Reducing method of aureobasidium pullulans dna and application thereof

Abstract

The present application relates to the technical field of genetic engineering, and discloses a DNA deletion method for Saccharopolyspora erythraea and application. The present application provides a CRISPR / Cas editing library design strategy, which can design a library with an upper limit of library capacity to densely cover the genome, and simultaneously target genes and intergenic regions. The strategy can be compatible with all different types of CRISPR / Cas tools, and can configure parameters such as interval division, sequence interval and off-target judgment according to needs to obtain more efficient target points. In addition, the strategy can also expand the design of guide RNA libraries with multiple target points in series. The present application uses a CRISPR / Cas combined with an endogenous non-homologous end joining system to perform DNA deletion on Saccharopolyspora erythraea, and the plasmid construction is simpler, and the operation time of one round is within 1 month, which greatly reduces the workload and time length of DNA deletion of Saccharopolyspora erythraea. The present application provides an efficient tool for gene editing of Saccharopolyspora erythraea, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically, to a method and application of DNA deletion in *Saccharomyces rubrum*. Background Technology

[0002] The traditional technique commonly used for DNA deletion is homologous recombination. This involves introducing homologous arms as templates and utilizing natural, low-probability DNA damage repair mechanisms to delete bases between homologous arms, thus achieving DNA deletion. In recent years, the rapidly developing CRISPR / Cas tools can generate targeted DNA damage at high frequency. Combining CRISPR / Cas tools with homologous recombination strategies can shorten the operation cycle, making it an emerging technique.

[0003] CRISPR / Cas editing libraries are auxiliary tools for CRISPR / Cas editing. They are constructed by synthesizing a series of guide RNAs targeting different sites, allowing for the generation of numerous edits targeting different sites in a single operation. Common CRISPR / Cas editing libraries are mainly categorized into three types based on their effects: knockout, repression, and activation. They typically target gene coding sequences, generating a large number of clones with different phenotypes through batch gene editing, thereby achieving purposes such as screening functional genes, activating silenced genes, or studying essential genes.

[0004] Homologous recombination is currently very difficult to perform in *Saccharopolysporum rubrum*. Firstly, *Saccharopolysporum rubrum* has a long growth cycle, and naturally occurring low-frequency DNA damage requires multiple passages to trigger homologous recombination, significantly increasing the operation cycle compared to other strains, typically requiring 3 months to complete one round of operations. Secondly, *Saccharopolysporum rubrum* is a Gram-positive bacterium with high G+C DNA content; homologous arms required for homologous recombination generally need to be above 3kb and have high G+C content, making it very difficult to obtain homologous arms and construct editing plasmids. Finally, the target strain obtained through homologous recombination only has a single deletion length at the target site, making it impossible to generate multiple deletion lengths in a single operation to obtain richer variations, resulting in a low return on investment. Even using CRISPR / Cas tools, the operation cycle can only be shortened to 2 months. Furthermore, using CRISPR / Cas tools requires additional construction of the target DNA sequence, increasing the workload of plasmid construction. Loading CRISPR / Cas tools and homologous arms onto the same plasmid increases the plasmid size to about 15kb, and CRISPR / Cas tools are also somewhat toxic to cells, increasing the difficulty of operation.

[0005] In recent years, it has been recognized that intergenic regions also have a significant impact on cellular physiological functions. However, due to the complexity of intergenic regions and the lack of a solid foundation and clear objectives in related research, our understanding of these regions is currently limited, and many unknown functions remain hidden within them. This is especially true for actinomycetes such as *Saccharomyces rubrum* and *Streptomyces*, which have highly complex genomes and life cycles, where intergenic regions often perform unexpected functions. Previous CRISPR / Cas editing libraries typically targeted gene coding sequences, neglecting intergenic regions, thus limiting the potential of the resulting mutant clones.

