Application of OsEME1 gene in increasing photosynthetic capacity, grain length and yield of rice

Abstract

The application belongs to the field of biotechnology, and particularly relates to application of an OsEME1 gene in increasing photosynthetic capacity, grain length and yield of rice. It is found in the application that the OsEME1 gene is a key gene for regulating chloroplast development and photosynthetic capacity, overexpression of the OsEME1 gene can increase the photosynthetic capacity of rice, and can increase the grain length of rice grains while keeping the grain width unchanged, improve the single-grain weight of rice grains, improve the grain type quality of rice, increase the yield of rice under the condition that the number of grains per panicle is unchanged; in addition, overexpression of the OsEME1 gene can increase the tiller number of rice, further increase the yield per plant of rice, and increase the total yield of rice. The application of the OsEME1 gene provided in the application has important theoretical value and application prospect for high-light-efficiency and high-yield breeding improvement of rice and other crops.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the OsEME1 gene in increasing the photosynthetic capacity, grain length, and yield of rice. Background Technology

[0002] Rice (Oryza sativa L.) is an important food crop, with more than half of the world's population relying on it as their staple food. It is estimated that by 2030, the yield of major crops will need to increase by 15% to meet global demand (Ray et al., 2013). Continuously increasing rice yield per unit area is of great strategic significance for ensuring my country's food security.

[0003] Photosynthesis is the largest process of matter and energy conversion on Earth. Over 90% of a plant's dry weight originates from photosynthesis, forming the basis of crop biomass and yield. Improving the efficiency of plant photosynthesis can help solve future global food shortages. In most higher plants, chloroplasts are the primary site of photosynthesis, absorbing light energy and converting it into chemical energy through the photosynthetic electron transport chain. Therefore, ensuring the normal and efficient development of chloroplasts in crops is a crucial prerequisite for cultivating high-light-efficiency, high-yield crop varieties.

[0004] Rice yield traits are complex quantitative traits controlled by multiple genes and the environment. In recent years, with the rapid development of plant molecular genetics and bioinformatics, several high photosynthetic efficiency and high yield genes in rice have been identified using techniques such as GWAS analysis, QTL mapping, and map-based cloning. This has laid the foundation for understanding rice growth, development, and yield formation, and for breeding high photosynthetic efficiency and high yield rice varieties. The Dehydration-Responsive Element-Binding Protein 1C (DREB1C) encodes an AP2 / ERF type transcription factor. Studies have shown that the OsDREB1C gene is responsive to light and low nitrogen levels, and can directly bind to and activate the expression of photosynthesis-related genes, nitrogen use efficiency-related genes, and flowering genes, synergistically regulating plant photosynthesis and nitrogen use efficiency. Research has found that overexpression of this gene in rice can increase grain yield and harvest index, synergistically improve crop photosynthesis and nitrogen use efficiency, promote flowering, and shorten the growth cycle, increasing crop yield by more than 30% (Wei et al., 2022). HPY1 (High Photosynthetic Rate and Yield 1) encodes a transposon-derived transcription factor that enhances the transcription of Rubisco small subunit-encoding genes (RbcS2, RbcS3, and RbcS4) by directly binding to them, thereby increasing Rubisco content and activity, which in turn increases photosynthetic rate and biomass, promoting high rice yield (Fan et al., 2023). However, our understanding of the genetic network regulating plant photosynthesis is still very limited. Summary of the Invention

[0005] To address the existing need for regulating rice photosynthetic capacity and increasing rice yield, this invention provides the application of the OsEME1 gene in increasing rice photosynthetic capacity, grain length, and yield. The specific technical solution is as follows:

[0006] Firstly, the application of the OsEME1 gene in at least one of items (a) to (d):

[0007] (a) Enhance the photosynthetic capacity of rice;

[0008] (b) Increase the grain length of rice;

[0009] (c) Increase the grain weight of rice;

[0010] (d) Increase the yield per rice plant;

[0011] The nucleotide sequence of the OsEME1 gene is shown in SEQ ID NO.1.

[0012] Furthermore, the application method is as follows:

[0013] (1) By overexpressing the OsEME1 gene in rice, the photosynthetic capacity of rice is enhanced, and / or the grain length of rice grains is increased, and / or the grain weight of rice grains is increased, and / or the yield per rice plant is increased.

