A method of modulating wheat grain fatty acid composition and triacylglycerol content

Abstract

The application belongs to the field of plant genetic engineering and crop genetic improvement, and particularly relates to a method for regulating the content of wheat grain fatty acid components and lipid components such as triacylglycerol, and provides a new strategy for wheat lipid metabolism regulation and nutritional quality improvement.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and crop genetic improvement, and specifically relates to a method for regulating the content of fatty acid components and lipid components such as triglycerides in wheat grains. Background Technology

[0002] The fatty acid and lipid components in wheat grains not only affect the processing performance and nutritional value of food, but are also closely related to the storage stability and antioxidant properties of the grains. Among them, fatty acids such as palmitic acid (C16:0), arachidic acid (C20:0), eicosapentaenoic acid (C20:1), and eicosadienoic acid (C20:2) have unique functions in lipid metabolism. C16:0, as a major saturated fatty acid, directly affects the oxidative stability of oils and the properties of flour products, but excessive accumulation can also reduce the nutritional value of oils (Gunstone, FD (2004). The Chemistry of Oils and Fats: Sources, Composition, Properties, and Uses. Blackwell Publishing); C20:0 is a very long-chain saturated fatty acid, which is related to the rate of lipid hydrolysis during grain storage (Napier, JA, & Graham, IA (2010). Tailoring plant lipid composition: Designer oilseeds come of age. Current Opinion in Plant Biology, 13(3), 330-337); C20:1, as a monounsaturated fatty acid, can promote the accumulation of triglycerides (TAG) and enhance the antioxidant capacity of grains (Bates, PD, Stymne, S., & Ohlrogge, J. (2013). Biochemical pathways in seed oil synthesis. Current Opinion in Plant Biology). Biology, 16(3), 358-364.); C20:2, as a polyunsaturated fatty acid, participates in the regulation of cell membrane fluidity and the dynamic balance of lipid metabolism (Wallis, JG, & Browse, J. (2002). Mutants of Arabidopsis reveal many roles for membrane lipids. Progress in Lipid Research, 41(3), 254-278.). In addition, other lipid components such as diacylglycerol (DAG), lysophosphatidylcholine (LPC), lysophosphatidylglycerol (LPG), phosphatidylglycerol (PG), monogalactosyldiacylglycerol (MGDG), and lysophosphatidylethanolamine (LPE) also play key roles in grain metabolism.DAG is a direct precursor to TAG synthesis and also participates in cell signaling and regulates plant stress responses (Bates, PD, & Browse, J. (2012). The significance of different diacylglycerol synthesis pathways on plant oil composition and bioengineering. Frontiers in Plant Science, 3, 147). LPC is a hydrolysis product of phosphatidylcholine, and its accumulation may reflect membrane lipid metabolism imbalance or oxidative stress. PG, as the core phospholipid of chloroplast membranes, plays a role in maintaining photosystem II (PSII) function and membrane charge balance. LPG is a metabolite of PG and may affect membrane stability under specific stress conditions. MGDG is the main glycolipid component of chloroplast membranes and supports photosynthetic light capture by stabilizing thylakoid membrane structure. LPE participates in membrane lipid homeostasis and programmed cell death signal transduction, and its content changes are related to grain development or stress response. The synthesis and accumulation of these fatty acids and lipid metabolism processes are regulated by a multi-gene network and are easily interfered with by environmental factors, leading to technical challenges in their precise regulation.

[0003] Traditional breeding techniques improve grain oil content through phenotypic selection, but their efficiency in targeted regulation of specific fatty acid components and lipid components is low. The main reasons are: (1) functional redundancy of key enzymes in lipid metabolism pathways (such as fatty acid elongases, desaturases, and acyltransferases), especially the synergistic or complementary effects of homologous genes in the wheat hexaploid genome; (2) lack of accurate identification of core genes regulating fatty acid C16:0, C20:0, C20:1, and C20:2, as well as lipid components such as TAG, DAG, LPC, and PG. In recent years, genome-wide association studies (GWAS) have been applied to mine lipid metabolism-related genetic loci, such as identifying candidate genes related to fatty acid composition through natural population analysis. In addition, gene editing technologies (such as CRISPR / Cas9) have been successfully used in oil crops to regulate specific fatty acid ratios, such as altering the content of unsaturated fatty acids by editing fatty acid desaturase genes. However, relevant research in wheat still has significant limitations: on the one hand, existing GWAS studies mostly focus on total oil content or common fatty acids (such as oleic acid C18:1), and the genetic mechanisms of ultra-long chain fatty acids (such as C20:0 and C20:2) are not well understood; on the other hand, the application of gene editing technology in wheat is still concentrated on disease resistance or yield traits, and the simultaneous editing and functional verification of multi-copy lipid metabolism genes have not yet been systematically carried out.