[0006] Existing guide RNA library design websites, such as CHOPCHOP (Reference 1), GuideScan2 (Reference 2), and CRISPR-SURF (Reference 3), mainly suffer from the following problems: they are designed for model organisms such as animals, plants, and yeast, and are not compatible with efficient gene editing tools in actinomycetes, such as CRISPR / Cas12f (Reference 4); they only consider or focus on coding regions of the genome, and do not adequately consider non-coding regions; and they cannot customize the spacing between tandem guide RNAs to control the range of dual-target cleavage lengths. Code-based guide RNA library design tools, such as crisprDesign (Reference 5), sgTiler (Reference 6), and snakemake-crispr-guides (https: / / github.com / MPUSP / snakemake-crispr-guides.), typically have some customizable input parameters and are more flexible, but they also suffer from poor compatibility with actinomycete genome data and corresponding CRISPR tools, and rigid encapsulation of region partitioning and screening logic. Summary of the Invention

[0007] The purpose of this invention is to provide a method and application for DNA deletion of *Saccharomyces rubrum*.

[0008] Another object of the present invention is to provide a method for designing guide RNA sequences for constructing actinomycete DNA deletion libraries, and a method for screening high-yielding strains of red saccharopolysporum using the constructed DNA deletion libraries.

[0009] To achieve the objectives of this invention, in a first aspect, this invention provides a method for DNA deletion (gene deletion) of *Saccharomyces rubrum*, comprising the following steps: (1) A free plasmid containing a CRISPR / Cas system expression element and at least one guide RNA expression element was introduced into *Saccharomyces rubrum*. Saccharopolyspora erythraea The guide RNA targets one or more predetermined sites on the genome of the red saccharopolysporum. (2) Express the CRISPR / Cas system and the guide RNA in the red sugar polysporum to generate DNA breaks at one or more predetermined sites; (3) The DNA break is repaired by using the endogenous non-homologous end ligation repair mechanism of the red sugar polysporum, thereby generating a deletion of DNA fragments at or near the preset site, and the method does not require the provision of an exogenous homologous recombination repair template.

[0010] Furthermore, the free plasmid contains two or more guide RNA expression elements in tandem, which target different preset sites on the actinomycete genome, thereby achieving the deletion of DNA fragments between the different preset sites.

[0011] Furthermore, the preset site is located in the gene coding region and / or intergenic region.

[0012] Preferably, the CRISPR / Cas system is a CRISPR / Cas12f system or a CRISPR / Cpf1 system.

[0013] Secondly, the present invention provides a method for designing guide RNA sequences for constructing actinomycete DNA deletion libraries (DNA deletion mutant libraries), comprising the following steps: 1) Identify all candidate guide RNA sequences across the entire actinomycete genome based on the PAM sequence obtained using the selected CRISPR / Cas tool; 2) The candidate guide RNA sequences are screened to remove repetitive sequences and sequences with off-target risk selected according to a preset off-target determination algorithm, so as to obtain a high-quality guide RNA sequence library. 3) Divide the entire genome of the actinomycete into a predetermined number of intervals; 4) From the high-quality guide RNA sequence library, at least one guide RNA sequence is selected for each or part of the interval according to preset rules to form the DNA deletion library that densely covers the genome.

[0014] Furthermore, the criteria for screening the candidate guide RNA sequences in step 2) include: at least one different base in the first 5 bases of the PAM sequence, at least two different bases in the first 10 bases, and at least four different bases in the first 15 bases.

[0015] Furthermore, the preset rules are configurable, including configuring the interval division strategy, the minimum interval between sequences, the rigor of off-target judgment, and the number of guide RNAs selected for each interval.

[0016] Further, in step 4), two guide RNA sequences located at the beginning and end of each interval are selected as a group to construct a tandem dual-target library.

[0017] Preferably, the interval between the two guide RNA sequences is greater than or equal to 50 bp.

[0018] Further, in step 4), a guide RNA sequence is selected for each interval to construct a single-target library.

[0019] Preferably, the distance between the guide RNA sequence and the interval boundary is not less than the length of the guide RNA.

[0020] Furthermore, the method also supports the extended design of guide RNAs with multiple targets in tandem, to simultaneously target two or more sites on the genome in a single guide RNA molecule.