[0014] Or, (2) by knocking out, knocking down, or silencing the OsEME1 gene in rice, the photosynthetic capacity of rice is weakened, and / or the grain length of rice grains is reduced, and / or the grain weight of rice grains is reduced, and / or the yield per rice plant is reduced.

[0015] Secondly, the present invention provides the application of OsEME1 protein in at least one of items (a) to (d):

[0016] (a) Enhance the photosynthetic capacity of rice;

[0017] (b) Increase the grain length of rice;

[0018] (c) Increase the grain weight of rice;

[0019] (d) Increase the yield per rice plant;

[0020] The amino acid sequence of the OsEME1 protein is shown in SEQ ID NO.2.

[0021] Thirdly, the present invention provides the application of biological materials containing the OsEME1 gene in at least one of (a) to (d):

[0022] (a) Enhance the photosynthetic capacity of rice;

[0023] (b) Increase the grain length of rice;

[0024] (c) Increase the grain weight of rice;

[0025] (d) Increase the yield per rice plant;

[0026] The nucleotide sequence of the OsEME1 gene is shown in SEQ ID NO.1;

[0027] The biological material is an expression cassette, vector, host cell, or host bacterium.

[0028] Fourthly, the present invention provides a method for improving rice grain shape and / or enhancing rice photosynthetic capacity and / or increasing rice yield, characterized in that it includes: overexpressing the OsEME1 gene in rice using genetic engineering methods;

[0029] The nucleotide sequence of the OsEME1 gene is shown in SEQ ID NO.1.

[0030] Furthermore, the improvement of rice grain shape is achieved by increasing the length of the rice grains and increasing the length-to-width ratio of the grains.

[0031] Furthermore, the method of increasing rice yield is to increase the grain weight without increasing the number of grains, thereby increasing the thousand-grain weight of rice and increasing the yield per rice plant.

[0032] And / or, increase the number of rice tillers and increase the yield per rice plant.

[0033] Furthermore, the overexpression can be performed in one of the following ways:

[0034] (1) By introducing a plasmid containing the OsEME1 gene;

[0035] (2) By increasing the copy number of the OsEME1 gene on plant chromosomes;

[0036] (3) By altering the promoter sequence of the OsEME1 gene on plant chromosomes;

[0037] (4) By operatively linking a strong promoter to the OsEME1 gene;

[0038] (5) By introducing enhancers.

[0039] Furthermore, the overexpression method is as follows:

[0040] (1) Based on the cDNA sequence of the OsEME1 gene, an overexpression vector was constructed.

[0041] (2) The overexpression vector was transferred into Agrobacterium competent cells to obtain Agrobacterium overexpressing the OsEME1 gene;

[0042] (3) Rice was transformed using the Agrobacterium to obtain rice lines overexpressing the OsEME1 gene.

[0043] Furthermore, the rice variety is Kongyu 131.

[0044] Fifthly, the present invention provides the application of the above-described method or the transgenic rice obtained by the above-described method in rice breeding.

[0045] Compared with the prior art, the present invention has the following beneficial effects:

[0046] This invention discovers that the OsEME1 gene is a key gene regulating chloroplast development and photosynthetic capacity. Overexpression of the OsEME1 gene increases the photosynthetic capacity of rice, and while maintaining the same grain width, it increases grain length, thereby improving the weight of individual grains and grain quality, and ultimately increasing rice yield without changing the number of grains per panicle. Furthermore, overexpression of the OsEME1 gene increases the number of tillers in rice, further increasing the yield per plant and thus the total yield. The findings of this invention have significant theoretical value and application prospects for high-efficiency, high-yield breeding and improvement of crops such as rice. Attached Figure Description

[0047] Figure 1 This diagram illustrates the photosynthetic levels of wild-type rice, OsEME1 mutant, and OsEME1 overexpressing plants. In the diagram, a represents the plant morphology, b represents the OsEME1 gene expression level in the three rice plants, c represents the net photosynthetic rate curves of the three rice plants, d represents the leaf phenotype of the three rice plants, e represents the chlorophyll content in the three rice plants, and f represents the expression levels of photosynthesis-related proteins in the three rice plants.

[0048] Figure 2 This diagram illustrates the expression levels of photosynthesis-related genes in wild-type rice, OsEME1 mutants, and OsEME1 overexpressing plants. In the diagram, a represents the expression level of CAB1, b represents the expression level of Lhca4, c represents the expression level of Lhcb2, and d represents the expression level of PORB. Actin1 was used as an internal reference gene for quantitative real-time PCR.

