Rice oslcd allele, molecular marker and application thereof

Abstract

The application discloses a rice OsLCD allele and a molecular marker and application thereof. The allele (SEQ ID NO: 2) is derived from a low-cadmium mutant obtained by 60Co-gamma ray mutagenesis of Wantaibao, and 16 bp deletion exists in the OsLCD gene segment. The cadmium content of the mutant rice grains is reduced by about 98.2% compared with that of the wild type, and the agronomic characters and the manganese, iron and zinc contents have no significant difference with those of the wild type. The KASP molecular marker developed for the deletion site can accurately distinguish the wild type homozygous, deletion type homozygous and heterozygous genotypes, and the detection accuracy reaches 100%. The application belongs to a non-transgenic low-cadmium gene resource, and can be applied to low-cadmium rice molecular assisted breeding.

Description

Technical Field

[0001] This invention belongs to the field of rice molecular breeding and genetic engineering technology, specifically relating to a rice variety derived from 60Co-γ-ray mutagenesis. OsLCD (LOC_Os01g72670) allele (its sequence is shown in SEQ ID NO:2), KASP molecular marker developed for this deletion site and its application in low cadmium breeding of rice. Background Technology

[0003] Currently, the main technical approaches to reducing cadmium accumulation in rice grains fall into three categories: agronomic regulation (such as water management and lime application), soil remediation (such as topsoil replacement and chemical leaching), and molecular breeding. Among these, agronomic regulation and soil remediation measures are costly, have unstable effects, and are difficult to fundamentally solve the problem; molecular breeding, due to its genetic stability, long-lasting effects, and controllable costs, is considered the most economical and effective way to solve the problem of cadmium pollution in rice.

[0004] Previous studies have shown that multiple genes in rice related to cadmium absorption, translocation, and accumulation are involved in regulating grain cadmium content, including OsNRAMP5, OsHMA3, OsLCT1, OsLCD Genes such as (LOC_Os01g72670). OsNRAMP5 It is a major transporter protein in rice roots involved in the absorption of divalent metal cations, primarily absorbing Mn. 2+ Cd 2+ and Fe 2+ While the loss of this gene's function does reduce cadmium content in grains, the problem arises that the plant's absorption of essential elements like manganese is also affected, resulting in poor plant growth, deteriorated agronomical traits, and decreased yield. Researchers have created numerous low-cadmium rice materials using gene editing, transgenics, and mutagenesis screening, and have also developed corresponding molecular markers for breeding assistance. Publicly reported low-cadmium breeding techniques mainly fall into several categories: site-specific editing of cadmium transport-related genes using CRISPR / Cas9; regulating the expression of cadmium-related genes through transgenic technology; inducing low-cadmium mutants using methods such as EMS or gamma rays; and developing molecular markers like SSR, InDel, and KASP for the detection of low-cadmium genes and molecular-assisted breeding. KASP markers are widely used in rice molecular breeding due to their high throughput, accurate detection, low cost, and suitability for large-scale breeding screening.

[0005] However, these technologies all have significant shortcomings. For gene-edited products to reach the market, they must first overcome the policy hurdles of GMO safety management, and may even encounter intellectual property issues related to foreign gene-editing technologies. Many low-cadmium materials are obtained through gene editing or genetic modification, making variety approval difficult and their industrialization prospects less than optimistic. OsNRAMP5When these genes are completely knocked out, the plant's ability to absorb manganese and iron decreases, resulting in impaired agronomic traits, reduced yield, and diminished breeding value. Furthermore, low-cadmium gene resources are limited to a few familiar types, with very few new functional variations obtained through mutagenesis, resulting in a narrow genetic base and limited scope for variety selection. Among existing molecular markers, some lack stability and universality, making it difficult to distinguish between homozygous, heterozygous, and materials with different genetic backgrounds, hindering large-scale molecular-assisted breeding. Specifically... OsLCD There is already little research on the low-cadmium functional variation of this gene, and even less research on novel deletion alleles that come from non-transgenic mutagenesis and do not impair agronomic traits.