[0021] The actinomycetes can be selected from *Saccharomyces rubrum* (…). Saccharopolyspora erythraea Streptomyces azureus ( ), Streptomyces coelicolor Streptomyces venezulatus ( Streptomyces venezuelae Thirdly, the present invention provides an application of the method, in which the guide RNA sequence designed by the method is used in the above-mentioned DNA deletion method to construct a red sucrose polysporum DNA deletion library.

[0022] Fourthly, the present invention provides a method for screening high-yielding strains of *Saccharomyces rubrum*, comprising the following steps: a) using the application to obtain a group of *Saccharomyces rubrum* mutant strains with different DNA deletions; b) culturing the mutant strains and determining the yield of the target product (such as erythromycin), and screening out mutant strains with higher yields than the starting strain.

[0023] Fifthly, the present invention provides a CRISPR / Cas editing library design system, comprising: ① Input module, used to receive configuration parameters such as genome sequence file, interval partitioning strategy, CRISPR tool type, off-target screening rigor, minimum interval between sequences, and maximum library capacity; ② Target region generation module, used to divide the whole genome into multiple target regions according to the interval division strategy; ③The guide RNA recognition module is used to identify candidate guide RNA sequences across the entire genome based on the PAM sequence corresponding to the configured CRISPR tool type, including all sequences targeting the sense and antisense strands; ④ Off-target screening module, used to screen out ideal guide RNA sequences (high-quality guide RNA sequences) that are not prone to off-target effects from the candidate guide RNA sequences according to the configured off-target screening rigor. ⑤ Library output module, used to select the sequence set that will eventually form the guide RNA library from the ideal guide RNA sequence according to the configured minimum interval between sequences and maximum library capacity.

[0024] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: This invention employs a CRISPR / Cas combined with an endogenous non-homologous end ligation system to perform DNA deletion on *Saccharopolysporum rubrum*, making plasmid construction simpler and reducing the operation time to less than one month per round, thus significantly reducing the workload and time required for DNA deletion on *Saccharopolysporum rubrum*.

[0025] This invention provides a CRISPR / Cas editing library design strategy that allows for the design of libraries that densely cover the genome while simultaneously targeting genes and intergenic regions. It is also compatible with all different types of CRISPR / Cas tools. Parameters such as region partitioning, sequence spacing, and off-target detection can be configured as needed to obtain more efficient targets. Furthermore, it can be extended to design guide RNA libraries that tandemly target multiple targets.

[0026] This invention provides an efficient tool for gene editing of *Saccharomyces rubrum*, and has broad application prospects. Attached Figure Description

[0027] Figure 1 This is a schematic diagram of the operation of targeting the exogenous fluorescent protein encoding gene in Example 1 of the present invention.

[0028] Figure 2 This refers to the monoclonal antibody that exhibits a lack of fluorescence signal after the introduction of the CRISPR / Cas tool in Example 1 of this invention.

[0029] Figure 3 This is a schematic diagram of the sequencing verification results of the strain that targeted the fluorescent protein encoding gene in Example 1 of the present invention.

[0030] Figure 4 This is a schematic diagram of the operation of targeting the endogenous aflatoxin synthesis gene cluster in Example 2 of the present invention.

[0031] Figure 5 This refers to the difference between the strain with the deleted aflatoxin synthesis gene cluster and the starting strain in shake-flask fermentation in Example 2 of the present invention.

[0032] Figure 6 The configurable parameters for the five modules designed for the Chinese library in Embodiment 3 of this invention.

[0033] Figure 7 This is a diagram showing the output result of step 1 in embodiment 4 of the present invention.

[0034] Figure 8 This is a diagram showing the output result of step 2 in Embodiment 4 of the present invention.

[0035] Figure 9 This is a diagram showing the output result of step 3 in embodiment 4 of the present invention.

[0036] Figure 10 This is a diagram showing the output result of step 4 in Embodiment 4 of the present invention.