[0004] Existing research suggests that the β-ketoacyl-CoA synthase (KCS) family may be involved in the biosynthesis of very long-chain fatty acids (such as C20:0), while diacylglycerol acyltransferase (DGAT) plays a key role in TAG synthesis. However, its influence on DAG homeostasis and phospholipid metabolism (such as PG synthesis) remains unclear. P., & Benning, C. (2002). Galactolipids rule in seedplants. Trends in Plant Science, 7(3), 112-118.). Meanwhile, the functional differentiation of these genes in wheat and their regulatory mechanisms on specific fatty acid components remain unclear. Furthermore, most functional studies rely on heterologous expression systems from model plants such as Arabidopsis thaliana, failing to directly correlate with the oil phenotype of wheat grains, resulting in low efficiency in translating research findings into actual breeding practices.

[0005] This invention, through GWAS combined with gene editing, clarifies for the first time the role of TaDGAT1 homologous genes on different chromosomes in regulating the synthesis and metabolism of wheat grain fatty acid components C16:0, C18:1, C20:0, C20:1, and C20:2, as well as TAG, DGDG, DAG, and LPC, providing an efficient strategy for targeted improvement of wheat grain lipid components (including fatty acids, TAG, and DAG). Summary of the Invention

[0006] The purpose of this invention is to provide a method for regulating the content of fatty acid components and lipid components such as triglycerides in wheat grains.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] This invention provides a method for altering the fatty acid or lipid composition of wheat grains, characterized by comprising any one of the following:

[0009] (1) Knock out the gene that encodes the sequence shown in SEQ ID NO.1 or the gene that encodes the sequence shown in SEQ ID NO.3 or the gene numbered TraesCS7A03G0878700 in the wheat gene database, and select plants with reduced content of C18:1 or / and C20:1 fatty acids or / and digalactosylglycerol or / and monogalactosylglycerol or / and lysophosphatidylglycerol in the grains;

[0010] (2) Knock out the following 3 genes simultaneously:

[0011] (i) The gene encoding the sequence shown in SEQ ID NO.1 or the gene encoding the sequence shown in SEQ ID NO.3 or the gene numbered TraesCS7A03G0878700 in the wheat gene database;

[0012] (ii) The gene that encodes the sequence shown in SEQ ID NO.4 or the gene that encodes the sequence shown in SEQ ID NO.6 or the gene numbered TraesCS7B03G0734000 in the wheat gene database;

[0013] (iii) The gene that encodes the sequence shown in SEQ ID NO.7 or the gene that encodes the sequence shown in SEQ ID NO.9 or the gene numbered TraesCS7D03G0857200 in the wheat gene database;

[0014] Select plants with decreased content of C16:0 or / and C18:1 or / and C20:1 fatty acids or / and digalactodiglycerides or / and triglycerides in their grains, and increased content of diglycerides or / and lysophosphatidylcholine or / and lysophosphatidylethanolamine in their grains.

[0015] (3) Knock out the following 3 genes at the same time:

[0016] (i) The gene encoding the sequence shown in SEQ ID NO.10 or the gene encoding the sequence shown in SEQ ID NO.12 or the gene numbered TraesCS1A03G0311400 in the wheat gene database;

[0017] (ii) The gene encoding the sequence shown in SEQ ID NO.13 or the gene encoding the sequence shown in SEQ ID NO.15 or the gene numbered TraesCS1B03G0394400 in the wheat gene database;

[0018] (iii) The gene encoding the sequence shown in SEQ ID NO.16 or the gene encoding the sequence shown in SEQ ID NO.18 or the gene numbered TraesCS1D03G0307200 in the wheat gene database;

[0019] Select plants with decreased C16:0 or / and C20:0 fatty acids or / and monogalactosyldiglycerol or / and lysophosphatidylglycerol or / and phosphatidylglycerol content in their grains, and increased C20:2 fatty acids or / and diglycerol content.

