Logic gate ecl sensing platform based on hcr-dnazyme cascade amplification, preparation method and application

Abstract

The application discloses a logic gate ECL sensing platform based on HCR-DNAzyme cascade amplification, a preparation method and application, relates to the field of nanomaterials and biological detection technology; the application comprises: a hexahedral frame nucleic acid nanostructure which is self-assembled from four skeleton chains, three T1 chains which are modified with mercapto and three T2 hairpin chains which contain a cleavage recognition site; a DNAzyme which is self-assembled from L1, L2 and miRNA-208, and L1 and L2 need to be replaced and released by miRNA-328 and Lock-1, and miRNA-499 and Lock-2 chains; an HCR module which comprises hairpin chains H1 and H2; an ECL signal probe which is prepared by coupling amino-modified RuSiNPs nanoparticles and carboxyl-modified hairpin chain H3; the sensing platform of the application only exists DNAzyme in the system when miRNA-208, miRNA-328 and miRNA-499 exist simultaneously, P1 can be cut from T2, H1 is opened, and the ECL signal can be detected, the specificity is extremely high, the detection limit is low, the linear range is wide, the required equipment is simple, the operation is standardized and easy to implement.

Description

Technical Field

[0001] This invention relates to the fields of nanomaterials and biosensing technology, specifically to a logic gate ECL sensing platform based on HCR-DNAzyme cascade amplification, its preparation method, and its applications. Background Technology

[0002] DNA molecules possess numerous biological characteristics such as programmability, low toxicity, biocompatibility, and selectivity, attracting widespread attention in the field of biomolecular logic operations. Similar to silicon-based electronic gates in integrated circuits, DNA logic gates can perform various computations at the molecular scale. Traditional methods of using single biomarkers as criteria for disease diagnosis are limited by the heterogeneity and diversity of biomarkers. DNA logic gates, however, can respond to single or multiple targets, recognizing and executing logical operations to generate outputs, providing a more accurate method for multi-target detection. Specifically, the AND logic gate's Boolean operation triggers the subsequent signal output only when all inputs are present simultaneously. This logic gate can significantly improve detection accuracy and effectively reduce false positives. Although some progress has been made in this field in recent years, miRNA-based DNA logic gates still face significant challenges due to the high homology and low abundance of miRNA sequences.

[0003] Developing amplification strategies that can effectively convert weak input signals into strong output signals is crucial for realizing high-order logic operations and high-sensitivity biosensing. Among numerous enzyme-free amplification methods, hematoxylin and eosin (HCR) has attracted much attention due to its excellent amplification efficiency and flexible sequence design. This reaction is triggered by single-stranded DNA, driving the spontaneous assembly of two metastable hairpin probes to form a long-chain double-stranded DNA product, thereby achieving autonomous signal amplification. DNAzymes, as DNA molecules with catalytic cleavage capabilities, can specifically recognize and cleave targets, further synergizing with HCR to construct a cascade amplification system, significantly improving detection sensitivity. Compared to methods such as CHA, RCA, and SDR, the combination strategy of HCR and DNAzymes exhibits unique advantages in system compatibility, signal gain, and design flexibility, becoming a key technology for constructing high-performance DNA logic systems.

[0004] Electrochemically generated light through high-energy electron transfer reactions between substances, ECLs offer advantages such as multifunctionality, high stability, low detection limit, low background noise, and simple photon detection. Therefore, ECLs have attracted significant attention from researchers in recent years. Designing a novel logic system with ECL signals as output is crucial for realizing logic gates at relatively low input molecule concentrations and offers significant advantages in practical applications. In summary, constructing a DNA logic gate sensing platform that utilizes a combination of HCR and DNAzyme strategies, outputs ECL signals, targets miRNA input in acute myocardial infarction, and simultaneously possesses excellent detection performance has become an important research direction. Summary of the Invention

[0005] The purpose of this invention is to provide a highly sensitive, highly specific, and low-background ECL sensing platform to achieve accurate and simultaneous detection of multiple characteristic miRNAs of acute myocardial infarction, solving the problems of high false positives and difficulty in detecting trace samples in traditional detection methods.

[0006] To achieve the above objectives, the present invention provides the following technical solution: a logic gate ECL sensing platform based on HCR-DNAzyme cascade amplification, comprising a hexahedral framework nucleic acid nanostructure, a DNAzyme composed of a three-input AND logic reaction, an HCR module, and ECL signal probes H3-NH2-RuSiNPs;

[0007] The four sides of the hexahedral framework nucleic acid nanostructure are self-assembled by backbone chains TSP1, TSP2, TSP3, and TSP4. One end of the tubular structure formed by the four sides is self-assembled with multiple T1 chains with thiol groups modified at the 3' end, which are used to fix the structure to the gold-plated electrode surface via gold-sulfur bonds. The other end is self-assembled with multiple T2 hairpin chains with cleavage recognition sites in the stem-loop region, which are used for DNAzyme-specific cleavage.

[0008] DNAzyme is formed by the self-assembly of L1, L2 and miRNA-208 triple strands. A base pair on L1 is complementary to Lock-1 and exists in the form of L1-Lock-1 double strand, and a base pair on L2 is complementary to Lock-2 and exists in the form of L2-Lock-2 double strand. L1 needs to be released by strand displacement between miRNA-328 and Lock-1, and L2 needs to be released by strand displacement between miRNA-499 and Lock-2.

[0009] The HCR module includes hairpin strands H1 and H2. After the T2 hairpin strand is cleaved, the portion released and attached to the hexahedral framework nucleic acid nanostructure becomes the trigger strand P1. A sequence exposed in P1 is complementary to a sticky end sequence near the 3' end of H1, which is used to recognize and open the H1 hairpin. A sequence at the 5' end of the opened H1 is complementary to a sequence at the 5' end of H2, which is used to recognize and open the H2 hairpin. The sequence exposed in the opened H2 is complementary to a sticky end sequence near the 3' end of H1, which is used to recognize and open another H1 hairpin. This process is repeated to form a long-chain DNA double helix polymer.

