A bacillus subtilis gene editing method based on a recombinase system

Abstract

The present application relates to the technical field of enzyme genetic engineering, in particular to a Bacillus subtilis gene editing method based on a recombinase system, in which the activity of the gene recombinase system in Bacillus subtilis is verified first, which provides new possibilities for the application of Bacillus subtilis in synthetic biology, gene therapy and other biotechnological fields, and the use of a resistance gene as a marker gene based on the recombinase system expands the selection range of the roxP recombination site, not only the wild type roxP can be used, but also a variety of rox mutants can be used, the introduction of any resistance marker gene is realized, the homologous recombination technology is combined to realize the precise integration of the exogenous gene, the recombination efficiency is improved, and unnecessary genome recombination is reduced, on the basis of which, the leakage activity of the system is reduced through the Dre recombinase regulation system, so that the application of the recombinase system in Bacillus subtilis is more efficient and reliable.

Description

Technical Field

[0001] This invention relates to the field of enzyme gene engineering technology, and in particular to a gene editing method for Bacillus subtilis based on a recombinant enzyme system. Background Technology

[0002] In the field of modern biotechnology, the application of genetic engineering is becoming increasingly widespread, especially in the field of microorganisms. Gene editing technology is used to improve microorganisms to enhance their application value in industries such as industry, medicine, and agriculture. Bacillus subtilis, as an important microbial platform, is widely used in biotechnology, food industry, agriculture, and environmental protection due to its strong secretion capacity, stress resistance, and food-grade microbial characteristics.

[0003] However, achieving efficient and precise gene manipulation in Bacillus subtilis, especially the scarless knockout of functional genes and the stable integration of exogenous genes, has always been a challenge in the field of genetic engineering. Traditional gene knockout techniques often leave exogenous resistance markers in the genome, which not only limits the possibility of continuous knockout but may also affect gene expression and cell function.

[0004] The Dre recombinase system is a family of recombinases derived from D6 phage. It is characterized by high efficiency and specificity, acting on DNA substrates of various structures, including linear, circular, and even supercoiled structures. The Dre recombinase system has been successfully applied to gene knockout in various eukaryotic cells and *E. coli*. The Dre recombinase system recognizes a specific DNA sequence (roxP) and induces recombination. The roxP site consists of 32 bp, containing two 12 bp flanking repeats and an 8 bp spacer region.

[0005] Currently, no application of the Dre-roxP gene recombinase system has been found in gene editing of Bacillus subtilis. However, it could provide a new strategy for gene editing of Bacillus subtilis, enabling both the scarless knockout of functional genes and the precise integration of exogenous genes by combining homologous recombination technology. This would solve the technical challenges in current gene engineering operations, provide new possibilities for the application of Bacillus subtilis in synthetic biology, gene therapy, and other biotechnology fields, and provide stronger technical support for industrial production, pharmaceutical development, and environmental protection. Summary of the Invention

[0006] The purpose of this invention is to provide a Bacillus subtilis gene editing method based on the Dre-roxP gene recombinase system;

[0007] Another objective of this invention is to provide a method for regulating the Dre-roxP gene recombinase system.

[0008] The technical solution adopted to achieve the purpose of this invention is:

[0009] The primary objective of this application is to provide a more efficient, flexible, and controllable technical means for gene editing in Bacillus subtilis, enabling the scarless knockout of functional genes and the precise integration of exogenous genes in Bacillus subtilis based on a recombinase system.

[0010] On the one hand, this application discloses for the first time the application of the Dre-roxP gene recombinase system in gene editing of Bacillus subtilis. The Dre-roxP gene recombinase system includes a marker gene and two roxP recombination sites. The roxP recombination sites are either wild-type roxP as shown in SEQ ID NO:1 or rox mutants with mutations at positions 11-18 based on the nucleotide sequence shown in SEQ ID NO:1.

[0011] Among them, SEQ ID NO:1 is:

[0012] taactttaaataatgccaat tatttaaagt ta.

