A method for increasing the tolerance of wheat to multiple stresses and the content of gamma-aminobutyric acid in the grain

Abstract

The application belongs to the field of plant breeding, and particularly relates to a method for improving multi-stress resistance and grain gamma-aminobutyric acid content of wheat. A gene affecting multi-stress resistance of wheat is obtained through big data analysis. Manipulation of the gene can improve multi-stress resistance and gamma-aminobutyric acid content of wheat.

Description

Technical Field

[0001] This invention belongs to the field of plant breeding, specifically relating to a method for improving the multi-adversity resistance and γ-aminobutyric acid content of wheat. Background Technology

[0002] Drought, high temperature, and other abiotic stresses severely restrict wheat growth, development, and yield stability. Traditional breeding techniques, limited by germplasm resources and insufficient understanding of the genetic mechanisms of complex traits, struggle to efficiently cultivate broad-spectrum stress-resistant varieties. Many wheat genes are related to stress tolerance, such as TaLEA (Yu Jianing. Cloning, Analysis, and Functional Study of Wheat Drought and Salt Tolerance Related Genes [D]. Northwest A&F University, 2003), TaWHY2-6A (CN118910132A), TaERF16-B (CN118834991A), and TaSnRK1 (CN118812685A). In recent years, gene editing technology has provided a new approach to improving crop stress resistance; however, existing research often focuses on single stress response genes, making it difficult to address the complex environment of multiple stresses occurring simultaneously in the field. More genes related to stress tolerance need to be identified to achieve the goal of improving the broad-spectrum stress tolerance of wheat.

[0003] γ-Aminobutyric acid (GABA), a four-carbon non-protein amino acid, is significantly positively correlated with wheat drought resistance. It can also effectively increase the content of P, K, Ca, Mg, Fe, Mn, and Zn elements in wheat grains, promote the accumulation of mineral elements in plant tissues, and increase wheat yield by increasing the number of grains per ear (Yang Na, Wu Hong, et al. Effects of foliar spraying of γ-aminobutyric acid on wheat yield and quality [J]. Journal of Chinese Cereals and Oils, 2018.3(33)). In addition, GABA, as a functional nutrient, has health benefits such as regulating human blood pressure and improving nervous system function. Wheat products are an important source of dietary GABA, but the GABA content in ordinary wheat grains is usually low. Currently, the main methods to increase wheat GABA content include stress induction (such as salt treatment and hypoxia treatment) and fermentation processing, but these methods have problems such as low efficiency, high cost, and impact on grain quality. Directly regulating the GABA metabolic pathway through genetic modification has become a new strategy to improve the nutritional function of wheat.

[0004] With the development of genomics technology, gene mining based on multi-omics data has provided new insights into the analysis of complex traits. However, as a hexaploid crop, wheat's functional redundancy of homologous genes makes it difficult for single gene editing to produce significant phenotypes. This invention, based on genome-wide association analysis, identified TaPOP2, a gene associated with wheat root growth and development and water stress adaptation. Through gene editing technology, mutants of three homologous genes were obtained, and their loss of function simultaneously improved wheat stress resistance and GABA content. This discovery provides a new target for developing synergistic improvement technologies for stress resistance and nutrition. Summary of the Invention

[0005] The purpose of this invention is to provide a method for improving the multi-adversity resistance and γ-aminobutyric acid content of wheat.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] This invention provides the application of a gene in regulating wheat root length, multi-stress resistance, or γ-aminobutyric acid (GABA) content, characterized in that the gene comprises any one of the following:

[0008] (1) Genes containing the sequence shown in SEQ ID NO.1, SEQ ID NO.4, or SEQ ID NO.7;

[0009] (2) Genes encoding the sequence shown in SEQ ID NO.3, SEQ ID NO.6, or SEQ ID NO.9;

[0010] (3) The wheat gene database is numbered TraesCS7A03G0822100 or TraesCS7B03G0682600 or TraesCS7D03G0806700.

[0011] The aforementioned multiple adversities include any one of drought and high temperature, or a combination thereof.

[0012] The present invention also provides a method for improving multi-stress resistance or γ-aminobutyric acid (GABA) content in wheat, characterized in that the gene described in (1) or (2) or (3) is knocked out simultaneously; and plants with increased multi-stress resistance or GABA content are selected.

[0013] The aforementioned multiple adversities include any one of drought and high temperature, or a combination thereof.

[0014] In some implementations, the gene knockout is performed by using gene editing technology to target CCAAGGTTACAGGTGAGTGA and CCTATCGAGACTGTTGATGT.

