A method for creating a pepper male sterile line by gene editing

Abstract

The present application relates to a method for creating pepper male sterile line by gene editing, and belongs to the technical field of pepper breeding. The present application inactivates the target gene by site-directed editing of pepper pollen development related genes to obtain edited materials; meanwhile, a back-supplement expression vector of the target gene is constructed and introduced into pepper to obtain back-supplement materials that can maintain fertility; then, the edited materials and the back-supplement materials are crossbred and self-crossed to finally establish a sterile line and a maintainer line that can be stably propagated. The pepper male sterile line created by the present application is stable in fertility and is not affected by environmental conditions, and the sterile line does not contain exogenous editing elements and is high in safety; the sterile line and the maintainer line obtained by using the method can be directly applied to the matching and breeding of hybrid pepper varieties, can effectively overcome the defects of long breeding cycle and complicated steps of traditional pepper male sterile line, greatly shorten the breeding process, improve the breeding efficiency of pepper hybrid advantage utilization, and provide a new technical path for pepper hybrid seed production.

Description

Technical Field

[0001] This invention belongs to the field of chili pepper breeding technology, specifically relating to a method for creating male-sterile chili pepper lines through gene editing. Background Technology

[0002] chili( Capsicum Chili peppers (spp.) are an important vegetable and economic crop worldwide, with numerous varieties, wide adaptability, and significant hybrid vigor. Traditional chili pepper hybrid seed production relies on manual emasculation—that is, removing the stamens from each flower of the female parent when it flowers, followed by artificial pollination with pollen from the male parent. However, chili peppers are small-flowered crops, making manual emasculation difficult, and this process requires meticulous manual operation and is labor-intensive. Using male-sterile lines for hybrid seed production is an ideal way to eliminate manual emasculation, reduce seed production costs, and improve seed purity.

[0003] In the creation of male-sterile lines through genetic engineering, existing technologies mainly employ RNA interference (RNAi). For example, Chinese patent CN105039398A discloses a method for preparing male-sterile materials by silencing the anther-specific gene CaMS1 of pepper using an RNAi vector. However, the shortcomings of this technology are: (1) RNAi inhibits the expression of target genes at the post-transcriptional level and cannot change the DNA sequence itself. Therefore, the sterility trait depends entirely on the continued existence of RNAi transgenes. Once the transgene is lost or the silencing efficiency decreases, the fertility can be restored, which means that the sterile line can never get rid of the transgene state. This does not conform to the modern breeding concept of separating the transgene editing tool from the edited trait; (2) RNAi silences the target gene by knocking it down rather than knocking it out. The silencing efficiency is usually between 70% and 90%. There are significant differences between different transformation events, making it difficult to achieve 100% complete male sterility. Moreover, the sterile plant obtained is unstable and is easily affected by the environment and its fertility can be restored; (3) The sterile line obtained by RNAi technology cannot be matched with the maintainer line for continuous reproduction of sterile offspring. Therefore, it is impossible to stably reproduce sterile materials; (4) This patent only involves the creation of sterile lines and does not provide a matching scheme for maintainer lines, restorer lines and hybrid seed production. It cannot form a complete commercial breeding technology system.

[0004] In recent years, the rapid development of CRISPR / Cas9 genome editing technology has provided a powerful tool for creating precise, stable, and irreversible gene knockouts. Unlike RNAi, CRISPR / Cas9 can directly act on the genomic DNA level, achieving permanent functional knockout of target genes by introducing frameshift mutations or fragment deletions. The resulting gene mutations are stably inherited, and fertility traits are not restored. However, existing sterile materials obtained through gene editing often carry exogenous elements associated with the editing tools (Cas9, sgRNA, etc.), posing a risk of editing drift. During the propagation of sterile lines, residual editing tools may continue to edit maintainer lines or hybrid offspring, leading to new mutations in fertility genes or accidental destruction of fertility genes in restorer lines. This severely affects seed purity and breeding efficiency, making direct application to commercial production difficult.

[0005] Furthermore, even after obtaining male-sterile materials using gene editing, the following key technical obstacles remain: (1) Male sterile plants formed after the target gene is knocked out cannot self-pollinate and produce fruit, making it difficult for sterile materials to be continuously propagated and preserved. Male sterile plants lose their ability to self-pollinate. If there is no matching maintainer line to provide fertile pollen and maintain the sterile trait of offspring, the sterile materials will be lost during the propagation process, making it impossible to achieve large-scale propagation and long-term preservation.

[0006] (2) Although conventional reintroduction transformation can restore fertility at the individual plant level, it is difficult to establish a sterile line / maintainer line system that is compatible with the sterile mutant, can be stably inherited, and can be propagated on a large scale. Existing reintroduction strategies mostly involve reintroducing the complete fertility gene expression cassette into the mutant to restore fertility. However, this method lacks a maintainer line that precisely matches the genotype of the sterile mutant, and cannot achieve stable hybridization between the sterile line and the maintainer line. Therefore, it cannot form a complete breeding system similar to the "three-line system", which restricts the large-scale propagation and commercial application of sterile materials.

