Construction and application of CRISPR / Cas9 gene editing system in Stropharia rugosoannulata

Abstract

A CRISPR / Cas9 gene editing vector for Stropharia rugosoannulata, the vector comprising: (1) a Cas9 protein expression cassette: driven by a Stropharia rugosoannulata endogenous glyceraldehyde-3-phosphate dehydrogenase gene promoter, a Cas9 gene sequence is optimized according to basidiomycete preferred codons, and the Cas9 gene sequence is fused with a nuclear localization signal; (2) an sgRNA expression cassette: driven by a Stropharia rugosoannulata endogenous U6 snRNA promoter; (3) a screening marker expression cassette: an antibiotic resistance gene driven by a constitutive promoter. The application is the first reported Stropharia rugosoannulata CRISPR / Cas9 gene editing system in the world, which breaks through the bottleneck of genetic manipulation of the species.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to a CRISPR / Cas9 gene editing system for Stropharia rugosoannulata and its construction and application. Background Technology

[0002] *Stropharia rugosoannulata* is a nutritious and medicinal fungus with significant medicinal value. More uniquely, it possesses powerful ecological functions, capable of directly decomposing agricultural and forestry waste (such as straw) without composting or high-temperature sterilization, making it a highly efficient "microbial cell factory." However, current genetic improvement of *Stropharia rugosoannulata* mainly relies on traditional hybridization breeding, which is time-consuming, labor-intensive, and lacks precision. The lack of precise genetic manipulation tools severely limits the optimization of its metabolic pathways (such as the expression of lignocellulose-degrading enzymes) and the molecular breeding of superior strains. CRISPR / Cas9 technology has been successfully applied in various fungi, but a mature system has not yet been established for *Stropharia rugosoannulata*. The main difficulties lie in the lack of effective endogenous promoters to drive the efficient expression of Cas9 and sgRNA, and the lack of a stable transformation and screening system. *Stropharia rugosoannulata* belongs to the order Agaricales and is mostly a heterokine binucleate (n+n) fungus in its natural or cultivated state. When gene editing is performed at the binucleosome level, the CRISPR / Cas9 system may only cut and modify the target site in one of the cell nuclei, which can easily produce heterozygous mutants. This causes the recessive mutant phenotype of the target gene to be masked by the unedited wild-type cell nucleus, which seriously hinders the phenotypic screening and functional verification of mutants. Summary of the Invention

[0003] The purpose of this invention is to provide the construction and application of a CRISPR / Cas9 gene editing system for *Agaricus macrocarpa*.

[0004] To achieve the above and other related objectives, the technical solution provided by this invention is: a CRISPR / Cas9 gene editing vector for *Agaricus bisporus*, wherein the vector comprises:

[0005] (1) Cas9 protein expression cassette: driven by the promoter of the endogenous glyceraldehyde-3-phosphate dehydrogenase gene of Pleurotus ostreatus, the Cas9 gene sequence was optimized according to the codons preferred by basidiomycetes, and the Cas9 gene sequence was fused with a nuclear localization signal;

[0006] (2) sgRNA expression cassette: driven by the endogenous U6 snRNA promoter of Pleurotus ostreatus;

[0007] (3) Selection marker expression cassette: antibiotic resistance gene driven by a constitutive promoter.

[0008] The preferred technical solution is that the endogenous U6 snRNA promoter of *Agaricus bisporus* not only contains a transcription start site, but also contains typical "TATA" box structural elements.

[0009] A preferred technical solution is that the sgRNA expression cassette adopts a tRNA-sgRNA tandem structure.

[0010] A preferred technical solution is that the tRNA-sgRNA tandem structure contains two or more tandem sgRNA expression units, which are used to simultaneously edit multiple sites of a single target gene or multiple different target genes.

[0011] To achieve the above and other related objectives, the technical solution provided by this invention is: a method for genome editing of *Agaricus bisporus*, comprising the following steps:

[0012] (1) Construct the CRISPR / Cas9 gene editing vector according to any one of claims 1-4, and design a specific sgRNA sequence targeting the target gene;

[0013] (2) Transform the constructed vector into Agrobacterium;

[0014] (3) Prepare a suspension of monokaryotic mycelia of Pleurotus ostreatus and co-culture it with Agrobacterium containing a carrier for transformation;

[0015] (4) Gene-edited mutant strains were obtained by primary screening with a culture medium containing antibiotics and secondary screening for the target gene mutation phenotype. The primary screening specifically involved washing the co-cultured hyphae with sterile water containing 600 mg / L cefotaxime sodium (Cef) and inoculating them on a selective medium containing 60 µg / mL hygromycin (Hyg) and 600 µg / mL Cef for 7-10 days. The secondary screening specifically involved transferring the transformants obtained from the primary screening to a medium containing 0.2 mg / mL 5-fluoroorotic acid (5-FOA) and culturing them for 7 days.