[0015] This invention also provides a kit for improving the multi-stress resistance or γ-aminobutyric acid (GABA) content of wheat, characterized in that it comprises any one of the following:

[0016] (1) It can recognize gRNA molecules such as CCAAGGTTACAGGTGAGTGA and CCTATTCGAGACTGTTGATGT;

[0017] (2) The DNA molecule encoding the gRNA described in (1);

[0018] (3) Vectors for expressing the gRNA described in (1).

[0019] In some embodiments, the sequence of the gRNA molecule is CCAAGGUUACAGGUGAGUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu and CCUAUCGAGACUGUUGAUGUguuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu.

[0020] The present invention also provides a mutant gene, characterized in that the sequence of the mutant gene is as shown in any one of SEQ ID NO.10, SEQ ID NO.11, or SEQ ID NO.12.

[0021] The present invention also provides the above-described method, the above-described kit, and the application of the above-described mutant gene in improving wheat multi-adversity resistance or γ-aminobutyric acid content;

[0022] The aforementioned multiple adversities include any one of drought and high temperature, or a combination thereof.

[0023] The present invention also provides a method for identifying or assisting in the identification of wheat root length, characterized by comprising the following steps: (1) detecting the base at position 1124 of the sequence shown in SEQ ID NO.4 in the test material; (2) if the detection result is T, the root length of the test material is short; if the detection result is A, the root length of the test material is long.

[0024] The advantages and beneficial effects of this invention are as follows: This invention obtained a novel gene affecting wheat's resistance to multiple abiotic stresses through genome-wide association analysis. Manipulating this gene can increase the content of γ-aminobutyric acid (GABA) in wheat and the plant's resistance to various abiotic stresses such as drought and high temperature. Attached Figure Description

[0025] Figure 1 Gene mapping. A: Mapping analysis of the TaPOP2-7B gene; B: Root lengths of materials with two different alleles.

[0026] Figure 2 TaPOP2 BSMV gene editing vector map

[0027] Figure 3 TaPOP2-7 gene editing status. A: Electrophoresis image of the edited site detected by PCR amplification; B: Mutation status of the edited sites in the three homologous genes.

[0028] Figure 4 Root length characteristics of the mutant Tapop2-aabbdd. A: Root length of the mutant and control under waterlogging stress; B: Growth of the control and mutant plants under normal conditions; C: Growth of the mutant and control plants under waterlogging stress.

[0029] Figure 5 Phenotypic characteristics of mutants and controls under drought stress. A: Plant growth; B: Plant survival rate.

[0030] Figure 6 Phenotypic characteristics of mutants and controls under drought and heat stress. A: Plant growth; B: Plant survival rate.

[0031] Figure 7 The content of γ-aminobutyric acid in the seeds of mutants and controls. Detailed Implementation

[0032] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0033] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance thereof are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001), or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available conventional reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

[0034] Example 1: Discovery of wheat stress resistance genes

[0035] Thirty-one wheat populations were subjected to normal treatment (CK) and waterlogging stress (WL). Phenotypic traits of wheat root growth under waterlogging conditions (0h, 24h, 48h, 72h) were statistically analyzed, yielding 58 phenotypic traits, including 40 root length-related traits, 10 root length growth rate traits, and 8 root number traits. Statistical analysis showed that the waterlogged wheat population grew significantly slower than the control group, indicating that waterlogging inhibits root growth in wheat seedlings.

[0036] Through resequencing and genome-wide association analysis, 78 and 21 QTL segments were located in the waterlogged group and control group, respectively. Candidate genes involved in root development or stress adaptation within these candidate segments were selected. A high-confidence candidate gene, TraesCS7B02G246800, was found on chromosome 7B, with the sequence shown in SEQ ID NO.4. The SNP marker SNP-52838470 at physical location 461708557 bp on chromosome 7B was significantly associated with root length after 72 hours of waterlogging (Pvalue = 5.27E-07). Haplotype analysis of SNP-52838470 revealed that the root length of the material with the T / T allele at 1124 bp of the sequence shown in SEQ ID NO.4 was significantly shorter than that of the material with the A / A allele after 72 hours of waterlogging. Figure 1 Protein sequence homology alignment analysis revealed that this candidate gene encodes a transaminase, with multiple homologous copies in the wheat genome. Two homologous genes on chromosomes 7A and 7D showed the highest similarity. It is speculated that this gene is related to wheat root growth and development and water stress adaptation, and has been named TaPOP2.