[0037] Figure 11 This is a statistical chart of the processing results in Embodiment 4 of the present invention.

[0038] Figure 12 This is a statistical chart showing the library design results in representative actinomycetes using commonly used CRISPR tools in Examples 3-6 of the present invention.

[0039] Figure 13 This is a graph showing the yield of a high-yield erythromycin strain obtained using large fragment deletion technology in Example 7 of this invention.

[0040] Figures 14-24 This is a compatibility program involved in a preferred embodiment of the present invention. Detailed Implementation

[0041] This invention aims to provide an efficient DNA deletion strategy for *Saccharopolysporum rubrum*, namely, a CRISPR / Cas-based DNA deletion strategy for *Saccharopolysporum rubrum* based on non-homologous end linkage.

[0042] The present invention adopts the following technical solution: This invention introduces a free plasmid containing a CRISPR / Cas tool and a guide RNA sequence targeting DNA into *Saccharomyces rubrum*. The DNA site-directed breakage generated by CRISPR / Cas triggers a non-terminal homologous ligation repair mechanism, resulting in DNA fragment deletion.

[0043] Subsequently, candidate sequences are identified across the entire genome based on PAM sequences (e.g., TT[ACG] for Cpf1 commonly used in actinomycetes, and [TC]TTG for Cas12f). After deduplication using a predefined algorithm (which can have strict criteria: at least one different sequence in the first 5 bases, at least two different sequences in the first 10 bases, and at least four different sequences in the first 15 bases; or, more leniently, sequences that are not completely identical, depending on the experimental objective), unique guide RNA sequences are obtained. Further, sequences prone to off-target effects on the genome are eliminated based on the recognition characteristics of CRISPR / Cas tools, resulting in the ideal guide RNA sequence. Based on the expected maximum library capacity, the genome is divided into multiple regions (typically up to 12,000 regions, meeting the most cost-effective library construction scheme). One sequence can be selected from each region, ensuring the sequence's distance from the boundary (e.g., setting the starting distance to be greater than or equal to the guide RNA length to ensure it does not exceed the boundary). Alternatively, one sequence can be selected from the beginning and end of each region as a group, ensuring the distance from the boundary (set to the guide RNA length) and the spacing between sequences (greater than or equal to 50 bp). This divides the entire genome into multiple regions, each with two targets that may act alone or simultaneously, potentially generating diverse mutations that densely cover the entire genome.

[0044] The core of this invention lies in: 1. DNA targeting of *Saccharomyces rubrum* using CRISPR / Cas tools; 2. Use a non-homologous end-ligation system derived from *Saccharomyces rubrum*; 3. The CRISPR / Cas system used can tandem guide RNAs for multiple target sites; 4. It can generate DNA deletions of random length within a certain range, and does not require the design of homologous arms; 5. Libraries with dense genome coverage can be designed based on the library capacity limit; 6. The interval division, sequence interval, and off-target judgment can be configured according to requirements; 7. Configurable and compatible with different types of CRISPR / Cas tools; 8. Expandable design of guide RNAs targeting multiple targets; 9. The library simultaneously targets both genes and intergenic regions; 10. All sequences in the library have undergone off-target detection.

[0045] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0046] The red saccharopolyspora used in the following examples is strain NRRL 2338 (this red saccharopolyspora can be found in the literature Oliyayk, M., Samborskyy, M., Lester, JB, et al. (2007). Complete genome sequence of the erythromycin-producing bacterium Saccharopolyspora erythraea NRRL 2338). Nature Biotechnology , 25(4), 447-453), Streptomyces coelicolor strain M145 (this Streptomyces coelicolor strain can be found in Bentley, SD, Chater, KF, Cerdeño-Tárraga, A.-M., et al. (2002). Complete genome sequence of the model actinomycete Streptomycescoelicolor A3(2). Nature , 417(6885), 141-147), Streptomyces venezuelae strain ATCC 10712 (for this Streptomyces venezuelae strain, see Chandra, G., et al. (2018). Complete genome sequence of Streptomyces venezuelae ATCC 10712. Microbiology Resource Announcements , 7(22), e01337-18). All of the above strains were provided by Professor Wang Weishan's research group at the Institute of Microbiology, Chinese Academy of Sciences.