[0013] Further, the mutant is a rox mutant having the nucleotide sequence shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6; in this application, the rox mutant having the nucleotide sequence of SEQ ID NO:2 is represented by rox9, the rox mutant having the nucleotide sequence of SEQ ID NO:3 is represented by rox13, the rox mutant having the nucleotide sequence of SEQ ID NO:4 is represented by rox14, the rox mutant having the nucleotide sequence of SEQ ID NO:5 is represented by rox62, and the rox mutant having the nucleotide sequence shown in SEQ ID NO:6 is represented by rox63.

[0014] in:

[0015] SEQ ID NO:2 is:

[0016] 1taactttaaa taacgccccttatttaaagt ta

[0017] SEQ ID NO:3 is:

[0018] 1taactttaaa taacgcctgt tatttaaagt ta

[0019] SEQ ID NO:4 is:

[0020] 1taactttaaa taaggcctct tatttaaagt ta

[0021] SEQ ID NO:5 is:

[0022] 1taactttaaataacgcccgttatttaaagt ta

[0023] SEQ ID NO:6 is:

[0024] 1taactttaaataaggccccttatttaaagt ta.

[0025] Furthermore, the marker genes include, but are not limited to, bleomycin resistance gene ble and kanamycin (neomycin) resistance gene neo, which are marker genes that can play a role in resistance selection in cells.

[0026] Furthermore, the roxP recombination site is a rox mutant, and the mutant has the nucleotide sequence shown in SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0027] Secondly, the Dre-roxP gene recombinase system described in this application includes any one of the promoters of PcspD (SEQ ID NO:7), Pspac (SEQ ID NO:8), PspanK (SEQ ID NO:9), and PsodA (SEQ ID NO:10) to enhance the expression of the Dre recombinase gene. It also includes the operon lacO and the repressor protein lacI, which are combined with the Dre recombinase gene to express the Dre recombinase in Bacillus subtilis, causing recombination at two roxP sites in the genome.

[0028] in:

[0029] SEQ ID NO:7 is:

[0030] 1tggcgtactt gagagcatac gaaaatcgtg tgctcttttt atttatattc agccatcaat

[0031] 61aaaagcggtt acattttttt atggaacttg cccttctttt gaaaaataag ccgtttcgca

[0032] 121acttgacggg tgctcccaga tggtgtatag ttgaaccatc atttaacaat gaatcaaagt

[0033] 181tagatgatga caaaattttt tttagcacat gggtgctaca gtactaggag gaattaagca

[0034] 241at

[0035] SEQ ID NO:8 is:

[0036] 1attatgggtg aagtggtcaa gacctcacta ggcaccttaa aaatagcgca ccctgaagaa

[0037] 61gatttatttg aggtagccct tgcctaccta gcttccaaga aagatatcct aacagcacaa

[0038] 121gagcggaaag atgttttgtt ctacatccag aacaacctct gctaaaattc ctgaaaaatt

[0039] 181ttgcaaaaag ttgttgactt tatctacaag gtgtggcata atgtgtggaa

[0040] SEQ ID NO:9 is:

[0041] 1ctcgagggta aatgtgagca ctcacaattc attttgcaaa agttgttgac tttatctaca

[0042] 61aggtgtggca taatgtgtgt aattgtgagc ggataacaat ttactagagt aaaggaggaa

[0043] 121ttaagcaat

[0044] SEQ ID NO:10 is:

[0045] 1gataattcct ccttagtata tatgtactga aatgccgctt cacagcgagc ctttcttcat

[0046] 61tcaatgtaac aaaagaatgc tttgtaatca atgaaaaagc tcacgatttg gctcatttca

[0047] 121gcggacatatttcactttaa ccgataatct gccccattaa acctgccgcc agcatttc.

[0048] Furthermore, the expression vector of the Dre-roxP gene recombinase system is any one of pMA5-PcspD-Dre, pMA5-Pspac-Dre, pMA5-PspanK-Dre, and pMA5-PsodA-Dre.

[0049] Thirdly, the regulation method of the Dre-roxP gene recombinase system further employs at least one of the following two methods:

[0050] Method 1: Add the lacO operon and / or theophylline riboswitch before the Dre gene, amplify by PCR to obtain a linearized vector, recover it and transform it into competent E. coli cells to obtain a plasmid. The plasmid controls the expression of Dre recombinase through the lacO operon.

[0051] Method 2: Add the lacO operon before the promoter, placing the lacO operon upstream of the promoter to control the expression of Dre recombinase.