[0006] The reasons for this situation are not hard to understand. Many low-cadmium-related genes themselves perform the physiological function of normal metal ion transport in plants; completely eliminating their function would inevitably impair normal plant growth. At the same time, researchers have devoted too much energy to gene editing, and have not explored enough the superior low-cadmium allelic variants induced by traditional mutagenesis.

[0007] Therefore, there is an urgent need for a new type of rice that does not rely on genetic modification, can reliably reduce cadmium accumulation in rice, and does not affect agronomic traits. OsLCD The absence of alleles, coupled with a highly efficient and stable KASP detection marker, is of great significance for molecular breeding of low-cadmium rice. Summary of the Invention

[0008] This invention aims to provide a rice OsLCD (LOC_Os01g72670) Alleles, Molecular Markers, and Applications. This invention describes the use of 60Co-γ-rays to mutate the rice maintainer line Wantai B, resulting in the screening of a low-cadmium-accumulation mutant within the mutagenized population. Sequencing analysis revealed that this mutant exhibits... OsLCD A 16 bp deletion variant was generated within the gene segment.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0010] This invention provides a rice OsLCD Allele, the sequence of which is shown in SEQ ID NO:2, wherein SEQ ID NO:2 is the wild-type allele shown in SEQ ID NO:1. OsLCD The sequence formed by deleting 16 bp nucleotides from the gene sequence.

[0011] The present invention also provides rice containing the above-described rice. OsLCD Recombinant expression vectors or host cells of alleles.

[0012] This invention also provides a method for breeding low-cadmium mutants of rice, comprising the following steps:

[0013] S1. Radiation mutagenesis treatment of dry rice seeds was carried out using 60Co-γ rays;

[0014] S2. Plant the mutated seeds to obtain the M1 generation, and self-pollinate the M1 generation to obtain the M2 generation.

[0015] S3. M2 and subsequent generations of materials were planted under cadmium pollution conditions, and the Cd content of the grains was measured. Low-cadmium mutants with reduced Cd content in the grains compared with wild type and normal agronomic traits compared with wild type were screened.

[0016] S4. Extract mutant genomic DNA and amplify it. OsLCD Gene regions were sequenced and analyzed, identifying a 16bp deletion variant. OsLCD Alleles.

[0017] To further clarify, the radiation dose for radiation-induced mutation in step S1 is 200–300 Gy; the rice in step S1 is the indica rice maintainer line Wantai B; and the Cd content in the grains is determined by ICP-MS or atomic absorption spectrophotometry in step S3.

[0018] The present invention also provides a method for detecting the above-mentioned rice. OsLCD The KASP molecular markers for alleles include mutant-specific primers, wild-type-specific primers, and a common reverse primer; the nucleotide sequences of the mutant-specific primers are shown in SEQ ID NO:4, the nucleotide sequences of the wild-type-specific primers are shown in SEQ ID NO:3, and the nucleotide sequences of the common reverse primers are shown in SEQ ID NO:5.

[0019] Furthermore, the KASP marker can distinguish between wild-type homozygous genotypes, deletion homozygous genotypes, and heterozygous genotypes.

[0020] The present invention also provides the rice described above. OsLCD Application of alleles in the breeding of low-cadmium rice varieties or the innovation of low-cadmium germplasm resources.

[0021] The present invention also provides the application of the above-described KASP molecular marker in molecular-assisted breeding of low-cadmium rice, identification of low-cadmium germplasm resources, or screening of low-cadmium hybrid offspring.

[0022] This invention also provides a method for breeding low-cadmium rice, using the rice... OsLCD Using alleles as donors, hybridization was performed with the target rice variety. The KASP molecular markers were then used to detect the genotypes of the hybrid offspring, and the rice varieties were screened. OsLCD The offspring materials of alleles were used to obtain low-cadmium rice varieties with reduced grain cadmium content and no significant difference in agronomic traits compared with the target variety.

[0023] To further clarify, the hybridization includes backcrossing.