[0020] (4) Knock out the following 3 genes at the same time:

[0021] (i) The gene encoding the sequence shown in SEQ ID NO.10 or the gene encoding the sequence shown in SEQ ID NO.12 or the gene numbered TraesCS1A03G0311400 in the wheat gene database;

[0022] (ii) The gene encoding the sequence shown in SEQ ID NO.13 or the gene encoding the sequence shown in SEQ ID NO.15 or the gene numbered TraesCS1B03G0394400 in the wheat gene database;

[0023] (iii) The gene encoding the sequence shown in SEQ ID NO.16 or the gene encoding the sequence shown in SEQ ID NO.18 or the gene numbered TraesCS1D03G0307200 in the wheat gene database;

[0024] Select plants with decreased C16:0 or / and C20:0 fatty acid or / and lysophosphatidylglycerol or / and phosphatidylglycerol content in their grains, and increased C20:2 fatty acid or / and lysophosphatidylcholine content.

[0025] In some implementations, the above method (1) or method (2) knocks out genes by using gene editing technology to target AGTTATCCCCGGACAGCATT and GTAGTTTTTACAGGCTTGAT.

[0026] In some implementations, the above method (3) or method (4) knocks out genes by using gene editing technology to target CACCGCGTTCAGCTTCCGCG and GACGCCATCTTCAAGCAGGT.

[0027] The present invention also provides a kit for altering the fatty acid or lipid composition of wheat grains, characterized in that it comprises any one of the following:

[0028] (1) gRNA molecules that can simultaneously recognize AGTTATCCCCGGACAGCATT and GTAGTTTTTACAGGCTTGAT or gRNA molecules that can simultaneously recognize CACCGCGTTCAGCTTCCGCG and GACGCCATCTTCAAGCAGGT.

[0029] (2) The DNA molecule encoding the gRNA described in (1);

[0030] (3) Vectors for expressing the gRNA described in (1).

[0031] In some embodiments, the sequence of the above-mentioned gRNA molecule is AAUGCUGUCCGGGGAUAACUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu and

[0032] GUAGUUUUUACAGGCUUGAUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu, or CACCGCGUUCAGCUUCCGCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu and

[0033] GACGCCAUCUUCAAGCAGGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu.

[0034] The present invention also provides a mutant gene, characterized in that the sequence of the mutant gene is as shown in any one of SEQ ID NO.19, SEQ ID NO.21, SEQ ID NO.23, SEQ ID NO.25, SEQ ID NO.27, SEQ ID NO.29, or SEQ ID NO.31.

[0035] The present invention also provides a mutant protein, characterized in that the sequence of the mutant protein is as shown in any one of SEQ ID NO.20, SEQ ID NO.22, SEQ ID NO.24, SEQ ID NO.26, SEQ ID NO.28, SEQ ID NO.30, or SEQ ID NO.32.

[0036] The present invention also provides the application of the above-described method, or the above-described kit, or the above-described mutant gene, or the above-described mutant protein in altering the fatty acid or lipid composition of wheat grains;

[0037] The fatty acid component includes at least one of C16:0, C18:1, C20:0, C20:1, or C20:2;

[0038] The lipid component includes at least one of digalactodiglyceride, triacylglycerol, diacylglycerol, lysophosphatidylcholine, lysophosphatidylglycerol, phosphatidylglycerol, monogalactodiglyceride, or lysophosphatidylethanolamine.

[0039] The present invention also provides a method for identifying or assisting in the identification of C20:1 fatty acid content in wheat grains, characterized by comprising the following steps: (1) sequentially detecting the base at position 37 of the sequence shown in SEQ ID NO.33 in the test material; (2) if the detection result is A, the C20:1 fatty acid content of the test material grains is low; if the detection result is G, the C20:1 fatty acid content of the test material grains is high.