[0010] The ECL signal probe is prepared by introducing amino groups into the surface of RuSiNPs nanoparticles through APTES modification, and then covalently coupling it with hairpin DNA H3 modified with a carboxyl group at the 5' end via an amide bond. The 3' end sequence of the H3 chain on the ECL signal probe is complementary to the 3' end exposed sequences of H1 and H2 on the long chain of the HCR product, and is used to introduce ECL luminescent material.

[0011] The sequences TSP1, TSP2, TSP3, TSP4, T1, and T2 are SEQ ID No. 4 to SEQ ID No. 9 in the sequence list, and the sequences P1, L1, L2, Lock-1, Lock-2, H1, H2, and H3 are SEQ ID No. 11 to SEQ ID No. 18 in the sequence list, respectively.

[0012] Preferably, in the above-mentioned hexahedral framework nucleic acid nanostructure, the molar ratio of TSP1, TSP2, TSP3, TSP4, T1, and T2 is 1:1:1:1:3:3.

[0013] Preferably, in the above DNAzyme, the molar ratio of L1, L2, and miRNA-208 is 1:1:1; in the strand replacement of L1 release, the molar ratio of miRNA-328 and Lock-1 is 1:1; and in the strand replacement of L2 release, the molar ratio of miRNA-499 and Lock-2 is 1:1.

[0014] Preferably, the 3' end of the T1 chain is modified with a C6 thiol group protected by a disulfide bond to ensure that there are no free thiol groups during the assembly stage.

[0015] Another technical solution provided by the present invention: the method for preparing the above-mentioned sensing platform includes the following:

[0016] S1 uses annealing to self-assemble TSP1, TSP2, TSP3, TSP4, T1, and T2 into a hexahedral framework nucleic acid nanostructure;

[0017] After S2 polishing, the glassy carbon electrode is immersed in chloroauric acid solution for electrodeposition to obtain a gold-plated electrode modified with gold nanoparticles. A hexahedral framework nucleic acid nanostructure solution is dropped onto the surface of the gold-plated electrode and fixed to the surface of the gold-plated electrode through the thiol-sulfur bond at the end of the T1 chain, and then sealed with MCH.

[0018] S3 anneals L1 and Lock-1 to form a double chain, and anneals L2 and Lock-2 to form a double chain.

[0019] S4 prepared amino-modified RuSiNPs by modifying the surface of RuSiNPs nanoparticles with APTES to introduce amino groups. The amino-modified RuSiNPs were then reacted with hairpin DNA H3 modified with a 5' carboxyl group in PBS buffer to prepare ECL signal probe H3-NH2-RuSiNPs.

[0020] Preferably, in step S1 above, the T1 chain is first added to the mixture containing TCEP and Mg. 2+ The hexahedral framework nucleic acid nanostructure solution was incubated in Tris-HCl buffer at 37°C for 30 min, and then the remaining strands were dissolved in the buffer and annealed at 95°C for 5 min. The resulting solution was stored at 4°C.

[0021] Preferably, in step S2 above, electrodeposition is performed using a 1% chloroauric acid solution, and electrodeposition is performed at -0.2V for 40 seconds using a constant potential method.

[0022] Preferably, in step S3 above, during the preparation of the two duplexes, all single chains are added at the same concentration to a pH of 7.4 containing Mg. 2+ It was prepared by heating at 90°C for 10 min in a Tris-HCl buffer solution containing NaCl.

[0023] Preferably, in step S4 above, RuSiNPs are dispersed in anhydrous ethanol, APTES are added and stirred to react, and the mixture is washed several times by centrifugation with anhydrous ethanol. The product is dispersed in ultrapure water to obtain an aminolated RuSiNPs solution, washed once by centrifugation with PBS buffer, and resuspended in PBS buffer containing EDC and NHS. After activation at room temperature, hairpin DNA H3 is added, and the mixture is brought to a final volume with PBS. The reaction is carried out at room temperature in the dark by shaking. After the reaction is completed, the uncoupled DNA is removed by centrifugation and washing several times. The obtained probe is dispersed in PBS buffer and stored at 4°C in the dark.

[0024] Another technical solution provided by the present invention is the application of the above-mentioned sensing platform in the combined detection of serum miRNA in acute myocardial infarction for non-diagnostic purposes.

[0025] Preferably, sufficient amounts of the two double-stranded DNAs and the test sample are incubated at 37°C for 2 hours. This step is to obtain an active DNAzyme in the presence of three miRNAs. Although in principle, the ratios of L1, L2, miRNA-208, miRNA-328, miRNA-499, Lock-1, and Lock-2 are equal, in actual testing, the content of the three miRNAs in the test sample is unknown. Therefore, for reference only, sufficient amounts of the two double-stranded DNAs can be added according to actual needs. Specifically, the maximum possible content of the three miRNAs in the sample can be determined, or multiple sets of experiments can be set up with different amounts of the two double-stranded DNAs added respectively. From the final test results, the groups with the highest and similar results are considered to have sufficient amounts. Alternatively, an excess can be added directly, as the electrode will be rinsed after incubation to remove unbound reactants, and an excess will not affect the results.

[0026] The reaction solution after 2 hours of incubation was dropped onto the surface of a gold-plated electrode with a hexahedral framework nucleic acid nanostructure immobilized, and incubated at 37°C for 30 minutes (10 μL or other volumes can be added quantitatively for easy calculation). Sufficient amounts of H1 and H2 were added to the electrode surface, and the electrode was incubated at 37°C for 3 hours. Sufficient ECL signal probes were then added to the electrode surface, and the electrode was incubated at 37°C in the dark for 2 hours (as mentioned above, since the cascaded long-chain DNA double helix polymer can theoretically extend indefinitely, and since unbound reactants are removed by rinsing the electrode after incubation, excess H1, H2, and probes will not affect the results). After each incubation, the electrode surface was rinsed with PBS buffer to remove unbound reactants. Finally, the ECL signal was detected in the co-reaction mixture, with a scan voltage of 0–1.3 V, a scan rate of 100 mV / s, and a photomultiplier tube voltage of 800 V. An ECL signal with an intensity higher than the threshold could be detected only when miRNA-208, miRNA-328, and miRNA-499 were simultaneously present in the sample.