[0049] Figure 3 The graph shows the grain shape statistics of wild-type rice, OsEME1 mutant, and OsEME1 overexpressing plants; where a is the grain shape of the three rice plants, with a scale bar of 5 mm, b is the grain length statistics of the three rice plants, c is the grain width statistics of the three rice plants, and d is the grain length-to-width ratio of the three rice plants.

[0050] Figure 4 This is a comparative analysis of yield traits in wild-type rice, OsEME1 mutant, and OsEME1 overexpressing plants; where a represents the plant height of the three types of rice, b represents the number of tillers of the three types of rice, c represents the number of grains per panicle of the three types of rice, d represents the thousand-grain weight of the three types of rice, and e represents the yield per plant of the three types of rice.

[0051] In the above figure, the values ​​are the mean ± standard deviation (n=3). The asterisks and different letters in the figure indicate significant differences (P<0.05). The significance analysis was performed using the Duncan test. Detailed Implementation

[0052] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It should be noted that the following detailed descriptions are exemplary and are only some embodiments of the present invention, not all embodiments.

[0053] Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0054] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. The experimental materials used in the embodiments of this invention are all conventional experimental materials in the art and are commercially available. Experimental methods not specifying detailed conditions are performed according to conventional experimental methods or the operating instructions recommended by the supplier.

[0055] In the following examples, the rice variety is Kongyu 131 (KY131).

[0056] In the following examples, the nucleotide sequence of the OsEME1 gene is shown in SEQ ID NO.1; the amino acid sequence of the OsEME1 protein is shown in SEQ ID NO.2; and the nucleotide sequence of the sgRNA expression cassette used to knock out the OsEME1 gene is shown in SEQ ID NO.3, wherein the underlined part is the target sequence and the bolded part is the sgRNA coding sequence.

[0057] SEQ ID NO.1:

[0058]

[0059] SEQ ID NO.2:

[0060] MASHAAVVEIIDDDDDDDDDVAAASTPPALHKRSHAVAAAAPDSPDAFSPSPPDPKRRQLAASTIVLDDTPTPPKRRPPPVAADRSASVVADTPRSFVPCSLRNRAIAGDTPDSVLPSPSFHLDAPDSATPGSDVPCSVGLDDIVPETPGFNSPRLARPPAVPGLTSPMTARKFSGVSCPISLDSDDELDDTVYRESLTRTPSNMAKPEHAIQPCTTSCTDKVENTKSTDKKDYSKSNVGYQTNNSACKNNGTTSYNQPPRANSPCEDSTLKEADPFINNHCPQEENALPIEERKKKQQEEKRLKKEKKAREIEEKKQKRLETKKQKEAMKAELAELKKLEKEKKKWESGKLATKCIVAEIDSSVIESGSVGGHLVQGFHEKGLCFRVTSNSIKGSILWKMQIPNEFTQDQASTSQVPYILFVLQAEEFCDLVSGGTLLDHVQKVRRQYPEFTICYVTNKLMSFIKRREQNQYNKTTSNSNSWKRPPVEEALCKLATHYARVRSRHCTDEAEVTEHIVGLTYSLANCKFRKPLTWLSVHANGSNISKGCVDKDRIKKSAWLKSLVAIPGVSPGQAIAIEKKYPSMRSLLNVYMDDSKSVHEKEHLLEDLRLEGPLGDFKRRLGPACSKKVYTILMAQNGAAEVEVDRRGA

[0061] SEQ ID NO.3:

[0062] TGGAATCGGCAGCAAAGGATTTTTTCCTGTAGTTTTCCCACAACCATTTTTTACCATCCGAATGATAGGATAGGAAAAATATCCAAGTGAACAGTATTCCTATAAAATTCCCGTAAAAAGCCTGCAATCCGAATGAGCCCTGAAGTCTGAACTAGCCGGTCACCTGTACAGGCTATCGAGATGCCATACAAGAGACGGTAGTAGGAACTAGGAAGACGATGGTTGATTCGTCA GGCGAAATCGTCGTCCTGCAGTCGCATCTATGGGCCTGGACGGAATAGGGGAAAAAGTTGGCCGGATAGGAGGGAAAGGCCCAGGTGCTTACGTGCGAGGTAGGCCTGGGCTCTCAGCACTTCGATTCGTTGGCACCGGGGTAGGATGCAATAGAGAGCAACGTTAGCTAGAGCAAACTGGACTGCCTTATATGCGCGGGTGCTGGCTTGGCTGCCG GAGCACGGCACGAACGACCG GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCAAGAGCTT.