[0007] In summary, there is currently no male sterility breeding technology system for chili peppers based on CRISPR / Cas9 site-specific knockout of fertility genes, complete isolation of the editing tool, and a complete maintainer-restorer line system. Therefore, there is an urgent need to develop a chili pepper male sterile line with stable and complete sterility traits, heritable editing tools, and stable propagation and maintenance capabilities, along with its supporting propagation technology system. This would fill the technological gap in chili pepper hybrid seed production and meet the industry's demand for low-cost, high-purity hybrid seeds. Summary of the Invention

[0008] To address the shortcomings of existing technologies, this invention aims to provide a method for creating male-sterile peppers through gene editing. This method involves site-specific editing of genes related to pepper pollen development to inactivate the target gene, resulting in a male-sterile mutant. Simultaneously, a complementation expression vector for the target gene is constructed and introduced into peppers to obtain a maintainer material capable of sustaining fertility. The male-sterile mutant and the complementation maintainer material are then hybridized, self-crossed, and screened using molecular markers to establish stably reproducing male-sterile and maintainer lines. Furthermore, color-coded selection markers are used to achieve rapid sorting of hybrid offspring.

[0009] The technical solution of this invention mainly includes the following: One objective of this invention is to provide a method for creating male-sterile lines of chili peppers through gene editing, comprising the following steps: S1. The fertility gene of pepper (e.g., chili pepper) is edited using the CRISPR / Cas9 gene editing system to knock out the gene, obtaining edited material; candidate material with single-copy transgenic insertion and biallelic mutation of the fertility gene is selected from the T0 generation of the edited material, and the transgenic T-DNA of the candidate material is labeled as A, the fertility gene as B, and the background locus as c, that is, the genotype of the candidate material is Aabbcc; peppers that have not been gene-edited are wild-type restorer lines, and the genotype of wild-type restorer line peppers is aaBBcc; S2. Construct the overexpression complementation material of the pepper fertility gene, screen out the transgenic homozygous single-copy insertion lines as complementation material, and label the transgenic T-DNA of the complementation material as C, that is, the genotype of the complementation material is aaBBBBCC, where genes B and C are linked; S3. Cross the material with genotype Aabbcc with the material aaBBBBCC to obtain the hybrid offspring with genotype aaBbBbCc. Self-fertilize the hybrid offspring to obtain the male-sterile line with genotype aabbBbCc.

[0010] Furthermore, the pepper fertility gene includes cytoplasmic male sterility (CMS) and nuclear male sterility (GMS). In one specific embodiment of the present invention, the pepper fertility gene is the pepper MYB80 transcription factor gene, and the accession number of the pepper MYB80 transcription factor gene in the NCBI gene database is LOC107845708. In another specific embodiment, a homologous gene of the MYB80 transcription factor gene can be selected.

[0011] Furthermore, in a specific embodiment of the present invention, the chili pepper MYB80 transcription factor gene is edited using a CRISPR / Cas9 gene editing system with two targets. The two targets are preferably target 1 and target 2, the sequence of target 1 is shown in SEQ ID NO.1, and the sequence of target 2 is shown in SEQ ID NO.2.

[0012] The second objective of this invention is to provide a method for creating a male-sterile chili pepper line and a maintainer line: the male-sterile line with the genotype aabbBbCc is self-crossed, and materials with the genotype aabbBBCC are selected from the self-crossed offspring to obtain the maintainer line.

[0013] In complex segregating progeny, how to quickly and accurately distinguish between male-sterile lines, maintainer lines, and wild-type restorer lines is a crucial issue hindering the practical application of this technology. In segregating populations of hybrids between gene-edited materials and complement materials, due to the complexity of genotype combinations, relying solely on field phenotypic identification is time-consuming and susceptible to environmental interference. Therefore, a third objective of this invention is to provide a method for rapidly identifying male-sterile lines, maintainer lines, and wild-type restorer lines in peppers. The specific steps include: designing screening primers for the male-sterile line, maintainer line, and wild-type restorer line, wherein the nucleotide sequences of the screening primers are, respectively, upstream primer F3 located at the left boundary of the genome, downstream primer R3 located on the overexpressed complement material T-DNA, and downstream primer R4 located at the right boundary of the genome; placing the primers in the same PCR system for reaction; and identifying the male-sterile line, maintainer line, and wild-type restorer line in peppers based on the number and size of the reaction bands.

[0014] Furthermore, the nucleotide sequence of the upstream primer F3 is shown in SEQ ID NO.7, the nucleotide sequence of the downstream primer R3 is shown in SEQ ID NO.8, and the nucleotide sequence of the downstream primer R4 is shown in SEQ ID NO.9. The amplified bands of F3 and R3 are 290 bp in size, and the amplified bands of F3 and R4 are 220 bp in size.