[0027] Compared with the prior art, the beneficial effects of the present invention are:

[0028] The sensing platform of this invention employs a three-input AND molecular logic, which is highly specific and eliminates false positives. This invention constructs a strict three-input DNA AND logic gate, which can only complete strand substitution, assemble active DNA zyme, initiate subsequent HCR amplification, and output a strong ECL signal when three AMI markers, miRNA-328, miRNA-499, and miRNA-208, are present simultaneously. There is no significant luminescent response when a single or any two miRNA inputs are present, which can completely distinguish non-myocardial injury cardiovascular samples and greatly reduce the probability of false detection.

[0029] The sensing platform of this invention utilizes a dual cascade amplification of HCR and DNAzyme, achieving ultra-high detection sensitivity through pre-DNAzyme specific cleavage and release of the trigger strand, followed by HCR enzyme-free chain amplification for in-situ growth of long DNA nanowires, resulting in synergistic dual signal amplification. Combined with a high-efficiency RuSiNPs silicon-based ruthenium luminescent probe, covering a linear range of 10 fM-10 nM and a detection limit as low as 0.8 fM, it can accurately capture trace amounts of miRNA in serum samples, outperforming single cascade amplification sensing platforms.

[0030] The sensing platform of this invention adopts a hexahedral framework nucleic acid regular interface to improve target capture efficiency. The DNA hexahedral scaffold is fixed to the surface of the gold electrode by thiol group positioning. The probe spatial orientation is controllable and the spacing is uniform, which can avoid spatial steric hindrance caused by disordered DNA entanglement. Compared with free DNA modified electrode, the target miRNA capture efficiency is improved by more than 40%, while significantly reducing non-specific adsorption background noise.

[0031] The sensing platform of this invention uses RuSiNPs silicon shell to encapsulate the light-emitting probe, which has excellent stability. The SiO2 shell encapsulates Ru(bpy)3. 2+ The light-emitting unit isolates oxidants and reductants in the electrochemical system, inhibiting leakage of light-emitting molecules and photobleaching; DLS, Zeta potential, XPS, and TEM / SEM characterization confirmed that the nanoparticles are monodisperse and have uniform elemental distribution. The RSD of the signal in multiple consecutive ECL scans is only 4.94%, and the signal attenuation is weak over long-term storage.

[0032] The sensing platform of this invention has good adaptability to complex serum matrices and high application potential. In a 10% diluted serum system, the logical recognition rules and linear detection performance are highly consistent with the buffer system, and the interference from serum proteins and miRNAs is weak. It can be directly used for rapid detection of serum samples. In addition, the nucleic acid sequence of the sensing platform of this invention is modular and replaceable. By changing the Lock and L recognition chains, it can be extended to the detection of other miRNA biomarkers.

[0033] The sensing platform of this invention is simple to use and has a controllable detection process. Quantification can be completed with just a conventional electrochemiluminescence analyzer, without the need for large and precision equipment such as PCR instruments and fluorescence confocal analyzers. All incubation steps can be completed at a constant temperature of 37°C. The operation is standardized and easy to apply to actual detection. Attached Figure Description

[0034] Figure 1 This is a schematic diagram of the sensing platform construction principle of the present invention. The diagram includes the processes of DNA hexahedral self-assembly, electrode fixation, target miRNA strand replacement, DNAzyme cleavage, HCR amplification, and ECL probe binding. It is clear that complete signal output is initiated only when miRNA-328, miRNA-499, and miRNA-208 coexist.

[0035] Figure 2 The image shows the characterization of RuSiNPs nanomaterials. TEM and SEM images show that RuSiNPs are spherical, uniform in size, and well dispersed. EDS surface distribution confirms that Si, O, and Ru elements are uniformly distributed. XPS detected characteristic peaks of Si and Ru, proving that silicon-coated ruthenium nanoparticles were successfully prepared.

[0036] Figure 3 The hydrated particle size of RuSiNPs gradually increased after being naked RuSiNPs, aminoated RuSiNPs, and coupled with the H3 probe, and the Zeta potential showed a regular shift, proving that the hairpin DNA H3 was successfully covalently coupled to the surface of RuSiNPs.

[0037] Figure 4 To verify nucleic acid assembly and cleavage using PAGE gel electrophoresis: Figure 4 A represents the stepwise assembly of the hexahedron: as TSP1-TSP4, T1, and T2 are added sequentially, the band migration rate decreases and the molecular weight increases, proving that the hexahedron framework is successfully self-assembled. Figure 4 B is the DNAzyme cleavage verification: cleavage product bands appear only when L1, L2, and miRNA-208 are present simultaneously, verifying the component dependence of the cleavage reaction.

[0038] Figure 5 Validation of HCR and three-input AND logic gates using PAGE gel: Figure 5 A represents HCR amplification: Stepped long bands appear only when the cleavage product P1 trigger strand is present, confirming that HCR is strictly dependent on P1 initiation; Figure 5 B is a three-input AND gate: a P1 band appears when only three miRNAs are added simultaneously, and no product is produced when only one or any two are added, thus verifying the AND logic operation rule.

[0039] Figure 6 To optimize the experimental conditions, the optimal parameters were determined by gradient optimization: TPrA concentration of 50 mM and HCR incubation time of 3 h, at which point the ECL signal reached its peak.

[0040] Figure 7 Electrochemical characterization of the stepwise modification of the electrode showed that the interfacial impedance gradually increased and the final ECL was significantly enhanced, verifying that each step of the modification and reaction was successfully completed.

[0041] Figure 8 The ECL response of the three-input AND logic gate in the buffer solution is high only when the three targets coexist, while the signals of the single / dual targets and the blank group are extremely low. The logic truth table and heatmap intuitively demonstrate that the platform has excellent molecular logic recognition specificity.