[0024] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0025] This invention is the first to obtain mutagenesis originating from 60Co-γ rays. OsLCD The novel 16 bp deleted allele is a non-transgenic low-cadmium gene resource, avoiding the difficulties in variety approval and low public acceptance faced by gene editing and transgenic technologies, and has better prospects for industrial application. When planted in soil with a cadmium content of 0.4–1.0 mg / kg, the average cadmium content of the homozygous mutant grains (0.019 mg / kg) was reduced by approximately 98.2% compared to the wild-type Wantai B (1.087 mg / kg), with a cadmium reduction effect comparable to CRISPR / Cas9 gene knockout (P>0.05). Furthermore, it was found that while the low-cadmium mutant obtained in this invention significantly reduced Cd accumulation in grains, the main agronomic traits such as plant height, number of effective panicles, number of grains per main panicle, and thousand-grain weight showed no significant differences from the wild type. The Mn, Fe, and Zn contents in the grains were also comparable to the wild type (P>0.05), overcoming the defect of the OsNRAMP5 mutant, which inhibited plant growth due to impaired Mn absorption. This invention also utilizes KASP molecular markers (SEQ ID NO: 3-5) developed for the 16 bp deletion site. The detection results for wild-type homozygous genotypes, deletion homozygous genotypes, and heterozygous genotypes showed 100% concordance with Sanger sequencing. The detection operation is simple and low-cost, suitable for large-scale high-throughput screening. Therefore, this invention constructs a complete technical system from the discovery of low-cadmium functional variations and the development of molecular markers to breeding applications. The allele (SEQ ID NO: 2) is derived from a low-cadmium mutant obtained by mutagenesis of the high-quality indica rice maintainer line Wantai B using 60Co-γ rays, and can be directly used for molecular-assisted breeding of low-cadmium rice. Attached Figure Description

[0026] Figure 1 The 16 bp deletion site described in this invention is located in OsLCD A diagram showing the location of genes.

[0027] Figure 2 This is a scatter plot of the genotyping results of the KASP molecular marker described in this invention on wild-type, homozygous mutants, heterozygotes, and different rice varieties; where green dots represent HEX (deletion homozygous genotype), red dots represent FAM / HEX (heterozygous genotype), blue dots represent FAM (wild-type homozygous genotype), and gray dots represent undetected.

[0028] Figure 3 This is a comparison chart of cadmium content in brown rice between the 16 bp deletion mutant described in this invention and the wild-type Wantai B.

[0029] Figure 4 This is a comparative diagram of agronomic traits of the 16 bp deletion mutant, wild-type Wantai B, and CRISPR / Cas9OsLCD knockout material described in this invention. In the diagram, A represents plant height, B represents the number of grains per main panicle, C represents the thousand-grain weight, and D represents the number of effective panicles.

[0030] Figure 5 This is a comparison chart of the contents of essential elements such as Mn, Fe, and Zn between the 16 bp deletion mutant described in this invention and the wild-type Wantai B. Detailed Implementation

[0031] All features disclosed in this specification, or all steps in all disclosed methods or processes, may be combined in any way, except for mutually exclusive features and / or steps.

[0032] Unless otherwise stated, each feature disclosed in this specification is merely one example of a series of equivalent or similar features.

[0033] Example 1: Creation and Screening of Low-Cadmium Mutants

[0034] 1. Mutagenesis treatment

[0035] In 2021, using the indica rice maintainer line Wantai B as the mutagenic material, mature and plump seeds harvested in the early season of that year with a germination rate greater than 95% were selected and subjected to irradiation mutagenesis treatment using 60Co-γ rays by the Institute of Biotechnology and Nuclear Technology, Sichuan Academy of Agricultural Sciences. Irradiation dose gradients of 200 Gy, 250 Gy, and 300 Gy were set, with each dose treatment containing at least 1 kg of seeds. After irradiation, the seeds were stored at room temperature for 7 days before sowing, obtaining the M1 generation population.