[0015] Furthermore, if a sample amplifies a single band with a band size of 290 bp, it is a maintainer line; if a sample amplifies a single band with a band size of 220 bp, it is a wild-type restorer line; if a sample amplifies two bands, it is a sterile line.

[0016] The beneficial effects of this invention are: This invention utilizes CRISPR / Cas9 gene editing technology to perform site-specific knockout of fertility genes, achieving permanent loss of function of the target genes. Compared with the reversible silencing at the post-transcriptional level by RNAi, the mutant traits produced by editing are stably inherited in subsequent generations, are not affected by environmental conditions, and do not pose a risk of fertility reversion.

[0017] By genetically isolating the editing tool T-DNA (containing Cas9, sgRNA, and selection marker genes) from fertility mutant materials through self-crossing or backcrossing, sterile materials containing only the target gene mutation and lacking the editing tool are obtained. When this sterile line is used as a maternal parent for hybridization or reproduction, it no longer expresses the Cas9 nuclease and will not produce new editing effects on the normal fertility alleles transmitted by the maintainer line or the genome of the hybrid offspring. This eliminates problems such as accidental damage to fertility genes or decreased seed purity caused by editing drift from the source, making gene-edited sterile lines truly safe for commercial production.

[0018] By constructing an overexpression complement vector (T-DNA) for fertility genes and tightly linking it to endogenous fertility gene loci, it was achieved that all offspring of the maintainer line after self-pollination were maintainer lines (aabbBBCC). After hybridization of the sterile line and the maintainer line, 50% sterile lines (aabbBbCc) and 50% maintainer lines (aabbBBCC) could be stably generated. This solved the problem that sterile lines created based on traditional technologies such as RNAi could not be stably propagated through maintainer lines, making it possible to preserve the germplasm and propagate gene-edited sterile lines on a large scale.

[0019] The boundary-specific triple primer system (F3+R3+R4) designed based on T-DNA insertion flanking sequences can directly distinguish three core materials—sterile lines (two bands), maintainer lines (one 290bp band), and wild-type restorer lines (one 220bp band)—in a single-tube PCR reaction based on the number and size of the bands. The system is simple to operate and does not rely on complex methods such as quantitative PCR or Southern blot, significantly improving the efficiency of large-scale material screening in the breeding process.

[0020] By incorporating visible color markers such as Ruby into maintainer lines, true hybrids and false hybrids can be visually distinguished by the color phenotype during seed germination or seedling stages after hybridization. This method requires no molecular detection, is non-destructive, rapid, and low-cost, making it suitable for large-scale commercial seed production.

[0021] The male-sterile breeding system constructed in this invention can be further combined with pepper haploid induction technology, endowing sterile lines with haploid induction function through gene editing, creating engineering materials that possess both male sterility and haploid induction capabilities. This expansion is expected to solve the production bottlenecks of pepper's small flowers, the difficulty in high-throughput operations for female parent emasculation and artificial pollination, and provide an important platform for the innovation of modern breeding technology for small-flowered crops such as peppers. Attached Figure Description

[0022] Figure 1 PCR gel electrophoresis images of sterile lines, maintainer lines, and wild-type restorer lines. Detailed Implementation

[0023] To facilitate a clearer understanding of the technical content of this invention by those skilled in the art, the invention will be further described below in conjunction with specific embodiments.

[0024] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0025] In the following examples, the parental chili pepper used for gene editing or complementation treatment is the Chaotian chili pepper variety. The core research and development path of this invention is as follows: 1. Creation of Transgenic Male-Sterile Pepper Lines: The fertility gene in peppers was edited using the CRISPR / Cas9 gene editing system to knock out the gene, obtaining edited materials. Candidate materials with a single-copy transgenic insertion and a biallelic mutation in the fertility gene were detected and selected in the T0 generation. The transgenic T-DNA of this material was labeled as A (if only one copy of T-DNA is inserted into the genome, the genotype is Aa), the fertility gene as B (if both alleles of the fertility gene are knocked out, the genotype is bb), and the background locus as c. Therefore, the genotype of this candidate material is Aabbcc, and the wild-type restorer line pepper is aaBBcc.

[0026] 2. Creation of male-sterile maintenance materials in pepper: Overexpression complementation material of this fertility gene was constructed. Single-copy insertion lines were screened in the T0 generation, and homozygous single-copy insertion lines were screened in the T1 generation. The transgenic T-DNA was labeled C. Therefore, the genotype of this material is aaBBBBCC, where genes B and C are linked.