[0016] The preferred technical solution is that, in step 3, the co-cultivation transformation specifically includes the following processing steps:

[0017] (1) Mycelial preparation and pre-induction: The monokaryotic strain of Pleurotus ostreatus was cultured in PDB liquid medium at 25℃ and 150 rpm until the diameter of the mycelial balls was 2-4 mm. Then, it was homogenized and crushed for 5 seconds, washed, and added to the induction medium containing 0.2% acetylsuccinone. It was then pre-induced by standing in the dark at 25℃ for 3-6 hours.

[0018] (2) Agrobacterium pre-induction: Agrobacterium containing the vector is cultured to OD. 600The concentration was 0.5–0.8. After washing, the solution was resuspended in the induction medium and pre-induced statically for 3–6 hours at 28°C in the dark.

[0019] (3) Co-culture: The pre-induced mycelial suspension was mixed with the Agrobacterium suspension and co-cultured at 25°C in the dark for 96 hours.

[0020] The preferred technical solution is that the screening system is as follows:

[0021] Initial screening: PDA medium containing 60 mg / L hygromycin and 600 mg / L cefotaxime sodium was used;

[0022] Secondary screening: PDAU medium containing 0.2 mg / mL 5-fluoroorotic acid was used.

[0023] To achieve the above and other related objectives, the technical solution provided by this invention is: the application of the gene editing system in the improvement of Pleurotus ostreatus strains, metabolic engineering modification, and optimization of straw degradation performance.

[0024] Due to the application of the above technical solution, the advantages of this invention compared with the prior art are:

[0025] 1. Originality: This invention is the first reported CRISPR / Cas9 gene editing system for Pleurotus ostreatus in the world, breaking through the genetic manipulation bottleneck of this species.

[0026] 2. High efficiency: By mining the specific endogenous promoter SrU6-3 and introducing the tRNA processing mechanism, gene knockout was successfully achieved, with an editing efficiency of 14.9%.

[0027] 3. Precise Creation of Homozygous Mutants: Addressing the challenge of the complex genetic background of *Stropharia macrocarpa* binukiformis, this invention prioritizes *Stropharia macrocarpa* monokaryotic mycelia (such as monokaryotic strain Y27) as the recipient material for Agrobacterium-mediated transformation. By editing the genes of the monokaryotes, edited strains with homozygous mutations of the target genes can be directly obtained, completely eliminating the masking interference of the other wild-type cell nucleus on the mutant phenotype in a binukiform (n+n) background. The obtained homozygous monokaryotic mutants can be further hybridized with compatible wild-type or other edited monokaryotes, thus providing reliable intermediate parents for creating binukiform cultivars with clear genetic backgrounds and superior traits.

[0028] 4. Broad application prospects: This system can be used to create gene-edited strains without selection markers, laying the foundation for cultivating new varieties of giant king mushrooms with stronger straw degradation capabilities and higher nutritional value. Attached Figure Description

[0029] Figure 1A schematic diagram of sequence alignment analysis of the U6 promoter of *Agaricus macrocarpa*.

[0030] Figure 2 A schematic diagram of the construction of the CRISPR / Cas9 gene editing vector for *Agaricus macrocarpa*. Detailed Implementation

[0031] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in these embodiments.

[0032] Please see Figure 1 - It should be noted that the structures, proportions, sizes, etc., illustrated in the accompanying drawings of this specification are only for illustrative purposes and to aid those skilled in the art in understanding and reading the content disclosed herein. They are not intended to limit the implementation conditions of the invention and therefore have no substantial technical significance. Any modifications to the structure, changes in proportions, or adjustments to the size are not technically significant. The following embodiments are provided to better understand the invention, but are not intended to limit it. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.

[0033] Unless otherwise specified, all reagents or materials described in the following examples are commercially available.

[0034] Example 1: Cloning and Analysis of Endogenous Promoters

[0035] Using the U6 sequences of humans, *A. nidulans*, and *G. lucidum* as references, three candidate genes were identified in the *S. spp.* genome through BLAST alignment. Sequence analysis showed that the SrU6-3 promoter region contains a conserved Run6-1 domain and a TATA box (…). Figure 1 The sgRNA was selected as the driver promoter. Simultaneously, the 2000bp upstream sequence of the ATG in the Srgpd gene was selected as the promoter for Cas9.

[0036] Example 2: Construction of the gene editing vector GPiE-SrU6

[0037] Cas9 module: Synthesizes a codon-optimized Cas9 gene, which is linked downstream of the Srgpd promoter and contains two nuclear localization signals (NLS).