[0036] 2. Initial screening of low-cadmium mutants

[0037] The M2 generation population (10,324 plants) was planted in mildly to moderately cadmium-contaminated paddy fields (Yizhou District, Hechi City, Guangxi Zhuang Autonomous Region, with a total soil cadmium content of approximately 0.4–1.0 mg / kg) for field screening. At maturity, the main agronomic traits of each plant were investigated, including plant height, number of effective panicles, number of grains per panicle, and thousand-grain weight. Plants with obvious growth abnormalities or severely degraded agronomic traits were removed. Cadmium content was measured after harvesting brown rice samples from each plant. Using the Wantai B wild-type as a control, plants with significantly lower brown rice cadmium content than the control and basically normal agronomic traits were selected as candidate low-cadmium mutants. Seeds from the M2 generation population were obtained by harvesting individual plants from the M1 generation.

[0038] 3. Rescreening of low-cadmium mutants

[0039] Candidate low-cadmium materials obtained from the initial screening were planted in the next generation (M3 generation) and continued to be evaluated in the same field. After maturity, the cadmium content of brown rice was measured again, and agronomic traits were investigated. Materials that showed significantly lower brown rice cadmium content than the wild-type control for two consecutive generations and no significant difference in agronomic traits were included in the rescreening population.

[0040] 4. Verification of stable genetics

[0041] The low-cadmium material obtained from the secondary screening was continuously self-pollinated to the M5 generation. Repeated planting trials were conducted in different years and different fields in Yizhou District. The results showed that the target material consistently exhibited low cadmium accumulation characteristics for multiple generations, with its brown rice cadmium content significantly lower than that of the parent Wantai B. Furthermore, the main agronomic traits such as plant height, number of effective panicles, number of grains per main panicle, and thousand-grain weight showed no significant differences from the parent, indicating that the low-cadmium trait can be stably inherited.

[0042] Example 2: OsLCD Deletion variant identification and sequence analysis

[0043] Our research group previously studied candidate genes related to cadmium accumulation. OsLCD (LOC_Os01g72670), genomic DNA was extracted from leaves of the stable genetically validated low-cadmium mutant and wild-type Wantai B. This was for verification purposes. OsLCD Gene mutation status, according to OsLCD Multiple pairs of overlapping PCR primers were designed for genome sequencing to amplify and sequence the full-length target gene. The length of each amplified fragment was controlled between 600 and 800 bp, and adjacent fragments were designed with an overlap region of 100 to 150 bp to ensure the accuracy of sequence assembly.

[0044] For amplification OsLCD The full-length primer pair sequences for the gene are as follows:

[0045] OsLCD -F1: 5′-TGGTACTCCTGGACTACACAG-3′ (SEQ ID NO: 6)

[0046] OsLCD- R1: 5′-TCTGTCTCTCCCCACTAAGAA-3′ (SEQ ID NO:7)

[0047] The PCR amplification conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 60 s, for a total of 35 cycles; and a final extension at 72℃ for 10 min.

[0048] After purification, the amplified products were subjected to bidirectional Sanger sequencing (using an ABI 3730xl DNA Analyzer as the sequencing platform, with the same sequencing primers as the amplification primers), and splicing analysis was performed using sequence alignment software.

[0049] Sequencing results (see) Figure 1 ), low cadmium mutants in OsLCD A 16 bp deletion variant exists within the gene segment (deletion site shown in SEQ ID NO:2), while the parental Wantai B does not exhibit this deletion variant (wild-type sequence shown in SEQ ID NO:1). This deletion leads to... OsLCD The gene sequence was altered and stably co-segregated with the low cadmium accumulation phenotype.

[0050] A segregating population was constructed by crossing a low-cadmium mutant with wild-type Wantai B. Molecular markers were developed using deletion sites to detect genotypes within the segregating population. Results showed that plants carrying the 16 bp deleted allele exhibited lower cadmium content in brown rice, while wild-type allele plants showed higher cadmium content. The co-segregation rate (X) between genotype and phenotype was determined by chi-square test. 2 =34.56, P<0.001, indicating that this 16 bp deletion is closely associated with the low cadmium accumulation trait.

[0051] Relevant sequence information:

[0052] SEQ ID NO:1- OsLCD The wild-type cDNA sequence (LOC_Os01g72670) must contain at least 200 bp upstream and downstream of a 16 bp deletion site.