[0042] Figure 9 Quantitative performance, stability, and selectivity of the sensing platform of this invention:Figure 9 (AC) includes a logarithmic linear correlation between the ECL signal and the target concentration, with a detection limit of 0.8 fM (10 fM-10 nM), validating its highly sensitive quantitative capability; Figure 9 D-type displays show minimal ECL fluctuations and excellent stability during continuous scanning. Figure 9 E showed no significant response in the miR-21, miR-155, and miR-133 interference groups, demonstrating that the system has high selectivity for recognizing the three target miRNAs.

[0043] Figure 10 The three-input AND logic gate response in 10% serum showed that the logic output results in serum and buffer were completely consistent, with only a slight difference in absolute signal intensity. This demonstrates that the sensor maintains good logic response performance in complex serum matrices and has the potential for clinical monitoring and early diagnosis applications.

[0044] Figure 11 The platform demonstrates good linearity in serum samples for quantitative detection, with minimal ECL signal deviation between the buffer and serum systems at the same concentration. This confirms that the platform can be directly used for the quantitative detection of miRNA in clinical serum samples from patients with acute myocardial infarction (AMI), and possesses clinical translational potential. Detailed Implementation

[0045] This invention addresses the limitations of traditional methods that use a single biomarker as a standard for disease diagnosis, which are subject to the heterogeneity and diversity of biomarkers. It employs an AND logic gate Boolean operation, where subsequent signal output is triggered only when all inputs are present simultaneously. Its core parameters and functions are as follows:

[0046] Three-input AND logic operation rule: define miRNA-328, miRNA-499, and miRNA-208 as inputs A, B, and C respectively. The output is "1" only when A=B=C=1 (all of them exist) (ECL signal>1800arb.units), and the output is "0" for the other 7 combinations.

[0047] Strand displacement and DNAzyme assembly pathway: miRNA-328 undergoes Toehold-mediated strand displacement with Lock-1, releasing L1; miRNA-499 undergoes strand displacement with Lock-2, releasing L2; L1, L2, and miRNA-208 assemble into an active DNAzyme. These three recognition events are cascaded to form an AND logic operation.

[0048] To effectively avoid the problems of disordered probe arrangement, large steric hindrance, low recognition efficiency, and severe non-specific adsorption in traditional sensor interfaces, this invention uses hexahedral framework nucleic acids at the ECL biosensor interface, which has good operability such as structural stability, probe orientation, and probe spacing, and can effectively improve the capture efficiency of target molecules.

[0049] Hexahedral framework assembly: The T1 chain was added to 10 mM Tris-HCl buffer (110 mM TCEP, 10 mM Mg). 2+ The TSP1, TSP2, TSP3, TSP4, and T2 chains were then dissolved in the buffer solution (1 mM EDTA, pH 7.4) and incubated at 37°C for 30 min. The resulting framework nucleic acid was then stored at 4°C for later use.

[0050] Scaffold functional design: The 3' end of the T1 chain is modified with a C6 thiol group (-SHC6) to orient and fix the hexahedral scaffold to the gold-plated electrode surface via gold-sulfur bonds (Au-S); the T2 hairpin chain extends outward to the vertices of the hexahedron, and its stem-loop region contains an rA cleavage recognition site (specifically the sequence 5'-ACTATrAGGA-3'), which facilitates the DNAzyme's access and specific cleavage; the remaining four TSP chains (TSP1-TSP4) constitute the main framework, maintaining the stability of the hexahedral structure.

[0051] The DNA hexahedral scaffold arranges the T2 hairpin probes in an orderly manner at the electrode interface, effectively reducing non-specific aggregation and steric hindrance effects between probes, improving the uniformity and efficiency of target recognition and cleavage reactions, and providing a good interfacial reaction environment for subsequent HCR amplification.

[0052] This invention addresses the shortcomings of traditional miRNA detection methods, such as insufficient sensitivity and limited specificity, by constructing an HCR-DNAzyme cascade amplification system. Its core parameters and functions are as follows:

[0053] DNAzyme assembly structure: The DNAzyme is formed by the assembly of L1, L2, and miRNA-208 through base complementarity pairing. It contains two catalytic core domains and is located in Mg. 2+ With the assistance of (10mM) , it specifically recognizes and cleaves the rA site on the T2 hairpin. The 5' ends of L1 and L2 each contain a DNAzyme active arm sequence, which forms a complete "8-17"-like three-dimensional DNAzyme conformation after binding with miRNA-208. It has high catalytic efficiency, precise cleavage site (recognizing rA monophosphate bond), and is in an inactive dissociated state when there is no target, ensuring low background signal.

[0054] HCR hybridization chain amplification: After the T2 hairpin is cleaved, the trigger strand P1 (sequence: AGCCGATAGTATGACCCTCTGTACAGGACATCGAATAGTCTTTTATTACACTATA) is released. P1 recognizes and opens the H1 hairpin through its sticky ends (5'-CATCGAATAGTC-3'). The exposed sequence further opens the H2 hairpin, and the exposed sequence of the opened H2 hairpin is used again to recognize and open the H1 hairpin, cascading sequentially to form a long DNA double helix polymer. HCR amplification efficiency is high (a single trigger strand can initiate approximately 10...). 2 -10 3 (The product is assembled in pairs of hairpins, is stable, and does not require the participation of proteases, effectively avoiding non-specific amplification.)

[0055] Cascade Synergistic Effect: DNAzyme converts each target miRNA-208 molecule into multiple P1 trigger chains (enzymatic cleavage cycle). P1 further initiates the HCR chain reaction, achieving stepwise signal transduction and exponential amplification from "target → DNAzyme → P1 → HCR long chain", with a total amplification factor of up to 10. 5 -10 6 This order of magnitude provides a high-sensitivity foundation for ECL signal output.