[0063] Example 1: The OsEME1 gene positively regulates chloroplast development and photosynthesis in rice.

[0064] Primers were designed using the rice OsEME1 gene to ligate the target sequence into the sgRNA expression cassette (sequence SEQ ID NO.3), and pYLCRISPR / Cas9P was inserted during enzyme digestion and ligation. ubi -MH vector, the specific method is as described in the literature (Ma et al., 2015). OsEME1 mutants with complete loss of OsEME1 gene function on the KY131 background were obtained using Agrobacterium-mediated transformation (e.g., ...). Figure 1 (as shown in a).

[0065] Following standard molecular biology and genetic procedures, an overexpression vector (pCAMBIA2300, which is commercially available, for example, purchased from Shanghai Lianmai Biotechnology Co., Ltd.) was constructed based on the cDNA sequence of the OsEME1 gene. The following primers were designed:

[0066] pOsEME1-F (SEQ ID NO.4):ATGGCGTCCCACGCCGCCGT;

[0067] pOsEME1-R (SEQ ID NO. 5): AGCTCCACGCCTATCAACTT.

[0068] Using the pCAMBIA2300 vector backbone, the p35S::OsEME1 vector was constructed using Gateway BP Clonase II Enzyme Mix and Gateway LR Clonase II Enzyme Mix kits (purchased from Invitrogen). Wild-type KY131 plants were transformed using Agrobacterium-mediated transformation to obtain p35S::OsEME1 positive transgenic lines (plant phenotypes are shown below). Figure 1 (as shown in a).

[0069] like Figure 1 As shown in b, the quantitative real-time PCR results showed that the gene expression level of OsEME1 was increased in p35S::OsEME1 overexpressing plants.

[0070] Wild-type KY131, OsEME1 mutants, and p35S::OsEME1 overexpressing plants were planted in the field, such as... Figure 1 As shown in Figure c, compared with wild-type KY131, the OsEME1 mutant exhibited a decreased net photosynthetic rate, while p35S::OsEME1 overexpression plants showed an increased net photosynthetic rate. This indicates that the OsEME1 gene positively regulates the net photosynthetic rate of rice. Furthermore, as... Figure 1 As shown in d to f, compared with wild-type KY131, the OsEME1 mutant showed leaf whitening, decreased chlorophyll a and chlorophyll b content, and decreased photosynthetic protein content; p35S::OsEME1 overexpression plants showed greener leaves, increased chlorophyll a and chlorophyll b content, and increased photosynthetic protein content.

[0071] The above results indicate that the OsEME1 gene positively regulates chloroplast development and photosynthesis in rice.

[0072] Example 2: The OsEME1 gene positively regulates the expression of photosynthesis-related genes.

[0073] Following conventional molecular biology and genetic procedures, the expression levels of photosynthesis-related genes (CAB1, Lhca4, Lhcb2, PORB) were extracted from wild-type KY131 and p35S::OsEME1 overexpressing plants and OsEME1 mutants grown under hydroponic conditions for 2 weeks.

[0074] like Figure 2As shown in a to d, the expression levels of photosynthesis-related genes in OsEME1 overexpression plants were higher than those in wild-type plants; while the expression levels of photosynthesis-related genes in OsEME1 mutants were lower than those in wild-type plants.

[0075] These results indicate that the OsEME1 gene can positively regulate the expression of photosynthesis-related genes.

[0076] The primer sequences used for quantitative PCR detection are shown in Table 1.

[0077] Table 1

[0078]

[0079] Example 3: Effects of the OsEME1 gene on rice grain shape

[0080] The traits of rice grain length, grain width, length-to-width ratio, and thousand-grain weight of wild-type KY131, p35S::OsEME1 overexpressing plants and OsEME1 mutants obtained in Example 1 were analyzed. The results are as follows: Figure 3 As shown.

[0081] The results showed that, compared with wild-type KY131, the grain length of p35S::OsEME1 overexpressing plants was significantly increased, but the grain width remained unchanged (e.g., ...). Figure 3 a, Figure 3 As shown in c), this increases the length-to-width ratio of the grain (as shown in c). Figure 3 (as shown in d); the OsEME1 mutant showed a significant reduction in grain length and width (e.g., as shown in d). Figure 3 a, Figure 3 b、 Figure 3 As shown in c), this reduces the length-to-width ratio of the grain (as shown in c). Figure 3 (as shown in d).