[0040] The advantages and beneficial effects of this invention are as follows: A new gene significantly associated with the content of C20:1 (eicosapentaenoic acid) was obtained through genome-wide association analysis, and through CRISPR / Cas9 multi-target editing, the targeted regulation of key fatty acid components such as C16:0, C18:1, C20:0, C20:1 and C20:2 and lipid components such as TAG, DAG, LPC and PG was successfully completed, providing a new technical solution for improving wheat lipid metabolism and enhancing nutritional quality. Attached Figure Description

[0041] Figure 1 GWAS gene localization. A: Localization analysis diagram of TaDGAT1-7A genes; B: Content of C20:1 component in materials with two different allelic genotypes.

[0042] Figure 2 Diagram of the TaDGAT1-7 gene editing vector.

[0043] Figure 3 Diagram of the TaDGAT1-1 gene editing vector.

[0044] Figure 4 TaDGAT1-7 gene structure and editing status.

[0045] Figure 5 TaDGAT1-1 gene structure and editing status.

[0046] Figure 6 Fatty acid content of mature seeds. A: Tadgat1-7 mutant; B: Tadgat1-1 mutant.

[0047] Figure 7 Lipid content of mature seeds. A: Tadgat1-7 mutant; B: Tadgat1-1 mutant. Detailed Implementation

[0048] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0049] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the invention are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s *Molecular Cloning: A Lab Manual* (Sambrook J & Russell DW, 2001), or as recommended by the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available and conventional methods well-known to those skilled in the art.

[0050] Example 1: Discovery of the wheat TaDGAT1 gene

[0051] Fatty acids in 311 wheat accessions were analyzed using GC-MS / FID. The main fatty acids identified in wheat grains were C16:0, C18:0, C18:1, C18:2, C20:0, C20:1, and C20:2. By calculating fatty acid content and oil content traits, 32 phenotypic traits were obtained for genome-wide association study (GWAS). Using the C20:1 (eicosenoic acid) trait, the TaDGAT1-7A gene located on chromosome 7A was mapped. Figure 1 A). The promoter region of this gene (partial sequence shown in SEQ ID NO.33) is located at physical location 532699563 bp on chromosome 7A, marked by the SNP AX-29020535, which is significantly associated with the fatty acid component C20:1 (Pvalue = 5.023e-62). Haplotype analysis of AX-29020535 revealed that the C20:1 content (Mol%) of the allele material with A / A at 37 bp of the sequence shown in SEQ ID NO.33 was significantly lower than that of the G / G allele material. Figure 1 B).

[0052] This gene encodes a membrane-bound O-acyltransferase—diacylglycerol acyltransferase (DGAT)—a key synthase and the only rate-limiting enzyme in the biosynthesis of triacylglycerol (TAG). Further analysis of gene expression patterns using the wheat genome database (IWGSC) revealed that six homologous genes (TaDGAT1-7A, 7B, 7D on chromosome 7 and TaDGAT1-1A, 1B, 1D on chromosome 1) were expressed in multiple tissues, with the highest expression level observed in grains.

[0053] The gene TaDGAT1-7A is identified in the database as TraesCS7A03G0878700, with its genome sequence shown in SEQ ID NO.1, coding region sequence shown in SEQ ID NO.2, and encoded protein sequence shown in SEQ ID NO.3; the gene TaDGAT1-7B is identified in the database as TraesCS7B03G0734000, with its genome sequence shown in SEQ ID NO.4, coding region sequence shown in SEQ ID NO.5, and encoded protein sequence shown in SEQ ID NO.6; the gene TaDGAT1-7D is identified in the database as TraesCS7D03G0857200, with its genome sequence shown in SEQ ID NO.7, coding region sequence shown in SEQ ID NO.8, and encoded protein sequence shown in SEQ ID NO.9.

[0054] The gene TaDGAT1-1A is identified in the database as TraesCS1A03G0311400, its genome sequence is shown in SEQ ID NO.10, its coding region sequence is shown in SEQ ID NO.11, and its encoded protein sequence is shown in SEQ ID NO.12; the gene TaDGAT1-1B is identified in the database as TraesCS1B03G0394400, its genome sequence is shown in SEQ ID NO.13, its coding region sequence is shown in SEQ ID NO.14, and its encoded protein sequence is shown in SEQ ID NO.15; the gene TaDGAT1-1D is identified in the database as TraesCS1D03G0307200, its genome sequence is shown in SEQ ID NO.16, its coding region sequence is shown in SEQ ID NO.17, and its encoded protein sequence is shown in SEQ ID NO.18.