[0056] This invention targets traditional free Ru(bpy)3 2+ To address the issues of limited signal strength, easy photobleaching, and leakage of markers, RuSiNPs nanoparticles were used as ECL signal probes. Their core parameters and functions are as follows:

[0057] Nanoparticle synthesis: Triton X-100 (surfactant), 1-hexanol (co-surfactant), cyclohexane (oil phase), and Ru(bpy)3 were combined. 2+ (Luminescent precursors) were mixed in a volume ratio of 1.77:1.8:7.5:0.34 and stirred at room temperature for 20 minutes to form a water-in-oil microemulsion. TEOS (silicon source) and NH4OH (catalyst) were added for hydrolysis and condensation. After reacting for 24 hours, the emulsion was broken with acetone. After centrifugation and washing with ethanol and water, monodisperse spherical RuSiNPs with a particle size of 50±5nm and PDI<0.1 were obtained.

[0058] Amination and DNA Coupling: A amino group (-NH2) was introduced into the surface of RuSiNPs via APTES modification, increasing the zeta potential from -8.5 mV to +3 mV. After activation with EDC / NHS, hairpin DNA H3 modified with a 5' carboxyl group was covalently coupled to the NH2-RuSiNPs surface. Following coupling, the zeta potential decreased to -24.6 mV, and the hydrated particle size increased from 450 nm to 1100 nm, demonstrating successful H3 immobilization.

[0059] ECL luminescence properties: Approximately 1.2 × 10⁻⁶ ppm is embedded within each RuSiNP. 4 3 Ru(bpy) 2+ In the presence of TPRA co-reactant, Ru(bpy)3 2+ It is electrochemically oxidized to Ru(bpy)3 3+ It reacts with TPRA free radicals to produce excited-state Ru(bpy)3 2+ *, after deexcitation, it emits strong electrochemiluminescence (λ). max (≈620nm). The ECL signal intensity of a single nanoparticle is equivalent to that of free Ru(bpy)3. 2+ 10 4 This significantly improves detection sensitivity.

[0060] The following embodiments further illustrate the content of the present invention. However, the following embodiments are only some optional implementations of the present invention and should not be regarded as an absolute limitation of this application. In addition, some well-known knowledge in the art is not described in detail in the following embodiments (such as the fact that DNA binding requires the assistance of Mg ions, the specific process of DNA annealing reaction, etc.), which will not cause misunderstanding to those skilled in the art.

[0061] The raw materials, reagents, and instruments used in the examples are as follows:

[0062] Synthesis and DNA Modification Reagents of RuSiNPs

[0063] Tris(hydroxymethyl)aminomethane (Tris): 10 mM, used to prepare buffer solutions for pH adjustment, purchased from Sangon Biotech (Shanghai) Co., Ltd. TritonX-100: 0.3 M (approximately 20% by volume), used as a surfactant to form water-in-oil microemulsions, purchased from Sigma-Aldrich. 1-Hexanol: approximately 12% by volume, used as a co-surfactant to synergistically stabilize the microemulsion system, purchased from Sinopharm Group. Cyclohexane: approximately 50% by volume, used as the oil phase medium to form the continuous phase of the microemulsion, purchased from Sinopharm Group. Tetraethyl orthosilicate (TEOS): ≥98% purity, used as a silicon source for the formation of the silica shell, purchased from Shanghai Titan Technology Co., Ltd. Ruthenium tripyridine (Ru(bpy)3Cl2·6H2O): 40 mM, used as an electrochemiluminescence precursor and signal source, purchased from Sigma-Aldrich. Ammonia (NH4OH): 28% concentration, used as a catalyst to promote the hydrolysis and condensation reaction of TEOS, purchased from Sinopharm Group. Acetone: Analytical grade, used for demulsification and centrifugation washing, purchased from Sinopharm Group. 3-Aminopropyltriethoxysilane (APTES): Purity ≥99%, used for amination modification of RuSiNPs surface, purchased from Sigma-Aldrich. Ethanol: Anhydrous grade, used for washing and dispersing nanoparticles, purchased from Sinopharm Group. PBS buffer: pH 7.4, used for the coupling reaction of DNA and nanoparticles, purchased from Sigma-Aldrich. 1-Ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC): Concentration 20 mM, used to activate the carboxyl groups on the surface of amination RuSiNPs, purchased from Sigma-Aldrich. N-Hydroxysuccinimide (NHS): Concentration 10 mM, synergistically acts with EDC to stabilize the active intermediate, purchased from Sigma-Aldrich.

[0064] Nucleic acid assembly and modification reagents

[0065] All DNA strands (TSP1, TSP2, TSP3, TSP4, T1, T2, T3, P1, L1, L2, Lock-1, Lock-2, H1, H2, H3) were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The 3' end of strand T1 was modified with a C6 thiol group (-C6HS-SH), and the 5' end of strand H3 was modified with a carboxyl group (COOH). The / rA / (modified as RNA-A by Sangon Biotech) in T2 served as the cleavage recognition site. miRNAs (miRNA-328, miRNA-499, miRNA-208) were synthesized by Shanghai Gemma Gene Pharmaceutical Co., Ltd., and purified by HPLC. Specific sequences are shown in Table 1 below.