[0053] TGGTACTCCTGGACTACACAGAGTCCGGAAACAAGGGGAGTTTCATCGTCACACAAGTTGATGGGTCATTCACTGCCTGGTTTGAAACAGGTGGAAAAGAGCTCTGCTTTGACTCATCTGGTCATATTACTCAGTTATTTAAAGACATGATTGTCGATTTTTACGATCTGACCTGGAGTTTGCACAAGAGGCACTTAGTCATGCAGAATTTTGTAAAGGAAAATATATACGTCAAAATCTTTGATGGCGTACCCAAACTTATGATTCTACTAACTGAAGTTAAATTGGTTGATCAGCTAGGGCCATTCAAACAGGACTGGAGTCATGTCCAAGGCCTCATGACTTGGTGTAAAGAACAATCTGGTTTAAAAATGGACTTTCTTACCAAGAGTTTCTATGATTTCATCGGATCTACCGACTGCACAGTAATCAAGCTGAGAAACTACCCTGATGATTGGGATGAAAAAAAGAAAGGTGATTATTTGCTCACACTCGCAGAAGTAAACCACGGAGTTCTTAAAGATAAGTTGAAGAGTAGGGATGATTTTCATTGGCCGTTTGTGAAGCTGCCTAAGCTGGAGCAGAACTTACCACCAATGTTACAGCAAATTCTTAGTGGGGAGAGACAGA

[0054] SEQ ID NO: 2-16 bp deletion mutant allele sequence (sequence obtained by deleting 16 bp on the basis of SEQ ID NO: 1):

[0055] TGGTACTCCTGGACTACACAGAGTCCGGAAACAAGGGGGAGTTTCATCGTCACACAAGTTGATGGGTCATTCACTGCCTGGTTTGAAACAGGTGGAAAAGAGCTCTGCTTTGACTCATCTGGTCATATTACTCAGTTATTTAAAGACATGATTG TCGATTTTTACGATCTGACCTGGAGTTTGCACAAGAGGCACTTAGTCATGCAGAATTTTGTAAAGGAAAATATATACGTCAAAATCTTTGATGGCGTACCCAAACTTATGATTCTACTAACTGAAGTTAAATTGGTTGATCAGCTAGGGCCAT TCAAACAGGACTGGAG TCATGTCCAAGGCCTCATGACTTGGTGTAAAGAACAATCTGGTTTAAAAATGGACTTTCTTACCAAGAGTTTCTATGATTTCATCGGATCTACCGACTGCACAGTAATCAAGCTGAGAAACTACCCTGATGATTGGGATGAAAAAAAGAAAGGTGATTA TTTGCTCACACTCGCAGAAGTAAACCACGGAGTTCTTAAAGATAAGTTGAAGAGTAGGGATGATTTTCATTGGCCGTTTGTGAAGCTGCCTAAGCTGGAGCAGAACTTACCACCAATGTTACAGCAAATTCTTAGTGGGGAGAGACAGA (missing 16 underlined) bp missing fragment)

[0056] Example 3: Identification of agronomic traits and essential element content

[0057] 1. Comparison of agronomic traits

[0058] The Wantai B-16bp deletion mutant, Wantai B wild-type, and Wantai B-Cas9 knockout obtained in this invention were used. OsLCD The materials were planted in the same field, and the main agronomic traits were investigated after maturity. The results are shown in Table 1.

[0059] Table 1 Comparison of main agronomic traits of different materials

[0060]

[0061] The results are shown in Table 1 and... Figure 4The Wantai B-16bp deletion mutant showed no significant difference from the wild-type Wantai B in major agronomic traits such as plant height, number of grains per panicle, thousand-grain weight, and number of effective panicles (P>0.05, t-test), indicating that the 16bp deletion basically does not affect the normal growth and development and yield traits of rice.

[0062] 2. Comparison of essential element content

[0063] The contents of essential elements such as Mn, Fe, and Zn in the grains of wild-type Wantai B and Wantai B-16bp deletion mutant were determined, and the results are shown in Table 2.