[0037] The gene TaPOP2-7A is identified in the database as TraesCS7A03G0822100, with its genome sequence shown in SEQ ID NO.1, its coding region sequence shown in SEQ ID NO.2, and its encoded protein sequence shown in SEQ ID NO.3; the gene TaPOP2-7B is identified in the database as TraesCS7B03G0682600, with its genome sequence shown in SEQ ID NO.4, its coding region sequence shown in SEQ ID NO.5, and its encoded protein sequence shown in SEQ ID NO.6; the gene TaPOP2-7D is identified in the database as TraesCS7D03G0806700, with its genome sequence shown in SEQ ID NO.7, its coding region sequence shown in SEQ ID NO.8, and its encoded protein sequence shown in SEQ ID NO.9.

[0038] Example 2: Stress Resistance Identification

[0039] Using the barley striped mosaic virus delivery system (BSMV), sgRNA1 (5'-CCAAGGTTACAGGTGAGTGA-3', PAM: AGG) and sgRNA2 (5'-CCTATCGAGACTGTTGATGT-3', PAM: GGG) were successfully introduced into wheat plants transfected with the Cas9 gene, achieving gene editing. A map of the TaPOP2 BSMV gene editing vector is shown below. Figure 2 As shown.

[0040] 1. Obtaining mutants and identifying resistance

[0041] Homozygous mutants of this gene were obtained through progeny selection, including a single-mutant mutant (Tapop2-bb) and a triple-mutant mutant (Tapop2-aabbdd). Sequencing analysis of the mutant DNA fragments precisely identified the editing sites of the TaPOP2 gene. The results showed that the Tapop2-aabbdd mutant exhibited large deletions in all three homologous genes: TaPOP2a and TaPOP2b each had a 113bp deletion, while TaPOP2d had a 114bp deletion. These deleted regions all contained the first exon of the gene, part of the 5' UTR, and the start codon ATG (…). Figure 3 This leads to the complete loss of gene function.

[0042] The stress resistance of the mutant Tapop2-aabbdd was further identified through flooding, drought and heat stress.

[0043] (1) Flooding stress

[0044] The method for treating waterlogging stress was as follows: Twenty plump, uniformly sized wheat grains were selected, disinfected, and washed. The grains were then laid flat, groove side down, in 15cm x 15cm square petri dishes containing moistened filter paper. After 7 days of growth, the seedlings were divided into a control group (filter paper kept moist) and a waterlogged group (roots submerged to a depth of 2cm). Each group was subjected to three biological replicates, with each replicate including 6-10 seedlings. Root images were taken of the seedlings in both the waterlogged and control groups at 0h, 24h, 48h, and 72h, and root length and number were recorded.

[0045] After 14 days of growth under normal conditions, the root length of the mutant Tapop2-aabbdd was significantly shorter than that of the control (WT) (p<0.05). Figure 4 A). After 7 days of normal growth, followed by 7 days of root flooding, the root length of the mutant was significantly inhibited (p<0.05), only 48.6% of the control. Figure 4 A). After 18 days of growth under normal conditions, there was no significant difference between the control and the mutant. Figure 4B), while 18 days of flooding caused the mutant's leaves to wilt and plant growth to be significantly inhibited. Figure 4 C). These results preliminarily indicate that the TaPOP2 gene is involved in regulating wheat root development, and that flooding inhibits root and plant growth.

[0046] (2) Drought stress

[0047] The drought stress treatment method was as follows: Small square pots (8cm x 8cm) were used to fill with soil, each pot containing 100g of soil (including the pot's weight). After ensuring the soil was fully saturated with water, five experimental plants were sown in each pot, for a total of 15 plants per replicate. Three biological replicates were set up for each material. One day before the wheat reached the "two-leaf-one-bud" stage (approximately 12-13 days, growing conditions 20-23℃, 12h / 12h day / night cycle), irrigation was performed to ensure that the weight of each pot was approximately uniform. After multiple precise measurements, the total weight of the pots before treatment should be controlled within the range of 250g ± 4g. Subsequently, the water in the white dish was drained, and the drought treatment began without further watering. After 12 days of treatment, a 7-day rehydration treatment was performed, and photographs were taken to record the results. The survival rate of each material was also calculated.

[0048] The results showed that the mutant Tapop2-aabbdd exhibited extremely strong drought resistance. After 12 days of drought and 5 days of rehydration, the survival rate of the mutant was 100%, significantly higher than the survival rate of the control (40%), while there was no significant difference between single-mutant and double-mutant mutants and the control. Figure 5 ).

[0049] (3) Drought and heat stress

[0050] The drought and heat stress treatment method was as follows: Small square pots (8cm x 8cm) were used to fill with soil, each pot containing 100g of soil (including the pot's weight). After ensuring the soil was fully saturated with water, five experimental plants were sown in each pot, for a total of 15 plants per replicate. Three biological replicates were set up for each material. One day before the wheat reached the "two-leaf-one-bud" stage (approximately 12-13 days, growing conditions 20-23℃, 12h / 12h day / night cycle), irrigation was performed to ensure that the weight of each pot was approximately uniform. After multiple precise measurements, the total weight of the pots before treatment should be controlled within the range of 250g ± 4g. Subsequently, the water in the white dish was drained, and the treatment began. The ambient temperature was adjusted to a high temperature range of 33-36℃, and watering was continuously withheld, simulating drought and heat stress. After 12 days of treatment, a 7-day rehydration treatment was performed, and photographs were taken to record the results. The degree of leaf curling for each material was also analyzed.