[0047] The primers used in the following examples are as follows (5′-3′): Primer 1: gctcatgatcgctttacgtt Primer 2: gacctgcgatgcaggttgtg Primer 3: aattgcccgctacccggaccacatgaa Primer 4: ctagttcatgtggtccgggtagcgggc Primer 5: atgcggaagggcgaggagct Primer 6: tcacttgtacagctcgtcca Primer 7: aatttctactgttgtagatctgccgctgaacaactacgcggaaatttctactattgtagatcaccggctacgagaagatcatgga Primer 8: ctagtccatgatcttctcgtagccggtgatctacaatagtagaaatttccgcgtagttgttcagcggcagatctacaacagtaga Primer 9: cacggacaagcgctatggtg Primer 10: gagcaataatatacagaca The culture medium used is as follows: LB medium (Luria-Bertani liquid medium):

[0048] Adjust the pH to 7.2 and sterilize at 121 °C for 20 min.

[0049] ISP4 medium:

[0050] Sterilize at 121 ℃ for 20 min.

[0051] TSB medium:

[0052] Adjust the pH to 7.3, add 2% agar powder to the solid (TSA), and sterilize at 115 ℃ for 30 min.

[0053] Fermentation medium:

[0054] Adjust the pH to 7.3 and sterilize at 115 °C for 30 min. Add 1% n-propanol to the fermentation medium after sterilization.

[0055] Example 1: Deletion of exogenous fluorescent protein encoding gene at a single targeted site First, the GFP-encoding gene (NCBI ID OP566393.1) was double-digested with NdeI and MfeI on the universally used integrative plasmid pSOK616 (see reference 7, provided by Professor Wang Weishan's research group at the Institute of Microbiology, Chinese Academy of Sciences) and ligated into a vector to obtain the recombinant vector pME1-gfp. pME1-gfp was then introduced into *Saccharopolysporum rubrum*, and its integration into the *Saccharopolysporum rubrum* genome was verified using primers 1 and 2.

[0056] Secondly, a CRISPR / Cas tool, pME2-Cas-cr, was constructed to target the DNA of exogenous fluorescent protein-encoding genes. gfp The free plasmid pKCCpf1, a common plasmid for actinomycetes carrying the CRISPR / Cpf1 encoding gene (see reference 8, provided by Professor Wang Weishan's research group at the Institute of Microbiology, Chinese Academy of Sciences), was digested with SpeI and MfeI to insert crRNA targeting the DNA encoding the exogenous fluorescent protein. The crRNA was obtained by annealing with primers 3 and 4. The pME2-Cas-cr... gfp The gene for a constitutively expressed fluorescent protein was introduced into *Glycopolysporum rubrum*, a species of red saccharidobacterium whose genome was integrated into its genome. Figure 1 After expansion culture, single clones were selected and cultured in 250mL shake flasks containing 50mL TSB medium at 30℃ and 220rpm for 24 hours. Then, they were transferred to 250mL shake flasks containing 50mL fermentation medium and fermented at 30℃ and 220rpm for 7 days. Fluorescence signal measurement revealed mutant strains with no fluorescence signal. Sequencing using primers 5 and 6 confirmed that the DNA sequence of the fluorescent protein gene region had been deleted to varying degrees. Figure 2 , Figure 3 ).