[0066] Table 1 DNA and RNA sequences

[0067] miRNA-328 CUGGCCCUCUCUGCCCUUCCGU miRNA-499 UUAAGACUUGCAGUGAUGUUU miRNA-208 AAGCUUUUUGCUCGAAUUAUGU TSP1 TCGCTGAGTATTTGAGGGTCACACTATCGGCTATTGCAAGTGTGGGCACGCACACATTAATAGGAGCTCCAGTGCTACGGAAGTTTGCACAAATCTG TSP2 CCACACTTGCTTTGAGGGTCATACTATCGGCTATTCTGACCAGTGTCAGCAAACCTTTTAATACCAGATGGAGTGCTACTGAAGTTTGTGTGCGTGC TSP3 CACTGGTCAGTTTGAGGGATGGTCAACTGCTCGTTCTACCGATAGCCGCTAGTTGTTTTAATACCAGATGGAGTGCTACTGAAGTTAGGTTTGCTGA TSP4 CTATCGGTAGTTTGAGGGTCATACTATCGGCTATTTACTCAGCGACAGATTTGTGCTTTAATACCAGATGGAGTGCTACTGAAGTTACAACTAGCGG T1 CTTCAGTAGCACTCCATCTGGTATTATTTTTT-C6HS-SH T2 AGCCGATAGTATGACCCTCTGTACAGGACATCGAATAGTCTTTTATTACACTAT / rA / GGAAGGGCAGATTTTGACTATTCGA T3 AGCCGATAGTATGACCCTCTGTACAGGACATCGAATAGTCTTTTATTACACTATAGGAAGGGCAGATTTTGACTATTCGA P1 AGCCGATAGTATGACCCTCTGTACAGGACATCGAATAGTCTTTTATTACACTATA L1 TCTGCCCTTCTCCGAGCGCAAAAAGCTT L2 ACATAATTCGACGGACGAAAATAGTGTAAGACATTG Lock-1 CGGAGAAGGGCAGAGAGGGCCAG Lock-2 AAACATCACTGCAAGTCTTACACTAT H1 CATCGAATAGTCCTGACTGACTATTCGATGTCCTGTACCCTCAGATGTACGTA H2 AGTCAGGACTATTCGATGACAGGACATCGAATAGTCACCCTCAGATGTACGTA H3 COOH-TTTTTTTTTACGTACATCTGAGGGT

[0068] As shown in Table 1, several bases at the 3' end of hairpin DNA T2 are complementary to a segment of bases in the middle. A cleavage recognition site rA is modified between the two complementary base segments to form a hairpin stem-loop structure, in which the loop exposes the rA site for DNAzyme recognition and cleavage. Hairpin DNA T3 serves as a control sequence, whose sequence is basically the same as T2 but does not contain the rA cleavage site (corresponding to position A), and is used to verify the rA dependence of the cleavage reaction.

[0069] The DNA hexahedral functional scaffold is formed by the self-assembly of six DNA strands—TSP1, TSP2, TSP3, TSP4, T1, and T2—through complementary base pairing. Among them, TSP1, TSP2, TSP3, and TSP4 are four backbone strands that constitute the main body of the hexahedral framework, maintaining the rigidity and stability of the three-dimensional nanostructure. The 3' end of the T1 strand is modified with a C6 thiol group (-C6HS-SH), which is used to orient and fix the hexahedral scaffold to the gold-plated electrode surface through gold-sulfur bonds. The T2 hairpin strand extends outward to the vertices of the hexahedron, and its loop contains rA cleavage recognition sites, which facilitate the DNAzyme to approach and specifically cleave the DNA, releasing the P1 trigger strand after cleavage.

[0070] P1 is the trigger strand fragment generated after the T2 hairpin is cleaved by DNAzyme. Its sequence covers the region from the 5' end to the rA site and is used to initiate the subsequent HCR reaction.

[0071] L1 forms double-stranded substrates with Lock-1, and L2 forms double-stranded substrates with Lock-2. A base from the 3' end of the L1 strand pairs complementaryly with the Lock-1 strand, while a base from the 5' end of the L1 strand is retained as a single-stranded DNAzyme active arm sequence, used for DNAzyme assembly. Similarly, a base from the 3' end of the L2 strand pairs complementaryly with the Lock-2 strand, and a base from the 5' end of the L2 strand is retained as a single-stranded DNAzyme active arm sequence. In the presence of miRNA-328, it undergoes Toehold-mediated strand displacement with Lock-1, releasing L1. In the presence of miRNA-499, it undergoes strand displacement with Lock-2, releasing L2. The released L1 and L2, in the presence of miRNA-208, assemble through complementary base pairing to form a catalytically active DNAzyme assembly structure that specifically cleaves the rA site on the T2 hairpin.

[0072] H1 and H2 are two metastable hairpin probes for the HCR reaction. The portion of the T2 hairpin strand released after cleavage and attached to the hexahedral framework nucleic acid nanostructure is the trigger strand P1. A sequence exposed in P1 is complementary to a sticky end sequence near the 3' end of H1, which is used to recognize and open the H1 hairpin. A sequence at the 5' end of the opened H1 is complementary to a sequence at the 5' end of H2, which is used to recognize and open the H2 hairpin. The sequence exposed in the opened H2 is complementary to a sticky end sequence near the 3' end of H1, which is used to recognize and open another H1 hairpin. This process is repeated to form a long DNA double helix polymer.

[0073] The 5' end of the H3 chain is modified with a carboxyl group (-COOH), which is used to covalently couple to the surface of aminated RuSiNPs via amide bonds to prepare ECL signal probes H3-NH2-RuSiNPs. The 3' end sequence of the H3 chain is complementary to the exposed sequence on the long chain of HCR product, so as to achieve specific binding of the signal probe on the electrode surface and introduce ECL luminescent material into the sensing interface.

[0074] DNA activation

[0075] Tris-HCl buffer: 40 mM, pH 8.0, for DNA annealing reaction, purchased from Shanghai Sangon Biotech. Magnesium chloride (MgCl2): 100 mM, for activating DNAzyme activity, purchased from Sigma-Aldrich.

[0076] ECL Electrode Modification and Detection Reagents

[0077] Chloroauric acid (HauCl4): 1% by mass, used for electrodeposition of gold nanoparticles on the electrode surface, purchased from Sinopharm Group. Alumina powder: 0.3 μm particle size, used for polishing pretreatment of glassy carbon electrodes, purchased from Shanghai Sangon Biotech. 6-Mercaptohexanol (MCH): 1 mM concentration, used to seal unreacted gold active sites on the electrode surface and reduce non-specific adsorption, purchased from Sigma-Aldrich. Tri-n-propylamine (TPrA): 0.05 M concentration, used as a co-reactant for ECL, in conjunction with Ru(bpy)3. 2+ The electrochemiluminescence signal was generated synergistically and was purchased from Sinopharm Group. Phosphate-buffered saline (PBS): 0.05 M, pH 7.4, used to prepare the co-reactant solution and wash the electrode, was purchased from Sigma-Aldrich. Tris(hydroxymethyl)aminomethane (Tris): 10 mM, pH 7.4, containing 10 mM Mg... 2+100mM NaCl, used to prepare logic gate substrate chain reaction buffer, purchased from Shanghai Sangon Biotech. Sodium dihydrogen phosphate dihydrate (NaH2PO4·2H2O): analytical grade, used to prepare PBS buffer, purchased from Sinopharm Group. Disodium hydrogen phosphate dodecahydrate (Na2HPO4·12H2O): analytical grade, used to prepare PBS buffer, purchased from Sinopharm Group.