[0055] Example 2 Gene Function Identification

[0056] To verify gene function, two pairs of dual-target sgRNAs (AGTTATCCCCGGACAGCATT and GTAGTTTTTACAGGCTTGAT targeting the TaDGAT1-7 gene and CACCGCGTTCAGCTTCCGCG and GACGCCATCTTCAAGCAGGT targeting the TaDGAT1-1 gene) were designed for constructing the CRISPR / Cas9 gene editing vector TaDGAT1-7-sgRNA. Figure 2 ) and TaDGAT1-1-sgRNA ( Figure 3 The promoter and terminator used for the Cas9 gene in the gene editing vector are the commonly used maize UBI promoter and NOS terminator, respectively, while the gRNA is driven by the wheat U6 promoter. The plasmid was then transformed into Agrobacterium EHA105, and the wheat variety Fielder was successfully transformed using the Agrobacterium-mediated wheat immature embryo genetic transformation system.

[0057] After screening and identification, the TaDGAT1 gene was finally identified as a single mutant TaDGAT1-7-aaBBDD (D2-1-3) and a triple mutant TaDGAT1-7-aabbdd (D12-18-12) located on chromosome 7; as well as a triple mutant TaDGAT1-1-aabbdd (GA2-9-8 and GA2-22-2) located on chromosome 1.

[0058] The TaDGAT1-7-aaBBDD(D2-1-3) plant caused a 74bp deletion on chromosome 7A; the TaDGAT1-7-aabbdd(D12-18-12) plant caused deletions of 74bp, 74bp, and 1bp on chromosomes 7A, 7B, and 7D, respectively. Figure 4 The sequence editing details of the TaDGAT1-7 mutant are shown in Table 1.

[0059] Table 1. Gene editing status of TaDGAT1-7A / B / D

[0060]

[0061] TaDGAT1-1-aabbdd(GA2-9-8) caused a 67bp deletion, a 1bp insertion, and a 67bp deletion on chromosomes 1A, 1B, and 1D, respectively; TaDGAT1-1-aabbdd(GA2-22-2) caused a 67bp deletion on chromosomes 1A, 1B, and 1D. Figure 5 The sequence editing details of the TaDGAT1-1 mutant are shown in Table 2.

[0062] Table 2. TaDGAT1-1A / B / D gene editing status.

[0063]

[0064] The fatty acid and lipid content of mature seeds from different types of mutants were determined, and the results are shown in Tables 3 and 4.

[0065] Table 3. Edited fatty acid composition (Mol%) and TAG content (%) of different mutant wheat grains

[0066]

[0067] Note: TAG, triglycerides; the mutant was compared with the control material Fielder using Student's t-test, *: pvalue<0.05, **: pvalue<0.01, ***: pvalue<0.001.

[0068] The fatty acid test results showed that:

[0069] Compared to the wheat variety Fielder, knocking out the TaDGAT1 gene significantly reduced the 18:1 and C20:1 contents in mature grains of the Tadgat1-7 single mutant TaDGAT1-7-aaBBDD (D2-1-3) and the triple mutant TaDGAT1-7-aabbdd (D12-18-12). The C16:0 content in D12-18-12 grains was also significantly lower than the control. Figure 6 A); In two different tri-protrusion materials of Tadgat1-1, GA2-9-8 and GA2-22-2, the contents of C16:0 and C20:0 (arachidic acid) decreased significantly, the contents of C20:2 (arachidic acid) increased significantly, while the contents of C20:1 did not change significantly. Figure 6 B).

[0070] The lipid composition analysis results showed that:

[0071] Compared to the wheat cultivar Fielder, after TaDGAT1-7 gene editing, the contents of digalactosyldiglycerol (DGDG), monogalactosyldiglycerol (MGDG), and lysophosphatidylglycerol (LPG) were significantly reduced in the TaDGAT1-7-aaBBDD(D2-1-3) material; while the contents of triglycerides (TAG) and digalactosyldiglycerol (DGDG) were significantly reduced in the Tadgat1-7-aabbdd material, and the contents of diacylglycerol (DAG), lysophosphatidylcholine (LPC), and lysophosphatidylethanolamine (LPE) were significantly increased. Figure 7 A).