[0027] 3. Editing Tool Segregating Male Sterile Line: An edited mutant material with genotype Aabbcc was crossed with a complement retention material with genotype aaBBBBCC. Molecular identification was performed on the offspring, and target materials without editing vector A and carrying complement element C were selected. These materials were further self-crossed and screened to obtain a male sterile line with genotype aabbBbCc. This material does not contain editing elements such as Cas9, sgRNA, and related selection markers, but retains complement T-DNA.

[0028] 4. Maintainer line creation: The material aabbBbCc is self-crossed. The copy number of the offspring is used for selection to obtain the material aabbBBCC, which is the maintainer line. The maintainer line is crossed with the sterile line. The offspring genotype aabbBbCc is the sterile line, and aabbBBCC is the maintainer line.

[0029] The aabbBbCc genotype material is a transgenic male-sterile line. Other cultivated peppers are used as wild-type restorer lines (genotype aaBBbbcc). Hybrids obtained by crossing the male-sterile line material with the wild-type restorer line can be rapidly sorted using Ruby selection markers.

[0030] 5. Material identification methods: Method for identifying hybrid chili pepper seeds: Hybrid chili pepper seeds are germinated on filter paper and sorted by ruby ​​color marking. Seedlings without color marking are non-GMO hybrids (aaBbbbcc).

[0031] Methods for identifying male-sterile pepper seeds: The specific insertion site of T-DNA (C) was determined using tail-PCR. Boundary sequences were identified, and specific amplification primers were designed. Based on the left boundary, primer F was designed for amplification on the genome, primer Ra for amplification on the T-DNA, and primer Rb for amplification downstream of the genome. PCR identification was then performed. The PCR results for male-sterile lines showed two bands, while those for maintainer lines showed a single band.

[0032] The implementation process of the present invention is illustrated below through specific embodiments: Example 1 (I) Construction of gene editing vectors 1. Target gene identification The pepper gene LOC107845708 was selected as the target gene for editing. Its transcript accession number is XM_016690167.1. Through homology comparison and functional prediction, this gene showed high homology with known key regulatory genes for anther / pollen development in Solanaceae and monocotyledonous plants, playing a crucial role in pollen viability formation. Knockout of this gene led to abnormal pollen development, reduced or complete loss of pollen viability, resulting in a male sterility phenotype.

[0033] 2. Construction of sgRNA expression cassette and CRISPR / Cas9 editing vector (1) sgRNA target design Based on the coding sequence of the target gene LOC107845708, two editing target sites located in the early exon region were selected to increase the probability of obtaining frameshift mutations, premature translation termination, and loss-of-function mutants. The selected target sites are as follows: Target 1: GAGAGGGCAATGGACTCCTG (SEQ ID NO.1) Target 2: TCATCTTACATTGCTCAACA (SEQ ID NO.2) (2) Editing system selection Editing was performed using the CRISPR / Cas9 system. A conventional plant binary expression vector was selected, in which: the Cas9 endonuclease was expressed by a plant constitutive promoter; the sgRNA was expressed by a plant U6 or U3 small RNA promoter; and the vector contained the plant selection marker gene HPT (hygromycin resistance gene) for screening resistance in transformed plants.

[0034] (3) Expression box construction Construction of single sgRNA expression cassettes: Complementary oligonucleotide single strands were designed for target 1 and target 2 respectively. Two oligonucleotides for the same target were mixed in a molar ratio of 1:1 and annealed in a PCR instrument: incubated at 95℃ for 5 min, and then cooled to room temperature at a gradient rate of 0.5℃ / min. The complementary pairing formed a double-stranded DNA adapter with sticky ends.

[0035] The intermediate sgRNA vector was double-digested with two IIS-type restriction endonucleases, BsaI and BbsI, and reacted at 37°C for 4–6 h. The linearized vector fragment was recovered by agarose gel electrophoresis. The annealed double-linked head was mixed with the linear vector at a molar ratio of (3–5):1, and T4 DNA ligase was added. Ligation was carried out overnight at 16°C. The ligation product was transformed into *E. coli* DH5α competent cells. Positive single colonies were screened on antibiotic plates. After identification by shaking, plasmid extraction, restriction enzyme digestion, PCR, and sequencing, two single sgRNA expression vectors carrying target 1 and target 2 were obtained, respectively.

[0036] Construction of a binary vector for dual sgRNA tandem editing The Golden Gate assembly technique was used to complete the tandem assembly of dual sgRNA expression cassettes. Two single sgRNA plasmids and a plant binary vector containing a Cas9 element were extracted and simultaneously digested with the corresponding IIS restriction endonucleases. The target fragments and the vector backbone were then recovered. The two sgRNA expression cassette fragments and the vector backbone were mixed according to the system ratio, and tandem assembly was completed using a simultaneous enzyme digestion-ligation reaction.