[0078] Sodium chloride (NaCl): 100 mM, used to adjust the ionic strength of the reaction buffer, purchased from Sinopharm Group. Magnesium chloride (MgCl2): 10 mM, used for DNA cleavage and HCR amplification reactions, purchased from Sigma-Aldrich.

[0079] Sample processing

[0080] Human serum samples: obtained from healthy volunteers at the First People's Hospital of Ma'anshan City, and used for actual sample validation experiments after ethical approval. Phosphate-buffered saline (PBS): 10 mM, pH 7.4, containing 0.05% Tween 20 (PBST), used for sample dilution and washing, purchased from Sigma-Aldrich.

[0081] Instrument-compatible reagents

[0082] Gel electrophoresis related:

[0083] Polyacrylamide: 6% concentration, used for the preparation of non-denaturing PAGE gels, purchased from Shanghai Sangon Biotech. GelRed dye: 1× concentration, used for DNA electrophoresis staining, purchased from Biotium. TAE buffer: 1× concentration, pH 8.0, used for electrophoretic separation, purchased from Shanghai Sangon Biotech.

[0084] ECL testing:

[0085] Electrochemical Analyzer: An MPI-B type electrochemiluminescence analyzer (Xi'an Ruimai Electronic Technology Co., Ltd.) is used, equipped with a three-electrode system (glassy carbon electrode as working electrode, platinum wire electrode as counter electrode, and Ag / AgCl electrode as reference electrode). Cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) are used to characterize the electrode modification process layer by layer. ECL signal detection adopts a constant potential step mode, with a scanning voltage range of 0-1.3V, a scanning speed of 100mV / s, and a photomultiplier tube (PMT) voltage of 800V. It can record the ECL luminescence intensity and potential-intensity curve in real time. The built-in electrochemical analysis software can automatically subtract background current and extract peak signals. The detection results can be exported to a computer via USB interface for data analysis and processing.

[0086] Ultrapure water: resistivity ≥18.2 MΩ·cm, used for reagent preparation and instrument cleaning, prepared by an ultrapure water purification system (Hefei Shengjue Technology SJ-CS-1).

[0087] Example 1

[0088] Synthesis and Characterization of RuSiNPs

[0089] Step 1: Synthesis of RuSiNPs

[0090] At room temperature, 1.77 mL of Triton X-100, 1.8 mL of 1-hexanol, and 7.5 mL of cyclohexane were mixed in a beaker and magnetically stirred for 5 minutes until a homogeneous, transparent oil phase was formed. Then, 340 μL of Ru(bpy)3 was added. 2+ The solution (40 mM) was stirred at room temperature for 20 minutes to form a clear, transparent water-in-oil microemulsion (water core diameter approximately 5-8 nm). 100 μL of TEOS and 60 μL of NH4OH (28%) were added sequentially to the above solution. The reaction system gradually turned milky white, and stirring continued for 24 hours. After the reaction was complete, 10 mL of acetone was added to disrupt the microemulsion system. The mixture was centrifuged at 10,000 rpm for 10 minutes, and the precipitate was washed three times each with anhydrous ethanol and ultrapure water, centrifuged at 10,000 rpm for 10 minutes each time. The orange RuSiNPs precipitate was collected.

[0091] Step 2: Amination modification of RuSiNPs

[0092] Two mg of dried RuSiNPs were ultrasonically dispersed in 1 mL of anhydrous ethanol (ultrasonic power 100 W, time 5 min), and 60 μL of APTES was added. The mixture was then magnetically stirred in a 60℃ water bath for 4 hours. After the reaction was complete, the product was washed three times with anhydrous ethanol at 10000 rpm / min (10 min each time), and redispersed in 500 μL of ultrapure water to obtain aminated RuSiNPs (NH2-RuSiNPs), which were stored at 4℃ for later use.

[0093] Step 3: Preparation of H3-NH2-RuSiNPs signal probe

[0094] Take 200 μL of NH2-RuSiNPs solution (approximately 0.8 mg / mL), wash once with PBS buffer (10 mM, pH 7.4) by centrifugation (10000 rpm / min, 10 min), resuspend in 1 mL of PBS buffer containing 20 mM EDC and 10 mM NHS, and activate at room temperature for 30 min. Then add 3 μM of 5' carboxyl-modified hairpin DNA H3, and bring the volume to 1 mL with PBS. Incubate at 25°C in the dark with shaking for 4 hours. After the reaction is complete, wash three times by centrifugation at 10000 rpm / min (10 min each time) to remove uncoupled DNA. Redisperse H3-NH2-RuSiNPs in PBS buffer and store at 4°C in the dark for later use.

[0095] Results test:

[0096] Transmission electron microscopy (TEM) observation Figure 2 A): RuSiNPs are regular spherical with a particle size distribution of 50±5nm. There is no obvious aggregation between particles, and they have good monodispersity.

[0097] Scanning electron microscopy (SEM) observation Figure 2 B): The particles have a uniform morphology, a smooth surface, and no damage or deformed structure.

[0098] Energy dispersive X-ray spectroscopy (EDS) surface scanning analysis Figure 2 C): Si (blue), O (green), and Ru (red) elements are uniformly distributed throughout the particle region, with no element segregation or aggregation, proving that ruthenium ions are uniformly embedded in the silica matrix.