[0072] Editing the TaDGAT1-1 gene did not cause significant changes in TAG, but the levels of lysophosphatidylglycerol (LPG) and phosphatidylglycerol (PG) decreased significantly. Figure 7 B). Furthermore, in GA2-9-8 material, the content of monogalactosyldiacylglycerol (MGDG) was significantly decreased, while the content of diacylglycerol (DAG) was significantly increased. In GA2-22-2 material, the content of lysophosphatidylcholine (LPC) was significantly increased.

[0073] In summary, this invention provides a method for targeted regulation of fatty acid and lipid components in wheat grains based on chromosome location-specific gene editing. By targeting and knocking out the TaDGAT1-7 homologous gene on chromosome 7, a single mutant can be obtained. Alternatively, the mutant gene TaDGAT1-7-aa can be introduced into other wheat materials, both of which can reduce the content of C18:1 and C20:1 fatty acids, digalactosidyldiglyceride (DGDG), monogalactosidyldiglyceride (MGDG), and lysophosphatidylglycerol (LPG) in the grains. This method is suitable for developing wheat products with low unsaturated fatty acids and low glycolipids (such as shelf-stable baked goods), while reducing the risk of membrane lipid oxidation. Triple mutants, or the introduction of the mutant gene Tadgat1-7-aabbdd into other wheat materials, can reduce the content of C16:0, C18:1, and C20:1 fatty acids, DGDG, and triglycerides (TAG) in the grains, while increasing the content of diacylglycerols (DAG), lysophosphatidylcholine (LPC), and lysophosphatidylethanolamine (LPE). This can be applied to the production of functional flours with low fat and high metabolic activity (e.g., enhancing dough extensibility), or to the extraction of health-promoting oils rich in signal lipids (DAG, LPC). By knocking out the TaDGAT1-1 homolog on chromosome 1, or by introducing the mutant gene TaDGAT1-1-aabbdd into other wheat materials, the content of C16:0 and C20:0 can be specifically reduced while the C20:2 level is increased, simultaneously reducing LPG and PG content. This can be used to produce wheat oils fortified with high polyunsaturated fatty acids and to improve the quality of flour products. This technology overcomes the challenge of functional redundancy in wheat hexaploid genes, enabling targeted regulation of grain fatty acids and lipid metabolism components through precise editing, providing an efficient solution for functional food development and healthy breeding.

[0074] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for altering the fatty acid or lipid composition of wheat grains, characterized in that, Including any of the following: (1) Knock out the gene that encodes the sequence shown in SEQ ID NO.1 or the gene that encodes the sequence shown in SEQ ID NO.3 or the gene numbered TraesCS7A03G0878700 in the wheat gene database, and select plants with reduced content of C18:1 or / and C20:1 fatty acids or / and digalactosylglycerol or / and monogalactosylglycerol or / and lysophosphatidylglycerol in the grains; (2) Knock out the following 3 genes simultaneously: (i) The gene encoding the sequence shown in SEQ ID NO.1 or the gene encoding the sequence shown in SEQ ID NO.3 or the gene numbered TraesCS7A03G0878700 in the wheat gene database; (ii) The gene that contains the sequence shown in SEQ ID NO.4 or the gene that encodes the sequence shown in SEQ ID NO.6 or the gene numbered TraesCS7B03G0734000 in the wheat gene database; (iii) The gene that encodes the sequence shown in SEQ ID NO.7 or the gene that encodes the sequence shown in SEQ ID NO.9 or the gene numbered TraesCS7D03G0857200 in the wheat gene database; Select plants with decreased content of C16:0 or / and C18:1 or / and C20:1 fatty acids or / and digalactodiglycerides or / and triglycerides in their grains, and increased content of diglycerides or / and lysophosphatidylcholine or / and lysophosphatidylethanolamine in their grains. (3) Knock out the following 3 genes at the same time: (i) The gene encoding the sequence shown in SEQ ID NO.10 or the gene encoding the sequence shown in SEQ ID NO.12 or the gene numbered TraesCS1A03G0311400 in the wheat gene database; (ii) The gene encoding the sequence shown in SEQ ID NO.13 or the gene encoding the sequence shown in SEQ ID NO.15 or the gene numbered TraesCS1B03G0394400 in the wheat gene database; (iii) The gene encoding the sequence shown in SEQ ID NO.16 or the gene encoding the sequence shown in SEQ ID NO.18 or the gene numbered TraesCS1D03G0307200 in the wheat gene database; Select plants with decreased C16:0 or / and C20:0 fatty acids or / and monogalactosyldiglycerol or / and lysophosphatidylglycerol or / and phosphatidylglycerol content in their grains, and increased C20:2 fatty acids or / and diglycerol content. (4) Knock out the following 3 genes at the same time: (i) The gene encoding the sequence shown in SEQ ID NO.10 or the gene encoding the sequence shown in SEQ ID NO.12 or the gene numbered TraesCS1A03G0311400 in the wheat gene database; (ii) The gene encoding the sequence shown in SEQ ID NO.13 or the gene encoding the sequence shown in SEQ ID NO.15 or the gene numbered TraesCS1B03G0394400 in the wheat gene database; (iii) The gene encoding the sequence shown in SEQ ID NO.16 or the gene encoding the sequence shown in SEQ ID NO.18 or the gene numbered TraesCS1D03G0307200 in the wheat gene database; Select plants with decreased C16:0 or / and C20:0 fatty acid or / and lysophosphatidylglycerol or / and phosphatidylglycerol content in their grains, and increased C20:2 fatty acid or / and lysophosphatidylcholine content.