[0038] sgRNA module: Designed target sequences for the marker gene ura3. Constructed a SrU6-3 promoter-driven tRNA-sgRNA tandem expression cassette to generate precise sgRNAs using endogenous tRNA splicing mechanisms.

[0039] Vector assembly: The above modules and HygR resistance module were assembled into the backbone vector to form the GPiE-SrU6 plasmid ( Figure 2 ).

[0040] Example 3: Agrobacterium-mediated transformation (ATMT)

[0041] Preparation of recipient monokaryotic hyphae: The identified *Agaricus bisporus* monokaryotic strain Y27 was selected and inoculated into PDB medium with shaking culture for 6 days. Since each monokaryotic cell contains only one nucleus, it can serve as an ideal gene editing recipient. The cultured monokaryotic hyphal balls were collected and homogenized using a homogenizer to prepare a monokaryotic hyphal suspension for later use.

[0042] Agrobacterium infection: The constructed plasmid was transformed into Agrobacterium GV3101. The Agrobacterium suspension was mixed with Pleurotus ostreatus mycelium in IM induction medium and co-cultured in the dark at 25°C for 96 hours.

[0043] Screening: After co-culture, the mycelia were washed with sterile water containing 600 mg / L Cef. They were then inoculated onto PDA plates containing 600 mg / L Cef and 60 mg / L Hyg for initial screening.

[0044] Example 4: Identification and Efficiency Analysis of Mutants

[0045] Double screening: Transformants grown from the initial screening were transferred to a medium containing 0.2 mg / mL 5-FOA for secondary screening. Deletion of the ura3 gene leads to resistance to 5-FOA in the strain.

[0046] Molecular identification: DNA was extracted from the resistant strain, the ura3 gene fragment was amplified by PCR, and Sanger sequencing was performed. The results showed that a base insertion (such as insertion of "T", "A", or "TG") occurred at the target site, resulting in a frameshift mutation. In particular, since the transformation recipient was the monokaryotic strain Y27, no heterozygous double peaks were observed in the sequencing peaks after the mutation site, proving that all the obtained transformants were homozygous mutants, effectively avoiding the chimeric or heterozygous states commonly found in binucleosome editing.

[0047] Efficiency statistics: 13 mutant strains were obtained from 87 transformants, with an editing efficiency of 14.9%.

[0048] Stropharia rugosoannulata U6-1 promoter:

[0049] Aatattctgacccgctcaggagcccagcagagttggtatacgactcagtggttatggattctgtgcgagatgattaggtgcacagagctatcggaacctctggttaggtatccttaccagctcacgttgatccattacgtcttgcttcgcctttatgtgtccggtggtatcatattttggttggttatatcctggtgattgtgtatcctggctctcgcggtttgttcttctccgcaaaatgtattccgctacctgtagtcgagccttcaatcgttcaaaaaaatacataggaaacctactttgtagctgtcgttgacgcagtggcgcggaaacggctaacccagtcaaccgaacaaaatgcagaactcgttccatgtcgtacgtaataggatagttacctttgtccccttcggggtgacatacgaaaaaattggaacgatacagagaagattagcatggcccctgcacaaggatgacacgctttcccggagtggtagacctacgggtctcaatatttatttt。

[0050] Stropharia rugosoannulata U6-2 promoter:

[0051] Cggaaaggcgaaagtagacggttatgttcctcaatctcgcgctcaaggacgtcgcgctccttcacaagcttgcctagaatgtcctcaatgtccgcaatcttgctgttcatccgctcgagtttctgggttggctcgacgaggagacccttgatgtgttccctgtcgagcgcgctggggacatggttagtacatagctctcctacaaacggcgagtcaagggcagactggggctgcataagtaggcttatcgacgacacatggatgcactcaccatgctgcgtggtgtgcaagagcaagcagcgccaaaggcagcgtcgtagttgttagtggctgtgcaacccagcgagctgaacaaaatgcaaaagtcagttcatgtgtacacttgtttggcattaccttatgtccccttcggggtgacatacgaaaaattggaacgatacagagaagattagcatggcccctgcacaaggatgacacgctttcccggagtggtagacctacgggtctcaatatttatttt。

[0052] Stropharia rugosoannulata U6-3 promoter:

[0053] Aagtaagtcctcccaccgattcgtgttccgctcttgaattcgaggcaatcatagaatcgaggaagcaaaagtcgacccagatccagaggcggcagccgtttgcgcattaccgaactctacttgacgtctatggcaaaggcagcccctctgcatttcggccctggcagaggccaggattagaagaataaataatgttagccacatgggtttcgggtagacatttagttgataggaatggacgacgtggaaagcatctgaaagcattgacaagattgagggaaggaagaaacgtcagcgagttgaagggagcgtcggtactagtgatgactaagcaacccagtcggctgaacaaaaatgcaaaaacttggtctataggcagcatctcggacaaatacctttgtccccttcggggtgacatacgaaaaaattggaacgatacagagaagattagcatggcccctgcacaaggatgacacgctttcccggaggtggtagacacctacgggtctcaatatttattt.