[0052] Furthermore, the Dre recombinase has the nucleotide sequence shown in SEQ ID NO:11, which is:

[0053] 1atgtccgaac tgatcattag cggatcatca ggcggtttct tacgcaacat tggcaaagaa

[0054] 61tatcaagaag ctgcagagaa tttcatgcgc tttatgaacg atcaaggtgc ctatgcacct

[0055] 121aacacactta gggatcttcg gctggtattt catagctggg cacgctggtg ccatgcacgg

[0056] 181caactggcat ggtttccgat ttcaccggag atggcacgtg agtatttctt acaacttcat

[0057] 241gatgcagatc ttgcatctac aacaattgat aagcattacg ccatgctgaatatgctgctt

[0058] 301tcacattgtg gactgcctcc acttagcgat gacaatcag tgtcactggc catgcgccgc

[0059] 361attcgtcgtg aagcagctac agaaaggt gaacgcacag gtcaagcaat tccgttacgt

[0060] 421tgggatgatc ttaaactgct ggatgtgctt cttagccgtt cagaacgcct tgtcgattta

[0061] 481cgtaatcggg ccttcttatt tgtggcatat aacacgttaatgcggatgtc tgaaatttct

[0062] 541 cgcattcgtg ttggcgatct ggaccaaaca ggcgatacag tgactttgca tatcagccac

[0063] 601acaaagacgattaccacggc tgcaggcctg gataaagtgc tttcacggcg cacaacagca

[0064] 661gtacttaacg attggctggatgtctctgga ttacgggaac accctgatgc tgtactgttt

[0065] 721ccgcctatcc atcggtcaaa caaagcacgg atcacaacga cacctttaac agctccggct

[0066] 781

[0067] 841aagggacgct atcggacatg gacaggtcat tcagcacgtg tgggagcagc aatcgatatg

[0068] 901gcagagaaac aagtcagcatggtcgaaatc atgcaagaag gcacatggaa gaaaccggaa

[0069] 961acgttgatgc ggtacctgag gcgcggtgga gtttcagtcg gtgcaaactc tcgtctcatg

[0070] 1021gattcatgat ga.

[0071] Furthermore, in the regulation method of the Dre-roxP gene recombinase system, the preferred expression vector for the Dre recombinase system is pMA5-PspanK-lacO-RS-Dre.

[0072] This application further discloses genetically engineered bacteria, cells, or kits comprising the DrexP gene recombinase system.

[0073] Furthermore, this application discloses the application of the Dre-roxP gene recombinase system, which includes knocking out functional genes within the Bacillus subtilis genome and / or achieving marker-free integrative expression of exogenous genes at designated genomic loci in Bacillus subtilis.

[0074] Compared with the prior art, the beneficial effects of the present invention are:

[0075] 1. The gene recombinase system is compact, efficient, and highly specific, and does not interfere with the normal expression and regulation of genes during gene editing. Using the resistance gene BLE as a marker gene, it can achieve scarless knockout of the target functional gene within the Bacillus subtilis genome without introducing any resistance marker gene. It can also be combined with homologous recombination technology to achieve precise integration of exogenous genes. Furthermore, the gene recombinase system significantly expands the selectable range of RoxP recombination sites, allowing the use of not only wild-type RoxP but also various Rox mutants, which further improve recombination efficiency.

[0076] 2. This application verifies the activity of the recombinase system in Bacillus subtilis, which lays a solid foundation for its application in the field of gene editing of Bacillus subtilis, provides new possibilities for the application of Bacillus subtilis in synthetic biology, gene therapy and other biotechnology fields, and provides stronger technical support for industrial production, pharmaceutical development and environmental protection.