[0037] The recombinant product was transformed into E. coli, and after resistance screening, enzyme digestion and sequencing verification, the sgRNA sequence and insertion direction were confirmed to be correct. Finally, a dual sgRNA / Cas9 pepper gene editing binary vector with tandem dual sgRNA, carrying Cas9 expression elements and plant selection markers was obtained.

[0038] (4) Editing carrier components Left boundary sequence LB Plant selection marker expression cassette: 35S-HPT-NOS Cas9 Expression Box: 2×35S Promoters - Cas9-NOS sgRNA1 expression cassette: U6 promoter - target 1 sgRNA scaffold - termination sequence sgRNA2 expression cassette: U6 promoter - target 2 sgRNA scaffold - termination sequence Right boundary sequence RB (II) Construction of overexpression vectors To create male-sterile maintenance materials for chili peppers, an complement overexpression vector for the target gene was further constructed. The complement fragment used the unedited CDS sequence of the target gene (SEQ ID NO. 10) and was driven by a strong promoter (35S). To prevent the complement gene from being recognized and cleaved again by the CRISPR / Cas9 system, synonymous mutations were performed on the sgRNA target site in the complement gene to optimize it. That is, the coding amino acid sequence was not changed, but the target site or PAM sequence was altered to prevent it from being cleaved by Cas9.

[0039] The overexpressed CDS sequence was restored as follows (SEQ ID NO.10): ATGGGAAGAATTCCATGTTGTGAAAAGGACAATGTCAAGA AC G T GC T ATGGA T TCCTGAGGAAGATCACAAGCTTTC T TC C TA T AT C GC CCAACATGGAACTCGTAATTGGCGTCTCATTCCTAAGAATGCTGGTTTACAAAGATGTGGAAAAAGTTGTAGATTGAGATGGACAAATTACCTTAGGCCTGATCTCAAACATGGCCAATTTTCAGAAGCAGAAGAACAAACCATTGTCACACTTCATTCTGTTCTTGGCAATAGATGGTCTGTGATTGCTGCTCAACTGCCAGGTAGAACAGACAATGATGTCAAGAACCATTGGAACACAAAGCTCAAAAAGAGACTATCTGGTATGGGCATTGATCCAGTAACACACAAGCCATTTTCTCACTTAATAAGTGAAATTGCAACAACATTATCTCCACCACAAGTCCCTCATTTAGCAGAAGCAGCACTTGGTTGTTTCAAAGATGAAATGCTTCATCTTTTAACCAAGAAAAGAATTGGTTTTCAGTTTCATCAACAGTTTCCAAATAATGCACCAAGTACTAGTCATGTCAAGAATGAAGAGAATGACACAGTTGAGAAGATCAAGTATGGATTGTCAAGAGCTATTAAGGGAAGTGACAAGAATTGGGAGACAAATGGAGGAGCAACATCTAGTAGTTTTCATGATAATGGTGGATATAGTAACTATAACTTTGCTAATTTGCTTAACGACGAAGACGGTTCACCATGGAACCAAAGTTTGTGTAGTGGAAGCACATGCACAGCAGGAGGAGAATTACAACAACAACAACAACAACAACGTAACAAGAAAACTAGCAATGGTAATTGTGAGGATAGTGGTAAGGAAGTGGTAACAACAAGAAATGGATCAACGACAACTATGTTCAATTCCGACTGTGTTCTGTGGGATATTTCATCTGATGATCTGATGAATCCAATGGTATGA (Note: the underlined positions in the above sequence are the optimized sites after synonymous mutation) Ruby Visual Screening Module: To facilitate offspring screening, a ruby ​​color marker expression module (SEQ ID NO.11) is further incorporated into the complementation vector. The ruby ​​marker module and the complementation expression cassette are located within the same T-DNA segment, forming a linked inheritance pattern. Using this marker, after seed germination, materials containing complemented T-DNA can be rapidly sorted from those without complemented T-DNA based on seedling color.

[0040] (III) Genetic transformation 1. Explant preparation Pepper cotyledon nodes, hypocotyls, or embryogenic tissues that have germinated aseptically for 5-10 days were selected as explants.

[0041] 2. Preparation of Agrobacterium The editing vector or the complementation vector was introduced into the Agrobacterium strain, and single clones were picked and cultured in YEP liquid medium containing the corresponding antibiotics until OD. 600 Approximately 0.4~0.8.

[0042] After centrifugation to collect the bacterial cells, they are resuspended in an inoculation solution, which may contain acetylsuccinone (AS) to improve transformation efficiency.

[0043] 3. Infection and Co-cultivation Immerse the explants in Agrobacterium suspension for 5-20 minutes, blot dry the surface bacterial solution, and place them on a co-culture medium. Incubate in the dark at 22-25°C for 2-3 days.

[0044] 4. Resistance selection and bud regeneration After co-culture, the explants were transferred to a differentiation medium containing antibacterial agents and screening antibiotics to induce adventitious shoot formation. Once the shoots emerged, they were transferred to elongation medium, and then to rooting medium to obtain complete plants.