2. The method according to claim 1, characterized in that, The method (1) or method (2) knocks out genes by using gene editing technology to target AGTTATCCCCGGACAGCATT and GTAGTTTTTACAGGCTTGAT.

3. The method according to claim 1, characterized in that, The method (3) or method (4) knocks out genes by using gene editing technology to target CACCGCGTTCAGCTTCCGCG and GACGCCATCTTCAAGCAGGT.

4. A kit for altering the fatty acid or lipid composition of wheat grains, characterized in that, Including any of the following: (1) gRNA molecules that can simultaneously recognize AGTTATCCCCGGACAGCATT and GTAGTTTTTACAGGCTTGAT or gRNA molecules that can simultaneously recognize CACCGCGTTCAGCTTCCGCG and GACGCCATCTTCAAGCAGGT. (2) The DNA molecule encoding the gRNA described in (1); (3) Vectors for expressing the gRNA described in (1).

5. The reagent kit according to claim 4, characterized in that, The sequence of the gRNA molecule is AAUGCUGUCCGGGGAUAACUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu and GUAGUUUUUACAGGCUUGAUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu, or CACCGCGUUCAGCUUCCGCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu and GACGCCAUCUUCAAGCAGGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu.

6. A mutant gene, characterized in that, The sequence of the mutated gene is shown in any one of SEQ ID NO.19, SEQ ID NO.21, SEQ ID NO.23, SEQ ID NO.25, SEQ ID NO.27, SEQ ID NO.29, or SEQ ID NO.

31.

7. A mutant protein, characterized in that, The sequence of the mutant protein is shown in any one of SEQ ID NO.20, SEQ ID NO.22, SEQ ID NO.24, SEQ ID NO.26, SEQ ID NO.28, SEQ ID NO.30, or SEQ ID NO.

32.

8. The use of the method of claims 1-3, the kit of claims 4-5, the mutant gene of claim 6, or the mutant protein of claim 7 in altering the fatty acid or lipid composition of wheat grains; The fatty acid component includes at least one of C16:0, C18:1, C20:0, C20:1, or C20:2; The lipid component includes one of digalactodiglyceride, triacylglyceride, diacylglyceride, lysophosphatidylcholine, lysophosphatidylglyceride, phosphatidylglyceride, monogalactodiglyceride, or lysophosphatidylethanolamine.

9. A method for identifying or assisting in the identification of C20:1 fatty acid content in wheat grains, characterized in that, The steps include: (1) detecting the base at position 37 of the sequence shown in SEQ ID NO.33 in the test material; (2) if the detection result is A, the content of C20:1 fatty acids in the grain of the test material is low; if the detection result is G, the content of C20:1 fatty acids in the grain of the test material is high.

Images