[0077] 3. Reducing system leakage activity through the Dre recombinase regulation system: When the recombinase system was applied to Bacillus subtilis, researchers found that all four plasmids exhibited some leakage expression. That is, without the addition of an inducer, the Dre recombinase was naturally expressed in the cell and triggered recombination between two roxP recombination sites. The Dre recombinase regulation system significantly improved the system's strictness, achieving precise control over the expression of the Dre recombinase, thereby effectively reducing leakage activity and making the application of the recombinase system in Bacillus subtilis more efficient and reliable. Attached Figure Description

[0078] Figure 1 To verify the activity of the recombinase system in Bacillus subtilis and the plasmid map of Dre recombinase expressed by different promoters, using the knockout of the bleomycin resistance gene ble as an example in Example 1 of the present invention;

[0079] Figure 2 This is a gel electrophoresis image of the bleomycin resistance gene ble integrated into the dacA site and the bleomycin resistance gene knocked out in Example 1 of the present invention.

[0080] Figure 3 The recombination efficiency of different Rox mutants in Example 2;

[0081] Figure 4 This is a schematic diagram of the stringency optimization results of the free plasmid carrying the Dre encoding gene in Example 2;

[0082] Figure 5 This is a schematic diagram of the scarless knockout of the ackA genomic functional gene in Bacillus subtilis based on the recombinase system in Example 3;

[0083] Figure 6 This is a schematic diagram of the integration of the exogenous gene DnaK at the ycsE site of the Bacillus subtilis gene based on the recombinase system in Example 4. Detailed Implementation

[0084] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0085] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.

[0086] Experimental methods not specified with particular conditions in the embodiments of this application can generally be performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual* by J. Sambrook et al., or according to the manufacturer's recommendations. Those skilled in the art can better understand and master this invention through the examples. However, the methods for implementing this invention should not be limited to the specific method steps described in the embodiments of this invention.

[0087] Example 1: Construction of the Dr-roxP gene recombinase system in Bacillus subtilis

[0088] (1) Constructing the genomic integration fragment of the resistance gene BLE

[0089] First, using plasmid p7Z6 as a template, primers were designed to amplify the bleomycin (BLE) resistance gene fragment. Based on the Bacillus subtilis genome as a template, the dacA gene was selected as the target gene. Primers were designed to amplify 1000 bp fragments upstream and downstream of the dacA gene, obtaining dacA gene knockout fragments F1 and F3. Further, using primer embedding technology, a 32 bp wild-type roxP sequence was introduced into the downstream primer of fragment F1 and the upstream primer of fragment F3. Fragments F1, F3, and the BLE resistance gene fragment were fused using overlap extension PCR technology, ultimately yielding the dacA-roxP-ble-roxP fragment.

[0090] To ensure successful PCR amplification, the following reaction system was used:

[0091] Primers system Upstream primer (10 μmol / L) 2.5μL Downstream primer (10 μmol / L) 2.5μL DNA template 2μL PrimeSTAR Max Premix (2×) 25μL <![CDATA[ddH2O]]> 18μL

[0092] The total reaction volume was 50 μL. The PCR amplification conditions were: 98℃ for 2 minutes, 1 cycle; 98℃ for 30 seconds, 60℃ for 15 seconds, 72℃ for 3 minutes, 30 cycles; and a final extension at 72℃ for 5 minutes.

[0093] (2) Transformation and homologous recombination of the BLE integration segment of the resistance gene

[0094] The dacA-roxP-ble-roxP fragment was transformed into competent Bacillus subtilis cells using the Spizizen transformation method, followed by homologous recombination. After homologous recombination, the roxP-ble-roxP fragment successfully integrated into the chromosome of Bacillus subtilis, yielding the recombinant strain Bs-dacA-roxP-ble-roxP.

[0095] (3) Construction of the DreroxP gene recombinase system vector

[0096] Using free plasmid pMA5 as the starting vector, primers were designed to amplify promoters such as P43 (SEQ ID NO:12), PcspB (SEQ ID NO:13), Pglv (SEQ ID NO:14), PcspD, Pspac, PspanK, and PsodA. The PspxI restriction site was introduced into the upstream primer, and the lacO gene was introduced into the downstream primer.

[0097] Simultaneously, primers were designed to amplify the synthesized Dre recombinase gene, and a BmaHI restriction site was introduced into the downstream primer. Through this design, the downstream primer of the promoter sequence fragment is complementary to the upstream sequence of the Dre recombinase sequence fragment, while the downstream primer of the Dre recombinase sequence fragment is complementary to the upstream sequence of the lacI sequence fragment. Therefore, these three fragments can be fused by overlap extension PCR, ultimately obtaining seven fragments, including P43-Dre-lacI, each with a different promoter.