[0057] Example 2: Targeted two-site deletion of endogenous aflatoxin synthesis gene clusters using tandem guide RNA The red sugar polyspora contains an endogenous gene cluster encoding the red secondary metabolite aflatoxin (NCBI IDs: SACE_RS05970~SACE_RS06165). A CRISPR / Cas tool targeting the first and last sites of the aflatoxin synthesis gene cluster DNA was constructed by tandemly connecting two guide RNAs. Figure 4 The plasmid pKCCpf1 (see reference 8, provided by Professor Wang Weishan's research group at the Institute of Microbiology, Chinese Academy of Sciences) was double-digested with SpeI and MfeI to insert a tandem sequence of crRNA targeting the aflatoxin synthesis gene cluster. The tandem sequences of crRNA1 and crRNA2 were annealed with primers 7 and 8 to obtain pME2-rib. The CRISPR / Cas tool pME2-rib targeting the aflatoxin synthesis gene cluster was introduced into *Saccharomyces rubrum*. After expansion culture, mutant clones that did not produce aflatoxin appeared. Sequencing verification confirmed that the DNA sequence of the aflatoxin synthesis gene cluster region of the mutant clone was deleted to varying degrees. After three generations of plate passage, the mutant strain was expanded cultured in 250 mL shake flasks containing 50 mL TSB medium at 30°C and 220 rpm for 24 h, and then transferred to 250 mL shake flasks containing 50 mL fermentation medium at 30°C and 220 rpm for 7 days. A stable color difference was observed between the mutant strain and the original strain. Figure 5 ).

[0058] Example 3: Design of a single-target library against CRISPR / Cas12f in *Saccharomyces rubrum* This program, written in Python, is designed to create a genome-wide, densely covered, off-target-preventing guide RNA library compatible with common CRISPR formats and sequences from various strains. The program's first module is the input module, allowing users to select key parameters such as the required genome sequence file, region partitioning strategy, type of CRISPR tool used, off-target prevention stringency, minimum interval between sequences, and maximum library size. The second module identifies the genome sequence file and generates all target regions according to the strategy. The third module finds guide RNA sequences across the entire genome, including all sequences targeting both the sense and antisense strands. The fourth module filters all sequences for high-quality sequences less prone to off-target effects based on the input. The fifth module selects the ideal sequence set from the high-quality sequences based on whether the sequence positions are repetitive or too close together, and the maximum selection amount for each region, to form the guide RNA library. Figure 6 ).

[0059] Use the compatibility program you wrote ( Figures 14-24 The Genbank format file NC_009142.1 of the *Saccharomyces rubrum* reference genome sequence was downloaded from a public database. Based on the CRISPR / Cas12f PAM sequence, the adjacent spacer sequences were searched within the genome file. All found sequences were stored as the first output file C, resulting in 42,041 candidate sequences. After removing duplicate sequences, 39,853 unique sequences were obtained. After removing off-target sequences from the unique sequences, 35,305 ideal sequences were obtained. These ideal sequences were mapped to 12,000 genomic regions, of which 10,791 regions had target sites, and 1,209 regions did not. The output of these regions constitutes a single-target library for CRISPR / Cas12f in *Saccharomyces rubrum*.

[0060] Example 4: Design of a tandem dual-target library against CRISPR / Cpf1 in *Saccharomyces rubrum* Using the developed compatibility program, the Genbank format file NC_009142.1 of the *Saccharomyces rubrum* reference genome sequence was downloaded from a public database. Based on the CRISPR / Cpf1 PAM sequence, the adjacent Spacer sequences were searched within the genome file. All found sequences were stored as the first output file C, resulting in a total of 271,596 candidate sequences. Figure 7 Then, after removing candidate sequences containing duplicates, 261,461 unique sequences were obtained. Figure 8After removing off-target sequences from the unique sequences, 161,710 ideal sequences were obtained. Figure 9 The ideal sequence was mapped to 12,000 genomic regions, of which 11,892 regions could be selected for tandem sequence formation of dual targets, 28 regions had only a single target, and 80 regions had no target. Figure 10 , Figure 11 The output is a tandem dual-target library of CRISPR / Cpf1 in *Saccharomyces rubrum*.