[0045] 5. Transplanting and acclimatization After the rooted seedlings were washed clean of the culture medium, they were transplanted into the substrate and acclimatized and cultured in a greenhouse to obtain T0 generation transgenic plants.

[0046] Genetic transformation results: A total of 300 explants were infected. After Agrobacterium infection, co-culture, resistance selection, shoot regeneration, rooting, and transplanting acclimatization, 31 resistant regenerated plants were obtained. PCR detection was performed on these resistant regenerated plants, and the results showed that 22 of them were HPT-positive. Amplification and sequencing of the 22 HPT-positive plants revealed that 16 of them underwent editing at the target site. The results showed that the genetic transformation efficiency was 7.3% (22 / 300 ×100%), the PCR positivity rate was 71% (22 / 31 ×100%), and the editing efficiency was 72.7% (16 / 22 ×100%). Genetic transformation efficiency is calculated using the following formula: Genetic transformation efficiency (%) = Number of HPT-positive plants / Total number of infected explants × 100% The PCR positivity rate is calculated using the following formula: PCR positivity rate (%) = (Number of HPT-positive plants / Total number of resistant regenerated plants) × 100% Editing efficiency is calculated using the following formula: Editing efficiency (%) = Number of edited plants / Number of HPT-positive plants × 100% (iv) Molecular detection 1. Positive initial screening: PCR or qPCR detection using HPT primers is used to identify whether the vector contains editing or complementation vectors.

[0047] The following primers for HPT plant resistance genes can be used: F1: CAGCTCTCGGAGGGCGAAGA (SEQ ID NO.3) R1: CTAAACTCCCCAATGTCAAG (SEQ ID NO.4) The internal control uses β-actin primers: F2: AATCAATCCCTCCACCTCTTCACTC (SEQ ID NO.5) R2: CATCACCAGCAAATCCAGCCTT (SEQ ID NO.6) By using relative quantification of HPT and internal control, the T-DNA insertion copy number can be preliminarily determined, and single-copy integrated plants can be screened.

[0048] 2. Editing Site Detection: Amplification primers were designed targeting the gene editing region. PCR amplification was performed on T0 or T1 generation plants, and the PCR products were directly sequenced to determine the editing type. Plants with biallelic mutations, homozygous mutations, or large fragment deletions were screened out.

[0049] 3. Screening of sterile materials without Cas9 editing vectors After obtaining positive plants for the target gene editing, they are self-crossed or backcrossed to separate offspring.

[0050] Simultaneously, the following tests were performed on the offspring: target site editing detection to confirm that the target gene mutation still exists; and Cas9 / HPT PCR detection to confirm that the editing vector components have been isolated and deleted.

[0051] Plants exhibiting biallelic mutations in the target gene and negative results for Cas9, sgRNA, and selection marker sequences were selected as stable male-sterile materials without editing vectors. When used as sterile lines in subsequent trials, these materials will not induce further editing in maintainer lines or hybrid offspring.

[0052] 4. Screening of replenishment and maintenance materials The complemented overexpression transformed lines were subjected to PCR and qPCR detection to screen for single-copy insertion plants; homozygous single-copy lines were further screened in the T1 generation; simultaneously, pollen viability detection, anther morphology observation, and seed setting evaluation were used to determine the restoreability of fertility of the complemented gene. The complemented insertion site was located by TAIL-PCR or whole-genome resequencing, and lines with well-defined insertion sites and genetic stability were selected.

[0053] 5. Three-lineage identification: Design primers for screening sterile lines, maintainer lines, and wild-type restorer lines. F3:ACTCATTAATGAGCTCTATA (SEQ ID NO.7) is located on the left boundary of the genomic (chromosome set).

[0054] R3:ACATGTAATGCATGACGTTA (SEQ ID NO.8) is located on T-DNA.

[0055] R4:TATTCGAGGAGACCCATGTA (SEQ ID NO.9) is located on the right genomic boundary.

[0056] The F3+R3 band size is 290bp, and the F3+R4 band size is 220bp.

[0057] Using 3% agarose gel electrophoresis, the three sets of primers were placed directly in the same PCR system.

[0058] Results analysis: Samples 1, 4, 8, 9, 11, 13, 14, 18, and 21 show a single band with a band size of 290 bp. This sample is a retainer material. Samples 2, 5, 17, and 19 showed a single band with a band size of 220 bp. These samples did not contain T-DNA (C) insertion and were wild-type restorer lines. Samples 3, 6, 7, 10, 12, 15, 16, and 20 show double bands, indicating they are sterile lines.