[0098] SEQ ID NO:12 is:

[0099] 1tggctgaaaa ttctttacatt tattttacat ttttagaaat gggcgtgaaa aaaagcgcgc

[0100] 61gattatgtaa aatataaagt gatagcggta ccattatagg taagagagga atgtacac

[0101] SEQ ID NO:13 is:

[0102] 1tgtgaccata ctcctatcta tgtattagag catgcaagca atatcagaca taaaaatcat

[0103] 61acgctctctt agttgataaa cgttgtcatt tgtaatattg attaactttt accttatactca

[0104] 121tatccaataa ggttgtcaat tcctattact tatcttccca aaatgaagga atactaaggc

[0105] 241

[0106] 301ctggtagatg aaaggtaatt atttttgttc gaactatctt taagaaa gttttgtaag

[0107] 361agttttcgtc ttgaaagttt gttaagagca agaatagtga atttaagcgt tatgatcgct

[0108] 421ttaggagaa atttc

[0109] SEQ ID NO:14

[0110] 1cttttgtccc ctgccttttc taaattcacg caaattgga tgttttatat aaatgattat

[0111] 61aaataattcg gcatgtatcc gaatcgtaca aaagaacctt ttcataagaa ttggaagggc

[0112] 121gtatattcac ttaaaattca cagttggtga gactttaaga ttacaaaaaa ggtaaaaaaa

[0113] 181ccaaatctct cagacataag ccaaatgaga aatttcccgc tctatgggaa aaaacactaa

[0114] 241agttgatcaa atgacctaag tgcgccaaac gtgttacggg acgagctatc tcatggtata

[0115] 301aatggaattg taaaatttat caaggaggtc gtcat。

[0116] Seven new free plasmids were constructed by ligating the plasmid pMA5, which was double-digested with PspxI / BmaHI, to the seven fragments mentioned above: pMA5-P43-Dre, pMA5-PcspB-Dre, pMA5-Pglv-Dre, pMA5-PcspD-Dre, pMA5-Pspac-Dre, pMA5-PspanK-Dre, and pMA5-PsodA-Dre.

[0117] (4) Induction of Dre recombinase plasmid expression and knockout of resistance gene

[0118] The seven free plasmids were introduced into the recombinant strain Bs-dacA-roxP-ble-roxP, and Dre recombinase was expressed under IPTG induction. After screening, plasmids pMA5-PcspD-Dre, pMA5-Pspac-Dre, pMA5-PspanK-Dre, and pMA5-PsodA-Dre all successfully expressed Dre recombinase, catalyzing recombination at two roxP sites, thereby deleting the resistance gene ble, ultimately yielding strain Bs-dacA-rox-Dre.

[0119] like Figure 1 The diagram shown illustrates the activity verification of the recombinase system in Bacillus subtilis and the plasmid map of Dre recombinase regulated by different promoters. Figure 2 The images show gel electrophoresis diagrams of the resistance gene ble integrated into the dacA site and the knockout of the resistance gene ble, verifying the effectiveness of the recombinase system in Bacillus subtilis.

[0120] In this embodiment, based on verifying the activity of the recombinase system in Bacillus subtilis, it is further demonstrated that a gene knockout vector is constructed using the recombinase system, Bacillus subtilis is used as the host to achieve the knockout of the target gene dacA, and the resistance gene ble is deleted by expressing Dre recombinase under the regulation of a specific promoter.

[0121] Example 2 Optimization of the Dre-roxP gene recombinase system

[0122] Part 1: Optimization of RoxP Recombination Sites

[0123] Based on the wild-type rox sequence, this application provides five rox mutants with base mutations in the rox spacer region, namely rox9, rox13, rox14, rox62, and rox63. To evaluate the recombination efficiency of these mutants in the genome, the same experimental protocol as in Example 1 was used, by knocking out the resistance gene BLE and detecting the recombination efficiency between different mutants.

[0124] In this section, by transforming recombinant strains with different rox mutants and inducing the expression of Dre recombinase, we found that there were significant differences in recombination between the two roxP recombination sites in the genome after one IPTG induction.