[0064] Table 2 Comparison of essential element content in grains of different materials (mg / kg)

[0065]

[0066] The results are shown in Table 2 and Figure 5 The Mn, Fe, and Zn contents in the grains of the Wantai B-16bp deletion mutant were not significantly different from those of the wild-type Wantai B (P>0.05, t-test), indicating that the 16bp deletion does not lead to a deficiency of essential elements. This is what distinguishes this invention from... OsNRAMP5 Key advantages of mutation: OsNRAMP5 The mutant inhibits plant growth by affecting Mn uptake, while the present invention... OsLCD The 16 bp deletion mutant reduces cadmium accumulation without affecting the normal absorption of essential elements.

[0067] Example 4: KASP Tag Development and Performance Verification

[0068] in accordance with OsLCD KASP genotyping primers (SEQ ID NO: 3-5) were designed for the 16 bp deletion site of the gene. The KASP primer sequences are as follows:

[0069] Wild-type specific forward primer sequence (SEQ ID NO:3):

[0070] GAAGGTGACCAAGTTCATGCTATGAGGCCTTGGACATGACTC

[0071] Mutant-specific forward primer sequence (SEQ ID NO:4):

[0072] GAAGGTCGGAGTCAACGGATTATGAGGCCTTGGACATGAATG

[0073] Public reverse primer sequence (SEQ ID NO:5):

[0074] TGTACAGTTAAATTGGTTGATCAGC.

[0075] The reaction system (10 μL) for KASP detection is as follows: 2 μL DNA template (20 ng / μL), 5 μL KASP Master Mix, 0.14 μL primer mixture (each primer concentration is 100 μM), and ddH2O to a final volume of 10 μL.

[0076] The amplification program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, annealing at 61-55℃ (gradient cooling) for 60 s, for a total of 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing for 60 s, for a total of 26 cycles.

[0077] Fluorescence signal detection was performed using a fluorescence microplate reader (BMG PHERAstar) at excitation wavelengths of 485 nm, emission wavelengths of 520 nm (FAM), and emission wavelengths of 556 nm (HEX). Genotype determination was based on cluster analysis using the intensity of the endpoint fluorescence signal.

[0078] Genotyping of wild-type, mutant, and hybrid offspring was performed using the KASP detection platform.

[0079] The samples tested included: Wantai B wild type (2 samples), 16 bp deletion mutant (2 samples), hybrid F1 (1 sample), and other rice varieties (20 samples), totaling 25 samples. The genotyping results are shown in Table 3.

[0080] Table 3. KASP marker gene typing validation results

[0081]

[0082] (Note: FAM is the wild-type homozygous genotype, HEX is the deletion homozygous genotype, and FAM / HEX is the heterozygous genotype.)

[0083] From Table 3 and Figure 2 The results showed that the developed KASP markers could accurately distinguish: (1) wild-type homozygous genotype (FAM); (2) deletion homozygous genotype (HEX); (3) heterozygous genotype (FAM / HEX); and (4) gray sample dots represented no data from the well, which were meaningless background values. The detection results were consistent with the sequencing results, with an accuracy of 100% and good repeatability, making it suitable for molecular-assisted breeding of low-cadmium rice.

[0084] Example 5: Validation of Breeding Applications

[0085] Using a low-cadmium mutant (Wantai B-16bp deletion mutant) as the donor parent, hybridization and backcrossing were performed with the rice male-sterile line Wantai A. The KASP marker developed in this invention was used to detect the genotype of the hybrid offspring, and carriers were screened. OsLCD16Progeny of the bp-deleted allele (Wantai A × Wantai B backcross 1 generation).

[0086] 1. Determination of cadmium content in grains

[0087] Wild-type Wantai B, Wantai B-16bp deletion mutant, and Wantai A × Wantai B backcross generation 1 materials were planted in three replicate fields in Yizhou District, Hechi City, Guangxi. After maturity, the cadmium content of brown rice was measured, and the results are shown in Table 4.

[0088] Table 4 Comparison of cadmium content in grains of different materials (mg / kg)

[0089]

[0090] The results are shown in Table 4 and Figure 3 The average cadmium content in the grains of the Wantai B-16bp deletion mutant (0.019 mg / kg) was reduced by approximately 98.2% compared to the wild-type Wantai B (1.087 mg / kg), demonstrating a highly significant cadmium reduction effect. Backcross progeny carrying this deleted allele did not show a reduction in grain cadmium content due to their heterozygous genotype.