[0061] Example 5: Design of a tandem dual-target library for CRISPR / Cpf1 in Streptomyces azureense Using a compatibility program, the Genbank format file NZ_CP042324.1 of the *Streptomyces cerevisiae* reference genome sequence was downloaded from a public database. Based on the CRISPR / Cpf1 PAM sequence, the adjacent spacer sequences were searched within the genome file. All found sequences were stored as the first output file C, resulting in 256,232 candidate sequences. Repeated sequences were then removed, yielding 247,560 unique sequences. After removing off-target sequences from the unique sequences, 157,572 ideal sequences were obtained. These ideal sequences were mapped to 12,000 genomic regions. Of these, 11,845 regions could be tandemly linked to form dual targets, 30 regions contained only a single target, and 125 regions had no target. The output of this library constitutes the tandem dual-target library for CRISPR / Cpf1 in *Streptomyces cerevisiae*.

[0062] Example 6: Design of a single-target library against CRISPR / Cpf1 in Streptomyces venezuelae Using a compatibility program, the Genbank format file NZ_CP029197.1 of the *Streptomyces venezuelae* reference genome sequence was downloaded from a public database. Based on the CRISPR / Cpf1 PAM sequence, the adjacent spacer sequences were searched within the genome file. All found sequences were stored as the first output file C, resulting in 239,768 candidate sequences. Repeated sequences were then removed, yielding 235,241 unique sequences. After removing off-target sequences from the unique sequences, 155,050 ideal sequences were obtained. These ideal sequences were mapped to 12,000 genomic regions, of which 11,956 regions had a single target and 44 regions did not. The output of these regions constitutes the single-target library for CRISPR / Cpf1 in *Streptomyces venezuelae*.

[0063] The statistical results of library design in representative actinomycetes using commonly used CRISPR tools in Examples 3-6 are shown in the table below. Figure 12 .

[0064] Example 7: Obtaining a high-yielding strain with a simplified genome from *Saccharomyces rubrum* using a DNA deletion strategy. For *Saccharopolysporum rubrum*, a designed CRISPR / Cpf1 single-target library was synthesized and constructed into a free plasmid pME2 by a gene synthesis company. This plasmid was then chemically transformed into *E. coli* ETZ, a medium capable of actinomycete conjugation transfer. A whole plate of *E. coli* and a whole plate of *Saccharopolysporum rubrum* were used for conjugation transfer. Bacterial cells scraped from TSA plates were reselected and mixed using standard LB medium, and then plated onto standard ISP4 medium containing 1 ng / μL naphthylpyridinium acid and incubated at 30°C for 7 days. After colony growth, colony verification was performed using primers 9 and 10, yielding 261 strains of *Saccharopolysporum rubrum* containing the library guide RNA. After expansion culture in 250 mL shake flasks containing 50 mL TSB medium at 30°C and 220 rpm for 24 h, the culture was transferred to 250 mL shake flasks containing 50 mL fermentation medium and fermented at 30°C and 220 rpm for 7 days (OD...). 600 The yield was 3.5-4.5 g / L, and the yield was tested using HPLC (reference 9), with three replicates for each strain. A total of 37 high-yielding strains were obtained, named Lib-1 to Lib-37. Figure 13 Five strains (Lib-4, Lib-14, Lib-22, Lib-23, and Lib-34) showed an erythromycin yield increase of over 15% compared to the original strain NRRL2338. The targeted deletion sites confirmed after sequencing are shown in Table 1.

[0065] Table 1 High-yielding erythromycin strains

[0066] Traditional homologous recombination techniques for DNA deletion in *Saccharomyces rubrum* typically require more than three months; while CRISPR / Cas homologous recombination requires two steps to construct the tool plasmid, usually taking more than two months. This invention utilizes a CRISPR / Cas approach combined with an endogenous non-homologous end ligation system for DNA deletion in *Saccharomyces rubrum*, resulting in simpler plasmid construction and a single-round operation taking less than one month, significantly reducing the workload and time required for DNA deletion in *Saccharomyces rubrum*.