[0125] The results are as follows Figure 3 As shown, the recombination efficiency of mutants rox9, rox13, rox14, rox62, and rox63 is improved compared with that of wild-type roxP, especially the recombination efficiency of mutants rox14, rox62, and rox63 is significantly higher than that of wild-type roxP.

[0126] Part Two: Dre Recombinase Regulation Methods

[0127] When the Dre-roxP gene recombinase system was applied to Bacillus subtilis, leakage expression was found in all four plasmids during the experiment. The leakage expression mentioned here refers to the fact that the Dre recombinase is naturally expressed in the cell and triggers recombination between two rox sites without the addition of an inducer.

[0128] To address the aforementioned issues and improve the system's strictness and control over Dre recombinase expression, this application provides a Dre recombinase regulatory system. This system includes promoters PcspD, Pspac, PspanK, and PsodA, an operator lacO, and a repressor protein lacI, which are combined with the Dre recombinase gene to express Dre recombinase in Bacillus subtilis, causing recombination at two roxP recombination sites in the genome.

[0129] Furthermore, the control system is provided with two modes to reduce or avoid leakage activity, namely Mode 1 or Mode 2:

[0130] Mode 1: Add the lacO operon and / or theophylline riboswitch before the Dre gene, amplify by PCR to obtain a linearized vector, recover it and transform it into competent E. coli cells to obtain a plasmid. This plasmid controls the expression of Dre recombinase through the lacO operon.

[0131] Mode 2: Add the lacO operon before the promoter, placing the lacO operon upstream of the promoter to control the expression of Dre recombinase.

[0132] This section uses the pMA5-PspanK-Dre plasmid as an example, such as Figure 4As shown, plasmid pMA5-PspanK-lacO-RS-Dre successfully achieved tight control over the Dre recombinase gene, minimizing system leakage activity. Furthermore, since the Dre recombinase is expressed only after the addition of the inducer IPTG, recombination efficiency is improved and unnecessary genomic recombination is reduced.

[0133] Example 3: Knockout of the ackA gene, a functional gene in Bacillus subtilis, using the Drex-roxP gene recombinase system

[0134] In this embodiment, the recombinase system constructed in this application is used. Based on the results of Example 2, the rox62 mutant is used to knock out the Bacillus subtilis gene ackA, illustrating the application of the system in bacterial genome editing.

[0135] (1) Construction of the ackA gene knockout fragment

[0136] To achieve the knockout of the target gene ackA, an ackA gene knockout fragment ackA-rox62-ble-rox62 containing the rox62 sequence was first constructed based on the gene knockout strategy described in Example 1.

[0137] (2) Construction of recombinant strains

[0138] The constructed gene knockout vector was transformed into Bacillus subtilis competent cells using the Spizizen transformation method, followed by homologous recombination. Through recombination, the ackA-rox62-ble-rox62 fragment was integrated into the target location in the Bacillus subtilis genome.

[0139] (3) Screening for recombinant strains

[0140] After transformation, recombinant strains containing the resistance gene ble were selected and cultured in a medium containing the corresponding antibiotic. Successfully integrated strains will survive the selection pressure of the ble resistance gene, yielding the recombinant strain Bs-ackA-rox62-ble-rox62.

[0141] (4) Induction of Dre recombinase expression and gene knockout

[0142] To ensure the accuracy of the knockout process, the optimized Dre recombinase regulation system in Example 2 is used, which includes the use of different promoters and control elements to strictly regulate the expression of Dre recombinase. The ackA gene in the genome is used as an example to demonstrate the editing effect of the gene editing system of the present invention on functional genes in the genome.

[0143] A Dre recombinase expression plasmid (e.g., pMA5-PspanK-lacO-RS-Dre) was introduced into the recombinant strain Bs-ackA-rox62-ble-rox62, and Dre recombinase was expressed under IPTG induction. Catalyzed by Dre recombinase, recombination occurred at two rox62 sites, thereby deleting the fragment containing the ble resistance gene from the Bacillus subtilis genome, successfully knocking out the ackA gene. This process achieved scarless gene knockout without the need for the introduction of additional exogenous genes or resistance markers.

[0144] like Figure 5 As shown, this demonstrates the process of scarless knockout of the functional gene ackA in the Bacillus subtilis genome using a recombinase system.