[0059] Pollen viability, pollen germination, self-pollination and fruit set rate were statistically measured for each material type (wild-type restorer line, maintainer line, and sterile line). The specific methods are as follows: (1) Pollen viability: Fresh pollen from the peak flowering period was collected and its viability was detected using the TTC (2,3,5-triphenyltetrazolium chloride) staining method. Under an optical microscope, viable pollen grains appeared red, while inactive pollen grains were unstained or very lightly stained. Five fields of view were randomly selected from each material, and ≥50 pollen grains were counted in each field of view. Viability (%) = Number of viable pollen grains / Total number of pollen grains × 100.

[0060] (2) Pollen germination rate: The in vitro germination method was adopted. The basic medium containing 15% sucrose and 0.01% boric acid was used as the germination medium. Pollen was evenly sprinkled on the surface of the medium and cultured in the dark at 25℃ for 2-4 hours before observation. Germination was considered to be when the length of the pollen tube reached or exceeded the diameter of the pollen grain. Each material was repeated 3 times, and ≥300 pollen grains were counted each time.

[0061] (3) Self-pollination rate: Before the full bloom period, the female parent was bagged and self-pollinated. After the fruit matured, the number of seeds per fruit and the fruit set rate were counted. At least 20 fruits were counted for each material type.

[0062] (4) Fruit setting rate of hybridization: Using each material as the female parent, emasculate or leave emasculated (sterile line) before the full bloom period, and perform artificial pollination with pollen from the corresponding male parent. Each combination has ≥30 flowers replicated. Observe whether the fruit set is normal after pollination.

[0063] Table 1

[0064] The experimental results are shown in Table 1. The pollen viability, germination rate, and self-pollination set rate of the wild-type restorer and maintainer lines were all at normal levels, indicating that their male ligands were functionally intact and their fertility was normal. In contrast, the pollen viability of the sterile lines was only 0-5%, the pollen germination rate was 0% or extremely low, and the self-pollination set rate was 0%, confirming their complete male sterility phenotype. Furthermore, the sterile lines showed normal fruit set rates when used as female parents, indicating that their female ligands were functionally intact, with only the male ligands being sterile without affecting the fertilization capacity of the pistil, and therefore they could be directly used for hybrid seed production.

[0065] Comparative Example 1 uses a single sgRNA vector targeting point 1 for editing. The vector was constructed and genetically transformed according to the method in Example 1, except that this comparative example only constructed a CRISPR / Cas9 editing vector containing the target 1 sgRNA expression cassette, and the target 1 sequence is the sequence shown in SEQ ID NO.1. The rest of the vector composition is consistent with that in Example 1.

[0066] After the constructed single sgRNA editing vector was introduced into Agrobacterium, pepper explants were genetically transformed to obtain T0 generation resistant plants. Target site analysis was performed on PCR-positive plants to statistically analyze the editing type and fertility phenotype.

[0067] The results showed that a total of 18 T0 generation PCR-positive plants were obtained, of which 12 plants showed editing at the target site, representing an editing rate of 66.7%. Among the 12 edited plants, 8 were monoallelic or chimeric edited plants, accounting for 66.7%; and 4 were biallelic mutant plants, accounting for 33.3%. Further investigation of anther morphology, pollen viability, and fruit set revealed that 3 of the biallelic mutant plants exhibited stable male sterility, and 1 exhibited partial male abortion; most of the remaining monoallelic or chimeric plants retained some fertility.

[0068] Comparative Example 2 used a single sgRNA vector targeting point 2 for editing. The vector was constructed and genetically transformed according to the method in Example 1, except that this comparative example only constructed a CRISPR / Cas9 editing vector containing the target 2 sgRNA expression cassette, and the target 2 sequence is the sequence shown in SEQ ID NO.2. The rest of the vector composition is consistent with that in Example 1.

[0069] After the constructed single sgRNA editing vector was introduced into Agrobacterium, pepper explants were genetically transformed to obtain T0 generation resistant plants. PCR-positive plants were subjected to target site amplification and sequencing analysis, and fertility phenotypes were statistically analyzed.

[0070] The results showed that 20 T0 generation PCR-positive plants were obtained, of which 13 plants showed editing at the target site, representing 65.0% of the total. Among the 13 edited plants, 9 were monoallelic or chimeric edited (69.2%), and 4 were biallelic mutants (30.8%). Further phenotypic investigation revealed that 2 of the biallelic mutant plants exhibited stable male sterility, and 2 exhibited partial male abortion; the remaining plants were mostly fertile or showed only a slight decrease in fertility.

[0071] Comparison of the effects of dual sgRNA tandem editing and single sgRNA editing LOC107845708 was edited using the dual sgRNA tandem editing vector (containing both target 1 and target 2) described in Example 1, and the results were compared with those of Comparative Example 1 and Comparative Example 2. The editing status, the proportion of biallelic mutations, and the proportion of stable male-sterile plants in the T0 generation PCR-positive plants were statistically analyzed.