[0082] The above results indicate that the OsEME1 gene positively regulates rice grain length and length-to-width ratio, which is beneficial for improving the appearance quality of rice.

[0083] Example 4: Effects of the OsEME1 gene on rice yield per plant

[0084] Wild-type KY131, p35S::OsEME1 overexpressing plants, and OsEME1 mutants were planted in the field, and yield phenotypic traits were analyzed.

[0085] The results showed that, compared with wild-type KY131, the plant height of p35S::OsEME1-overexpressing plants was significantly increased. Figure 4 a) The number of tillers increased significantly ( Figure 4 b), but the number of grains per ear remained unchanged. Figure 4 c), the thousand-grain weight increased significantly ( Figure 4d) indicates that the increased grain weight of rice ultimately leads to an increase in yield per plant of about 15%. Figure 4 e); the plant height of the OsEME1 mutant was significantly reduced (e); Figure 4 a) The number of tillers decreased significantly ( Figure 4 b) The number of grains per ear is significantly reduced ( Figure 4 c), the thousand-grain weight was significantly reduced ( Figure 4 d), ultimately leading to a decrease in yield per plant ( Figure 4 e).

[0086] The above results indicate that overexpression of the OsEME1 gene can increase plant height, tiller number, and thousand-grain weight in rice, ultimately increasing yield per plant.

Claims

1. Application of the OsEME1 gene in at least one of items (a) to (d): (a) Enhance the photosynthetic capacity of rice; (b) Increase the grain length of rice; (c) Increase the grain weight of rice; (d) Increase the yield per rice plant; The nucleotide sequence of the OsEME1 gene is shown in SEQ ID NO.

1.

2. The application as described in claim 1, characterized in that, The application method is as follows: (1) By overexpressing the OsEME1 gene in rice, the photosynthetic capacity of rice is enhanced, and / or the grain length of rice grains is increased, and / or the grain weight of rice grains is increased, and / or the yield per rice plant is increased. Or, (2) by knocking out, knocking down, or silencing the OsEME1 gene in rice, the photosynthetic capacity of rice is weakened, and / or the grain length of rice grains is reduced, and / or the grain weight of rice grains is reduced, and / or the yield per rice plant is reduced.

3. Application of OsEME1 protein in at least one of items (a) to (d): (a) Enhance the photosynthetic capacity of rice; (b) Increase the grain length of rice; (c) Increase the grain weight of rice; (d) Increase the yield per rice plant; The amino acid sequence of the OsEME1 protein is shown in SEQ ID NO.

2.

4. Application of biological materials containing the OsEME1 gene in at least one of items (a) to (d): (a) Enhance the photosynthetic capacity of rice; (b) Increase the grain length of rice; (c) Increase the grain weight of rice; (d) Increase the yield per rice plant; The nucleotide sequence of the OsEME1 gene is shown in SEQ ID NO.1; The biological material is an expression cassette, vector, host cell, or host bacterium.

5. A method for improving rice grain shape and / or enhancing rice photosynthetic capacity and / or increasing rice yield, characterized in that, include: The OsEME1 gene was overexpressed in rice using genetic engineering techniques. The nucleotide sequence of the OsEME1 gene is shown in SEQ ID NO.

1.

6. The method according to claim 5, characterized in that, The overexpression method is one of the following: (1) By introducing a plasmid containing the OsEME1 gene; (2) By increasing the copy number of the OsEME1 gene on plant chromosomes; (3) By altering the promoter sequence of the OsEME1 gene on plant chromosomes; (4) By operatively linking a strong promoter to the OsEME1 gene; (5) By introducing enhancers.

7. The method according to any one of claims 5 or 6, characterized in that, The overexpression method is as follows: (1) Based on the cDNA sequence of the OsEME1 gene, an overexpression vector was constructed. (2) The overexpression vector was transferred into Agrobacterium competent cells to obtain Agrobacterium overexpressing the OsEME1 gene; (3) Rice was transformed using the Agrobacterium to obtain rice lines overexpressing the OsEME1 gene.

8. The method according to claim 7, characterized in that, The feature is that, The rice variety in question is Kongyu 131.

9. The application of the transgenic rice obtained by the method of claim 8 or by the method of claim 8 in rice breeding.

Images