[0067] Existing CRISPR / Cas editing library design strategies typically target gene coding sequences, neglecting intergenic regions; generally only support one CRISPR / Cas tool; cannot be designed to the maximum limit based on library size; lack strict off-target detection; and lack extended designs for multiple guide RNAs tandem. The CRISPR / Cas editing library design strategy proposed in this invention can firstly design libraries that densely cover the genome at the maximum library size limit, simultaneously targeting both genes and intergenic regions; it is compatible with all different types of CRISPR / Cas tools; it allows for on-demand configuration of parameters such as region partitioning, sequence spacing, and off-target detection to obtain more efficient targets; furthermore, it can be extended to design libraries with guide RNAs tandemly targeting multiple targets.

[0068] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for DNA deletion in *Saccharomyces rubrum*, characterized in that, Includes the following steps: (1) A free plasmid containing a CRISPR / Cas system expression element and at least one guide RNA expression element was introduced into *Saccharomyces rubrum*. Saccharopolyspora erythraea The guide RNA targets one or more predetermined sites on the genome of the red saccharopolysporum. (2) Express the CRISPR / Cas system and the guide RNA in the red sugar polysporum to generate DNA breaks at one or more predetermined sites; (3) The DNA break is repaired by using the endogenous non-homologous end ligation repair mechanism of the red sugar polysporum, thereby generating a deletion of DNA fragments at or near the preset site, and the method does not require the provision of an exogenous homologous recombination repair template.

2. The method according to claim 1, characterized in that, The free plasmid contains two or more guide RNA expression elements in tandem, which target different preset sites on the genome of *Saccharomyces rubrum*, thereby achieving deletion of DNA fragments between the different preset sites.

3. The method according to claim 1 or 2, characterized in that, The preset site is located in the gene coding region and / or intergenic region; and / or, The CRISPR / Cas system is either a CRISPR / Cas12f system or a CRISPR / Cpf1 system.

4. A method for designing guide RNA sequences for constructing actinomycete DNA deletion libraries, characterized in that, Includes the following steps: 1) Identify all candidate guide RNA sequences across the entire actinomycete genome based on the PAM sequence obtained using the selected CRISPR / Cas tool; 2) The candidate guide RNA sequences are screened to remove repetitive sequences and sequences with off-target risk selected according to a preset off-target determination algorithm, so as to obtain a high-quality guide RNA sequence library. 3) Divide the entire genome of the actinomycete into a predetermined number of intervals; 4) From the high-quality guide RNA sequence library, at least one guide RNA sequence is selected for each or part of the interval according to preset rules to form the DNA deletion library that densely covers the genome; The actinomycetes are selected from *Saccharomyces rubrum* (red sugar polysporum). Saccharopolyspora erythraea Streptomyces azureus ( ), Streptomyces coelicolor Streptomyces venezulatus ( Streptomyces venezuelae ).

5. The method according to claim 4, characterized in that, The criteria for screening the candidate guide RNA sequences in step 2) include: at least one different base in the first 5 bases of the PAM sequence, at least two different bases in the first 10 bases, and at least four different bases in the first 15 bases.

6. The method according to claim 4, characterized in that, The preset rules are configurable, including the configuration of interval division strategy, minimum interval between sequences, strictness of off-target judgment, and number of guide RNAs selected for each interval.

7. The method according to any one of claims 4-6, characterized in that, In step 4), two guide RNA sequences located at the beginning and end of each interval are selected as a group to construct a tandem dual-target library; Preferably, the interval between the two guide RNA sequences is greater than or equal to 50 bp.

8. The method according to any one of claims 4-6, characterized in that, In step 4), a guide RNA sequence is selected for each region to construct a single-target library; Preferably, the distance between the guide RNA sequence and the interval boundary is not less than the length of the guide RNA.

9. The application of the method according to any one of claims 4-8, characterized in that, The guide RNA sequence designed by the method is used in the DNA deletion method according to any one of claims 1-3 to construct a red sugar polyspora DNA deletion library.

10. A method for screening high-yielding strains of *Saccharomyces rubrum*, characterized in that, Includes the following steps: a) Using the application described in claim 9, obtain a group of red saccharopolysporum mutant strains with different DNA deletions; b) Cultivate the mutant strains and determine the yield of the target product, and screen out mutant strains with higher yields than the starting strain.

Images