[0145] Example 4: Integration of exogenous gene dnaK into the Bacillus subtilis genome based on the DrexoprexP gene recombinase system

[0146] (1) Construction of exogenous gene dnaK integration fragment

[0147] To integrate the exogenous gene dnaK (SEQ ID NO:15) into the ycsE site of the Bacillus subtilis genome, an integration fragment containing ycsE, DnaK, and the neo resistance gene was constructed.

[0148] SEQ ID NO:15 is:

[0149] 1atgtctaagg taattggcat tgacttaggc acaacaaact cttgcgtcgc tgttctggaa

[0150] 61ggcggagaac ctaaagtcat cgcaaatgcg gaaggtaatc ggacgacacc tagcgttgtt

[0151] 121gcgtttaaga atggcgaacg tcaagtggga gaagtggcaa agcggcagtc tatcacgaat

[0152] 181ccgaatacaa tcatgtcaat caagaggcac atgggcacag attacaaagt ggagatcgaa

[0153] 241ggcaaagatt atacaccgca agaagtttca gcgatcattc tgcaacatct taaatcttat

[0154] 301gcagaatctt atctgggcga aacagtgtct aaggcagtta ttacagtacc tgcctacttt

[0155] 361aatgatgctg aacgtcaagc aacgaaagat gctggcaaga tcgctggtct tgaagtcgaa

[0156] 421cgtatcatca acgaacctac agcagccgct ctggcatacg gcctggataa gacggatgaa

[0157] 481gaccaaacaa tcttagtgta tgatcttggc ggcggcacat tcgatgtcag cattctggaa

[0158] 541ttaggcgatg gagtctttga agtccgtagc acggctggcg ataatcgctt gggaggcgat

[0159] 601gactttgacc aagttatcat cgatcatctt gtctctgagt ttaagaaaga gaacggcatc

[0160] 661gatctgagca aagataagat ggcacttcaa cgcctcaaag atgctgctga gaaggctaag

[0161] 721aaagaccttt caggtgtgtc atcaacgcag atcagccttc cgtttatcac agctggcgaa

[0162] 781gctggacctt tgcatctgga actgacgctt acgcgggcaa agttcgaaga actgtcaagc

[0163] 841caccttgtcg aacggacaat gggtccagtc cgtcaagcct tacaagatgc cggactgtca

[0164] 901 gcgtctgaaa tcgataaagt gatcttagtc ggaggctcaa cgcggatacc tgcagtacaa

[0165] 961gaagcaatca agaaagaaac aggcaaagaa gctcataagg gagtgaatcc ggacgaagtg

[0166] 1021gttgctctgg gcgctgcaat ccagggaggt gtcattacgg gcgatgtgaa agacgttgtg

[0167] 1081ctgcttgatg taactccgct ttctcttggc attgaaacga tgggaggcgt ctttaacaaag

[0168] 1141ctgatcgatc gcatacaac gattccgaca agcaagagcc aggtattctc tacggctgcg

[0169] 1201gataatcaaa cagctgttga cattcatgtc ttacagggcg aaaggccaat gtctgctgat

[0170] 1261aaaagacgc ttggacggtt tcaacttaca gacattccac ctgcacctcg tggagtgcct

[0171] 1321caaattgagg tgagctttga catcgataag aatggaatcg taaacgtacg cgcgaaagac

[0172] 1381ctgggtacag gcaaagaaca gaatattacc attaaatcat catccggctt aagcgatgaa

[0173] 1441gaaattgaac ggatggtcaa agaagcagaa gagaatgcag atgcagatgc taagaaaa

[0174] 1501gaagaaatcg aagtgcgtaa cgaagcggat cagctggtct ttcaaacgga aaagacgctt

[0175] 1561aaagaccttg aaggcaaagt agatgaagaa caggtgaaga aagcgaatga tgccaaagat

[0176] 1621gcactgaaag cagccattga gaagaacgag tttgaagaaa tcaaagcgaa gaaagatgaa

[0177] 1681ctgcagacaa ttgttcaaga actttcaatg aaactgtacg aagaagctgc caaagcacaa

[0178] 1741caagcacaag gcggtgctaa tgcagaaggc aaagcagatg ataatgtcgt cgatgcagag

[0179] 1801tacgaagagg ttaatgatga tcagaacaag aagtga.