[0091] 2. Agronomic traits of backcross offspring

[0092] The main agronomic traits of wild-type Wantai B, Wantai B-16bp deletion mutant, and Wantai A × Wantai B backcross generation 1 materials were investigated, and the results are shown in Table 5.

[0093] Table 5 Comparison of agronomic traits of different materials

[0094]

[0095] The results showed that the agronomic traits (except for plant height and number of grains per panicle) of the Wantai B-16bp deletion mutant and its backcross progeny were not significantly different from those of the recurrent parent Wantai B (P>0.05, t test), further confirming that the 16bp deletion allele reduced cadmium accumulation without affecting the main agronomic traits of rice.

[0096] 3. Generational advancement program for backcross breeding

[0097] Using a low-cadmium mutant (Wantai B-16bp deletion mutant) as the donor parent and Wantai A as the recurrent parent, F1 was obtained by hybridization. F1 was backcrossed with the recurrent parent to obtain BC1F1. The genotype of BC1F1 was detected using the KASP markers shown in SEQ ID NO:3-5. Individual plants carrying heterozygous deletion alleles and with excellent agronomic traits were selected for further backcrossing. After 3-4 generations of backcrossing, plants carrying homozygous deletion alleles (HEX type) were selected for self-pollination and purification to obtain breeding materials with low cadmium and stable agronomic traits.

[0098] Example 6: Comparison Experiment with CRISPR / Cas9 Knockout Materials

[0099] The Wantai B-16bp deletion mutant and the Wantai B-Cas9 knockout OsLCD material obtained in this invention were planted in three replicate fields in Yizhou District, Hechi City, Guangxi Province, and their cadmium reduction effects were compared. The results are shown in Table 6.

[0100] Table 6. Comparison of cadmium content (mg / kg) in grains of 16 bp deletion mutants and CRISPR / Cas9 knockout materials.

[0101]

[0102] Statistical analysis (P > 0.05) showed no significant difference in cadmium accumulation capacity between the Wantai B-16bp deletion mutant and the Wantai B-Cas9 knockout OsLCD material, indicating that the cadmium reduction effect of the 16bp deletion allele described in this invention is comparable to that of CRISPR / Cas9 gene knockout.

[0103] However, compared with CRISPR / Cas9 knockout materials, the present invention has the following advantages: (1) it is derived from non-transgenic mutagenesis pathways and there are no regulatory obstacles to variety approval and industrialization promotion; (2) its agronomic traits are superior to those of CRISPR / Cas9 knockout materials (see Table 1). The plant height, number of grains per ear, thousand-grain weight and other traits of the 16 bp deletion mutant are not significantly different from those of the wild type, while some CRISPR / Cas9 knockout materials may have certain agronomic trait losses.

[0104] Example 7: Construction of recombinant expression vector and host cells

[0105] The 16 bp deletion mutant shown in SEQ ID NO:2 OsLCD After PCR amplification, the coding sequence was cloned into the plant binary expression vector pCAMBIA1300 via homologous recombination or restriction enzyme ligation. This vector contains the CaMV 35S promoter and a hygromycin resistance selection marker gene. After sequencing verification, the recombinant vector was transformed into Agrobacterium competent cells EHA105 using a freeze-thaw method. The cells were plated on YEB solid medium containing 50 mg / L kanamycin and 20 mg / L rifampin and incubated at 28°C for 48 h. Single colonies were picked for colony PCR identification; positive clones contained the gene shown in SEQ ID NO:2. OsLCD Recombinant host cells lacking alleles.