[0051] The results showed that after 10 days of drought and heat treatment and 7 days of rehydration, the survival rate of the mutant Tapop2-aabbdd was significantly higher than that of the wild type and the single mutant. Figure 6 ).

[0052] These findings indicate that the deletion of the three TaPOP2 homologs not only improves the drought resistance of wheat plants, but also significantly enhances their tolerance and recovery ability to combined drought and heat stress.

[0053] Example 3: Identification of γ-aminobutyric acid content

[0054] Gamma-aminobutyric acid (GABA) is an important inhibitory neurotransmitter in the mammalian central nervous system. It plays a crucial role in various physiological processes such as anxiety, sleep, and mood regulation by regulating neuronal activity and maintaining the balance between excitation and inhibition in the brain. The transaminase encoded by the TaPOP2 gene is a key enzyme in the GABA metabolic pathway. Gas chromatography-mass spectrometry (GC-MS) analysis revealed that the GABA content in the seeds of the mutant Tapop2-aabbdd was more than 17 times higher than that in the wild-type control plant. Figure 7 This result indicates that the deletion of the TaPOP2 gene significantly increases the level of γ-aminobutyric acid (GABA) in wheat grains.

[0055] In summary, knocking out the three TaPOP2 homologs on chromosomes 7A, 7B, and 7D (TraesCS7A03G0822100, TraesCS7B03G0682600, and TraesCS7D03G0806700) inhibited wheat root growth and increased sensitivity to flooding, but significantly improved resistance to drought and heat stress. Simultaneously, it substantially increased the γ-aminobutyric acid (GABA) content in wheat grains. Therefore, reducing TaPOP2 gene expression can effectively improve wheat's resistance to drought and heat stress while simultaneously increasing the GABA content in wheat grains.

[0056] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. The application of genes in regulating wheat root length, multi-stress resistance, or γ-aminobutyric acid (GABA) content, characterized in that, The gene includes any of the following: (1) Genes containing the sequence shown in SEQ ID NO.1, SEQ ID NO.4, or SEQ ID NO.7; (2) Genes encoding the sequence shown in SEQ ID NO.3, SEQ ID NO.6, or SEQ ID NO.9; (3) Genes numbered TraesCS7A03G0822100, TraesCS7B03G0682600, or TraesCS7D03G0806700 in the wheat gene database. The aforementioned multiple adversities include drought, high temperature, or a combination thereof.

2. A method for increasing the multi-stress resistance or γ-aminobutyric acid (GABA) content of wheat, characterized in that, Simultaneously knock out the gene described in claim 1(1), (2), or (3); select plants with increased resistance to multiple abiotic stresses or elevated γ-aminobutyric acid (GABA) content; The aforementioned multiple adversities include drought, high temperature, or a combination thereof.

3. The method according to claim 2, characterized in that, The gene knockout method involves using gene editing technology to target and edit CCAAGGTTACAGGTGAGTGA and CCTATTCGAGACTGTTGATGT.

4. A kit for improving multi-stress resistance or γ-aminobutyric acid (GABA) content in wheat, characterized in that: Including any of the following: (1) It can recognize gRNA molecules such as CCAAGGTTACAGGTGAGTGA and CCTATTCGAGACTGTTGATGT; (2) The DNA molecule encoding the gRNA described in (1); (3) Vectors expressing the gRNA described in (1).

5. The reagent kit according to claim 4, characterized in that, The sequence of the gRNA molecule is CCAAGGUUACAGGUGAGUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu and CCUAUCGAGACUGUUGAUGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu.

6. A combination of mutant genes, characterized in that, The sequence of the mutated gene is shown in any one of SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.

12.

7. The method according to claims 2-3, the kit according to claims 4-5, and the application of the mutant gene according to claim 6 in improving wheat's resistance to multiple abiotic stresses or γ-aminobutyric acid content; in, The aforementioned multiple adversities include drought, high temperature, or a combination thereof.

8. A method for identifying or assisting in the identification of wheat root length, characterized in that, The steps include: (1) detecting the base at position 1124 of the sequence shown in SEQ ID NO.4 in the test material; (2) if the detection result is T, the root length of the test material is short; if the detection result is A, the root length of the test material is long.

Images