[0180] The construction steps are as follows: Referring to Example 1, primers were designed to amplify 1000bp fragments upstream and downstream of the ycsE gene. The exogenous gene dnaK was obtained through gene synthesis, and specific primers were designed for PCR amplification. Both ends of the primers contained homologous sequences to the neomycin resistance gene and the ycsE site in the Bacillus subtilis genome, respectively. Specific primers were designed for PCR amplification of the neo resistance gene. Both ends of the primers contained homologous sequences to the ycsE site in the Bacillus subtilis genome and the exogenous gene dnaK, respectively, and each primer contained a rox62 sequence. The integrated fragment ycsE-rox62-neo-rox62-dnaK was constructed using overlap extension PCR technology.

[0181] (2) Construction and screening of recombinant strains

[0182] The constructed integration vector ycsE-rox62-neo-rox62-dnaK was transformed into Bacillus subtilis competent cells using the Spizizen method, and dnaK was integrated into the ycsE site through homologous recombination.

[0183] Transformed strains were screened on a culture medium containing a resistance selection agent, and recombinant strains carrying the neo resistance gene were selected. PCR verification confirmed that the dnaK gene had been successfully integrated into the target site ycsE.

[0184] (3) Induction of Dre recombinase expression and knockout of resistance genes

[0185] A plasmid containing the PspanK promoter (e.g., pMA5-PspanK-lacO-RS-Dre) was introduced into the recombinant strain, and the expression of the recombinase Dre was induced using IPTG. The Dre recombinase catalyzes recombination between the rox62 sites, resulting in the knockout of the resistance gene neo. The exogenous gene dnaK was successfully integrated into the ycsE site of the Bacillus subtilis genome, avoiding the introduction of resistance markers.

[0186] Figure 6 This study demonstrates the integration of the exogenous gene DnaK into the ycsE site of the Bacillus subtilis genome using a recombinase system. Precise integration of the exogenous gene DnaK was achieved at the ycsE site by introducing an integration fragment containing the rox62 mutant and the neo resistance gene. This process, facilitated by the Dre recombinase, ensured stable integration of the exogenous gene and avoided the introduction of new resistance genes, thus guaranteeing a seamless integration process.

[0187] The above description is only a preferred embodiment of the present invention. It should be noted that, for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A DrexP gene recombinase system, characterized in that: The roxP recombination site is either the wild-type roxP shown in SEQ ID NO:1, or a rox mutant with the nucleotide sequence shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:

6.

2. The DrexP gene recombinase system as described in claim 1, characterized in that: The roxP recombination site is a rox mutant, which has the nucleotide sequence shown in SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:

6.

3. The DrexP gene recombinase system as described in claim 1, characterized in that: The expression of the Dre recombinase gene was enhanced by using any one of the promoters PcspD, Pspac, PspanK, or PsodA.

4. The DrexP gene recombinase system as described in claim 3, characterized in that: The recombinase system expression vector is any one of pMA5-PcspD-Dre, pMA5-Pspac-Dre, pMA5-PspanK-Dre, and pMA5-PsodA-Dre.

5. The method for regulating the DrexP gene recombinase system as described in any one of claims 1-4, characterized in that: This was achieved by controlling the expression of Dre recombinase by adding a lacO operon and / or a theophylline riboswitch before the Dre gene.

6. The method for regulating the DrexP gene recombinase system as described in any one of claims 1-4, characterized in that: The expression of Dre recombinase was controlled by adding the lacO operon before the promoter.

7. The method for regulating the DrexP gene recombinase system as described in any one of claims 5 or 6, characterized in that: The expression vector for the Dre recombinase system is pMA5-PspanK-lacO-RS-Dre.

8. Genetically engineered bacteria, engineered cells, or kits comprising the DrexP recombinase system according to any one of claims 1-4.

9. The application of the DreoxP recombinase system as described in any one of claims 1-4, characterized in that... The applications include: knocking out functional genes within the Bacillus subtilis genome, and / or achieving integrated expression of exogenous genes without resistance markers at designated genomic loci in Bacillus subtilis.

Images