[0072] The results showed that 22 T0 generation PCR-positive plants were obtained using dual sgRNA tandem editing, of which 16 plants showed editing at the target site, representing an editing rate of 72.7%. Among the 16 edited plants, 10 were biallelic mutants (62.5%); 7 of these showed fragment deletions or frameshift mutations between the two target sites, indicating more thorough disruption of the target gene function. Of the 10 biallelic mutant plants, 9 exhibited stable male sterility, and 1 showed significant abortion but still retained very low levels of pollen viability.

[0073] Table 2

[0074] When editing with a single sgRNA, chimeric mutations, monoallelic editing, or non-frameshift mutations are prone to occur in T0 generation plants, leading to incomplete loss of target gene function. This results in problems such as incomplete pollen abortion and inconsistent fertility phenotypes, with low proportions of biallelic mutations and stable male sterility phenotypes. This invention, by setting two target sites at the beginning of the target gene coding region and employing a dual sgRNA tandem editing strategy, significantly increases the probability of obtaining biallelic loss-of-function mutations and fragment deletions between target sites. It also makes it easier to obtain plants with fragment deletions or frameshift mutations in the target region, resulting in more stable and consistent male sterility phenotypes in offspring, thereby improving the screening efficiency of stable male sterility materials.

[0075] The above description is only a partial embodiment of the technical solution of the present invention. These embodiments are merely illustrative examples intended to help those skilled in the art understand the core concept of the present invention, and are not exhaustive enumerations of all embodiments of the present invention. The scope of protection of the present invention should be determined by the claims. Any adaptive modifications, equivalent substitutions of technical features, further optimizations and improvements made based on the basic principles and concepts disclosed in the present invention are all within the scope of protection of the present invention.

Claims

1. A method for creating male-sterile lines of chili peppers through gene editing, characterized in that, The chili pepper is a bird's eye chili, and the method includes the following steps: S1. The MYB80 transcription factor gene in pepper was edited using the CRISPR / Cas9 gene editing system to knock out the gene and obtain edited material. Candidate material with a single-copy transgene insertion and a biallelic mutation in the fertility gene was selected from the T0 generation of the edited material. The transgene T-DNA of the candidate material was labeled as A, the fertility gene as B, and the background locus as c, i.e., the genotype of the candidate material was Aabbcc. Peppers that were not gene-edited were wild-type restorer lines, and the genotype of the wild-type restorer line peppers was aaBBcc. The accession number of the chili pepper MYB80 transcription factor gene in the NCBI gene database is LOC107845708; The dual target points are target point 1 and target point 2, the sequence of target point 1 is shown in SEQ ID NO.1, and the sequence of target point 2 is shown in SEQ ID NO.2; S2. Construct the overexpression complementation material of the pepper fertility gene, wherein the overexpression complementation material contains the MYB80 transcription factor gene overexpression cds sequence and the Ruby visualization screening module; screen out the transgenic homozygous single copy insertion lines as complementation material, and label the transgenic T-DNA of the complementation material as C, that is, the genotype of the complementation material is aaBBBBCC, wherein genes B and C are linked; The nucleotide sequence of the MYB80 transcription factor gene overexpression cds sequence is shown in SEQ ID NO.10, and the nucleotide sequence of the ruby ​​visualization screening module is shown in SEQ ID NO.11; S3. Cross the material with genotype Aabbcc with the material aaBBBBCC to obtain the hybrid offspring with genotype aaBbBbCc. Self-fertilize the hybrid offspring to obtain the male-sterile line with genotype aabbBbCc.

2. A method for creating a male-sterile chili pepper line and its maintainer, characterized in that, The male-sterile line with genotype aabbBbCc as described in claim 1 is self-crossed, and materials with genotype aabbBBCC are screened from the self-crossed offspring to obtain the maintainer line.

3. A method for rapidly identifying male-sterile lines, maintainer lines, and wild-type restorer lines in chili peppers, characterized in that... The male-sterile line is the male-sterile line created by the method of claim 1, the maintainer line is the maintainer line created by the method of claim 2, and the wild-type restorer line is chili pepper. Screening primers were designed for sterile lines, maintainer lines, and wild-type restorer lines. The nucleotide sequences of the screening primers are as follows: upstream primer F3 located at the left boundary of the genome, downstream primer R3 located on the overexpressed complement material T-DNA, and downstream primer R4 located at the right boundary of the genome. The nucleotide sequence of the upstream primer F3 is shown in SEQ ID NO.7, the nucleotide sequence of the downstream primer R3 is shown in SEQ ID NO.8, and the nucleotide sequence of the downstream primer R4 is shown in SEQ ID NO.

9. The primers were placed in the same PCR system for reaction. If a sample amplifies a single band with a size of 290 bp, it is a maintainer. If a sample amplifies a single band with a size of 220 bp, it is a wild-type restorer line. If the sample amplifies two bands, it is a sterile line.

Images