure 2 As shown.

[0028] Example 2 rape BnaC09.NTM1 Obtaining and identifying gene knockout lines 1. The *Agrobacterium tumefaciens* strain constructed in Example 1 was confirmed to be positive. A. tumefaciens Based on GV3101, and using rapeseed (…) preserved by the research group Brassica napus Using the hypocotyl of "Zhongshuang 11" as the recipient material, an Agrobacterium-mediated genetic transformation experiment was conducted on rapeseed. Hygromycin was used as the selection marker. Through Agrobacterium co-culture, callus screening and plant regeneration, hygromycin-resistant regenerated plants were obtained.

[0029] 2. PCR identification of positive lines: After obtaining regenerated plants, genomic DNA was extracted from each regenerated plant, primers were designed to amplify the hygromycin resistance gene, and positive plants whose expression cassette had been transformed were selected.

[0030] 3. Select positive plants and design primers upstream and downstream of the editing target site, respectively. The primer sequences are as follows: BnaC09.NTM1 F: 5′-ACGCGAGAGCGAGGTGTGCA-3′; SEQ ID NO.8 BnaC09.NTM1 R: 5′-GAGACAGTTGAGTCAAACC-3′; SEQ ID NO.9 The target region of a 746 bp fragment was amplified by PCR in positive plants. The reaction conditions were as follows: 95℃ for 10 s, 55℃ for 30 s, 72℃ for 30 s, for 32-35 cycles.

[0031] Genomic DNA was extracted from regenerated plants obtained through hygromycin screening and analyzed using specific primers. BnaC09.NTM1 F (SEQ ID NO. 8) and BnaC09.NTM1 R (SEQ ID NO. 9) amplified the genomic fragment containing the target site, and the PCR product was sent to a sequencing company for sequencing identification. Sequencing results compared with the wild-type control sequence showed that the target plant underwent editing in the target region, with the mutation type being a 5-base deletion, leading to... BnaC09.NTM1 A frameshift mutation occurred in the coding region of the gene, which is expected to cause loss of protein function. The identification results are as follows: Figure 3 As shown in A, this plant is a homozygous mutant.

[0032] 4. Positive lines confirmed by high-throughput sequencing to have undergone editing were planted in an experimental greenhouse along with the wild-type (ZS11) until harvest. Under greenhouse conditions (22℃), 20 wild-type and 20 mutant lines were randomly selected, and the weight of 100 seeds per 100 seeds was measured. The results showed that the average weight of 100 seeds per 100 seeds in the mutant was 0.505 g, which was 42.2% higher than that of the wild-type (0.355 g). P <0.001, t test)( Figure 3 (B and 3C). This can significantly alter the agronomical traits of rapeseed seed size.

[0033] This demonstrates that site-directed mutagenesis using the gene-editing vector constructed in Example 1... BnaC09.NTM1 Genes can significantly increase the size of rapeseed seeds, making them an ideal target site for gene editing to increase rapeseed seed size.

Claims

1. A method based on BnaC09.NTM1 Gene editing to improve rapeseed-sized sgRNA target sequences, characterized by: The sgRNA target sequence includes the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. An sgRNA expression cassette, characterized in that: The sgRNA expression cassette contains the sgRNA target sequence of claim 1 and is expressed by the U6-26 promoter. The nucleotide sequence of the sgRNA expression cassette is shown in SEQ ID NO.

3.

3. A CRISPR / Cas9 gene editing vector, characterized in that: It includes the sgRNA expression cassette as described in claim 2.

4. A method for constructing the CRISPR / Cas9 gene editing vector of claim 3, characterized in that: The sgRNA expression cassette was inserted into the pv58-K vector via the KpnI restriction site to obtain a CRISPR / Cas9 gene editing vector with two sgRNAs expressed by the U6-26 promoter.

5. A method based on BnaC09.NTM1 A method for improving rapeseed seed size through gene editing, characterized in that, Includes the following steps: S1, based on BnaC09.NTM1 The genome sequence was designed and synthesized to contain the sgRNA target sequence as described in claim 1, the nucleotide sequence of which is shown in SEQ ID NO.4; S2. The CRISPR / Cas9 expression vector pv58-K was linearized by digesting it with KpnI restriction endonuclease and then purified by gel extraction. S3. The nucleotide fragment synthesized in S1 is ligated into the vector linearized in S2 to obtain the recombinant expression vector; S4. Transform the recombinant expression vector obtained in S3 into E. coli, screen for positive clones, extract plasmids and sequence them for verification. S5. Transform the plasmid verified in S4 into Agrobacterium tumefaciens. Agrobacterium tumefaciens In the process, engineered bacteria were obtained, and rapeseed hypocotyl explants were transformed using engineered bacteria. After callus induction, differentiation and hygromycin screening, transgenic regenerated plants were obtained. S6. Extract genomic DNA from the transgenic regenerated plants obtained in S5, amplify the genomic fragment containing the target sites SEQ ID NO.1 and SEQ ID NO.2, and sequence them to screen and identify the target sites. BnaC09.NTM1 Positive plants with target mutations in the gene were used to obtain rapeseed mutant materials with significantly increased seed size.

6. Based on claim 5 BnaC09.NTM1 A method for improving rapeseed seed size through gene editing, characterized by: The sgRNA target sequence design described in S1 is in BnaC09.NTM1 The first or second exon region of the genome sequence.

7. Based on claim 5 BnaC09.NTM1 A method for improving rapeseed seed size through gene editing, characterized by: The mutation described in S6 is the deletion, insertion, and / or substitution of one or more bases, resulting in BnaC09.NTM1 Loss of function.

8. Based on claim 5 BnaC09.NTM1 A method for improving rapeseed seed size through gene editing, characterized by: The rapeseed mentioned in S5 is the Brassica napus type.

Images