[0054] Stropharia rugosoannulata glyceraldehyde-3-phosphate dehydrogenase gene promoter (Srgpd promoter):

[0055]

[0056] Cas9 sequence:

[0057]

[0058] sgRNA sequence:

[0059] gtttcagagctatgctggaaacagcatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc.

[0060] The above description is merely a preferred embodiment for explaining the present invention and is not intended to limit the present invention in any way. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included within the scope of protection intended by the present invention.

Claims

1. A CRISPR / Cas9 gene editing vector for *Agaricus bisporus*, characterized in that, The carrier comprises: (1) Cas9 protein expression cassette: driven by the promoter of the endogenous glyceraldehyde-3-phosphate dehydrogenase gene of Pleurotus ostreatus, the Cas9 gene sequence was optimized according to the codons preferred by basidiomycetes, and the Cas9 gene sequence was fused with a nuclear localization signal; (2) sgRNA expression cassette: driven by the endogenous U6 snRNA promoter of Pleurotus ostreatus; (3) Selection marker expression cassette: antibiotic resistance gene driven by a constitutive promoter.

2. The CRISPR / Cas9 gene editing vector for *Agaricus macrocarpa* according to claim 1, characterized in that, The endogenous U6 snRNA promoter of *Pleurotus ostreatus* not only contains a transcription start site, but also includes typical "TATA" box structural elements.

3. The CRISPR / Cas9 gene editing vector for *Agaricus macrocarpa* according to claim 1, characterized in that, The sgRNA expression cassette uses a tRNA-sgRNA tandem structure.

4. The CRISPR / Cas9 gene editing vector for *Agaricus macrocarpa* according to claim 3, characterized in that, The tRNA-sgRNA tandem structure contains two or more tandem sgRNA expression units, which are used to simultaneously edit multiple sites of a single target gene or multiple different target genes.

5. A method for genome editing of *Agaricus bisporus*, characterized in that, Includes the following steps: (1) Construct the CRISPR / Cas9 gene editing vector according to any one of claims 1-4, and design a specific sgRNA sequence targeting the target gene; (2) Transform the constructed vector into Agrobacterium; (3) Prepare a suspension of monokaryotic mycelia of Pleurotus ostreatus and co-culture it with Agrobacterium containing a carrier for transformation; (4) Gene-edited mutant strains were obtained by primary screening with a culture medium containing antibiotics and secondary screening for the target gene mutation phenotype. The primary screening specifically involved washing the co-cultured hyphae with sterile water containing 600 mg / L cefotaxime sodium (Cef) and inoculating them on a selective medium containing 60 µg / mL hygromycin (Hyg) and 600 µg / mL Cef for 7-10 days. The secondary screening specifically involved transferring the transformants obtained from the primary screening to a medium containing 0.2 mg / mL 5-fluoroorotic acid (5-FOA) and culturing them for 7 days.

6. The method for editing the genome of *Agaricus macrocarpa* according to claim 5, characterized in that, Step 3, the co-cultivation transformation specifically includes the following processes: (1) Mycelial preparation and pre-induction: The monokaryotic strain of Pleurotus ostreatus was cultured in PDB liquid medium at 25℃ and 150 rpm until the diameter of the mycelial balls was 2-4 mm. Then, it was homogenized and crushed for 5 seconds, washed, and added to the induction medium containing 0.2% acetylsuccinone. It was then pre-induced in the dark at 25℃ for 3-6 hours. (2) Agrobacterium pre-induction: Agrobacterium containing the vector is cultured to OD. 600 The concentration was 0.5–0.

8. After washing, the solution was resuspended in the induction medium and pre-induced statically for 3–6 hours at 28°C in the dark. (3) Co-culture: The pre-induced mycelial suspension was mixed with the Agrobacterium suspension and co-cultured at 25°C in the dark for 96 hours.

7. The method for editing the genome of *Agaricus macrocarpa* according to claim 5, characterized in that, The screening system is as follows: Initial screening: PDA medium containing 60 mg / L hygromycin and 600 mg / L cefotaxime sodium was used; Secondary screening: PDAU medium containing 0.2 mg / mL 5-fluoroorotic acid was used.

8. The application of the gene editing system described in claim 1 in the improvement of Pleurotus ostreatus strains, metabolic engineering modification, and optimization of straw degradation performance.

Images