[0106] In summary, this invention, through 60Co-γ-ray radiation-induced mutagenesis of the indica rice maintainer line Wantai B, for the first time screened and obtained a stable genetic low-cadmium-accumulating rice mutant from the mutagenesis population; and for the first time identified in this mutant... OsLCDA novel allele with a 16 bp deletion in the coding region of the (LOC_Os01g72670) gene, its sequence is shown in SEQ ID NO:2. This study is the first to demonstrate a close association between this 16 bp deletion allele and the low cadmium accumulation trait in rice grains. Homozygous mutants carrying this allele significantly reduced grain cadmium content (approximately 98.2% lower than the wild type) while largely unaffected major agronomic traits such as plant height, number of grains per panicle, and thousand-grain weight. It also did not affect the normal absorption of essential elements such as Mn, Fe, and Zn, overcoming the limitations of existing low-cadmium gene resources (such as...). OsNRAMP5 This invention addresses the shortcomings of existing technologies, such as the scarcity of low-cadmium gene resources, impaired agronomic traits, and strong dependence on transgenic genes, which affect the normal growth of plants due to mutants. Based on this, the invention develops, for the first time, a KASP molecular marker (SEQ ID NO: 3-5) targeting this 16 bp deletion site. This marker can stably and accurately distinguish between wild-type homozygous genotypes, deletion-type homozygous genotypes, and heterozygous genotypes, with a detection accuracy of 100%. It is suitable for large-scale, high-throughput molecular-assisted breeding screening and has good breeding application value and industrialization prospects.

[0107] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. A type of rice OsLCD Alleles, characterized by: The sequence of the allele is shown in SEQ ID NO:2, which is the wild-type allele shown in SEQ ID NO:

1. OsLCD The sequence formed by deleting 16 bp nucleotides from the gene sequence.

2. Containing the rice described in claim 1 OsLCD Recombinant expression vectors or host cells of alleles.

3. A method for breeding low-cadmium mutants of rice, characterized in that, Includes the following steps: S1. Radiation mutagenesis treatment of dry rice seeds was carried out using 60Co-γ rays; S2. Plant the mutated seeds to obtain the M1 generation, and self-pollinate the M1 generation to obtain the M2 generation. S3. M2 and subsequent generations of materials were planted under cadmium pollution conditions, and the Cd content of the grains was measured. Low-cadmium mutants with reduced Cd content in the grains compared with wild type and normal agronomic traits compared with wild type were screened. S4. Extract mutant genomic DNA and amplify it. OsLCD The gene region was sequenced and analyzed, and a 16 bp deletion variant was identified. OsLCD Alleles.

4. The method according to claim 3, characterized in that: The radiation dose for radiation-induced mutation in step S1 is 200–300 Gy; the rice in step S1 is the indica rice maintainer line Wantai B; the Cd content in the grains is determined by ICP-MS or atomic absorption spectrophotometry in step S3.

5. A method for detecting the rice of claim 1 OsLCD KASP molecular markers of alleles, characterized by: The KASP marker includes mutant-specific primers, wild-type-specific primers, and a common reverse primer; the nucleotide sequence of the mutant-specific primer is shown in SEQ ID NO:4, the nucleotide sequence of the wild-type-specific primer is shown in SEQ ID NO:3, and the nucleotide sequence of the common reverse primer is shown in SEQ ID NO:

5.

6. The KASP molecular marker according to claim 5, characterized in that: The KASP marker can distinguish between wild-type homozygous genotype, deletion homozygous genotype, and heterozygous genotype.

7. The rice according to claim 1 OsLCD Application of alleles in the breeding of low-cadmium rice varieties or the innovation of low-cadmium germplasm resources.

8. The application of the KASP molecular marker according to claim 5 or 6 in molecular-assisted breeding of low-cadmium rice, identification of low-cadmium germplasm resources, or screening of low-cadmium hybrid offspring.

9. A method for breeding low-cadmium rice, characterized in that: The rice according to claim 1 OsLCD Using alleles as donors, hybridization is performed with the target rice variety. The KASP molecular markers described in claim 5 or 6 are used to detect the genotype of the hybrid offspring, and the rice variety described in claim 1 is screened. OsLCD The offspring materials of alleles were used to obtain low-cadmium rice varieties with reduced grain cadmium content and no significant difference in agronomic traits compared with the target variety.

10. The breeding method according to claim 9, characterized in that: The hybridization includes backcrossing.

Images