[0099] X-ray photoelectron spectroscopy (XPS) full spectrum analysis Figure 2 D): Characteristic peaks of Si2p (103eV), O1s (532eV), Ru3d (284eV) and Ru3p (462eV) were detected, and no other impurity element peaks were observed, further confirming that the chemical composition of RuSiNPs is in line with expectations.

[0100] Dynamic light scattering (DLS) particle size analysis Figure 3 A): The hydrated particle size of naked RuSiNPs is 450 nm, that of NH2-RuSiNPs increases to 800 nm, and that of H3-NH2-RuSiNPs further increases to 1100 nm. The stepwise increase in size proves that the DNA was successfully modified.

[0101] Zeta potential analysis ( Figure 3B): The potential of naked RuSiNPs is -8.5 mV, which rises to +3 mV after amination (the surface -NH2 is protonated and becomes positively charged). After coupling with H3 (a negatively charged DNA strand), the potential drops to -24.6 mV. The charge reversal and further negative shift prove that H3 is covalently linked through an amide bond.

[0102] Example 2

[0103] Assembly and verification of nucleic acids using the DNA hexahedral framework

[0104] Step 1: Frame Assembly

[0105] Add T1 chain (100 μM, 2 μL) to 10 mM Tris-HCl buffer (110 mM TCEP, 10 mM MgSO4). 2+ In 1 mM EDTA (pH 7.4, total volume 20 μL), incubate at 37 °C for 30 minutes to reduce thiol groups (to prevent the formation of dimers between T1 chains).

[0106] TSP1, TSP2, TSP3, TSP4, and T2 chains were dissolved separately in the above buffer solution to a final concentration of 100 μM. Each chain was mixed in an equimolar ratio (2 μL each, final volume 20 μL), heated at 95 °C for 5 minutes, then slowly cooled to below 40 °C at a rate of 1 °C / min (approximately 1.5 hours), and finally stored at 4 °C for 12 hours to form the hexahedral functional framework of DNA.

[0107] Step 2: Non-denaturing PAGE analysis

[0108] Prepare a 6% non-denaturing polyacrylamide gel (29:1, acrylamide:methylenebisacrylamide). Take 20 μL of each sample from each assembly stage and add 4 μL of 6× loading buffer (containing 30% glycerol and 0.25% bromophenol blue). Electrophoresis is performed at a constant voltage of 110V for 2 hours in 1× TAE buffer (40 mM Tris-Acetate, 1 mM EDTA, pH 8.0). After electrophoresis, stain with 1× GelRed dye in the dark for 30 minutes and record the image under UV light using a gel imaging system.

[0109] Results test:

[0110] PAGE step-by-step assembly results ( Figure 4A): Lane 1 (TSP1 single chain) shows the fastest migration rate, with the band located at the bottom. Lane 2 (TSP1+TSP2) shows a new band with decreasing migration rate, indicating that the two chains have hybridized to form a binary complex. The migration rates of the bands in lanes 3 (+TSP3), 4 (+TSP4), 5 (+T1), and 6 (+T2) decrease progressively, while the molecular weight increases sequentially. The final product band in lane 6 is located at the top of the gel, with a significantly lower migration rate than all intermediate products, and the band is clear and undispersed, proving that the six chains have successfully self-assembled to form a stable high-molecular-weight hexahedral framework structure.

[0111] Example 3

[0112] DNAzyme cleavage activity and logic gate verification

[0113] Step 2: DNA zyme cleavage reaction

[0114] Lanes (1–10) are: T2; L1; L2; miRNA-208; L1 + miRNA-208; L2 + miRNA-208; L1 + L2 + miRNA-208; L1 + L2 + miRNA-208 + T3; L1 + L2 + miRNA-208 + T2; P1. Take 2 μL of each of the above substrates and supplement with TAE / Mg. 2+ Add buffer to 20 μL (final concentration 0.1 μM each) and incubate at 37°C for 2 hours. After the reaction, take 20 μL of sample for 6% non-denaturing PAGE electrophoresis analysis (conditions as in Example 2).

[0115] Step 2: Logic Gate Verification

[0116] The designed three-input AND logic gate, upon input of the target miRNA, assembles a complete DNAzyme through a strand displacement amplification reaction, which then cleaves hairpin substrates containing rA sites on the framework nucleic acids. The process of miRNA analysis using the logic gate is as follows: All single strands in the two double-stranded DNAs (L1–Lock-1, L2–Lock-2) are added at the same concentration to 10 mM Tris-HCl buffer (10 mM MgSO4). 2+The mixture was prepared using 100 mM NaCl (pH 7.4). It was then heated at 90°C for 10 min and cooled to ambient temperature to form stable substrate chains for each logic gate. Next, different target miRNAs (miRNA-499, miRNA-328, miRNA-208, or a mixture thereof) were added, maintaining a final concentration of 0.1 μM for each miRNA, for a total volume of 10 μL. 2 μL of each substrate (final concentration 0.1 μM) was taken and Tris-HCl buffer was added to a final volume of 20 μL, and the mixture was incubated at 37°C for 2 hours. After the reaction, 20 μL of the sample was analyzed by 6% non-denaturing PAGE electrophoresis (under the same conditions as in Example 2).

[0117] Results test:

[0118] DNAzyme cleavage PAGE verification ( Figure 4 B): Lane 1 (T2 control) shows a single band of a complete hairpin; lanes 2 (L1 single strand), 3 (L2 single strand), and 4 (miRNA-208 single strand) each show a single band; lanes 5 (L1+miRNA-208) and 6 (L2+miRNA-208) show bands slightly higher than L1 / L2, indicating that L1 or L2 binds to miRNA-208 alone; lane 7 (L1+L2+miRNA-208) shows a new band higher than lanes 5 and 6, indicating successful binding of the DNA-zyme complex. Comparing lanes 8 and 9, lane 8 shows a band with a significantly lower migration rate, which is the result of the DNA structures in lanes 1 and 7 binding through complementary base pairing, while the band at this position in lane 9 is very faint, indicating that the DNA structure at this position has been cleaved and digested. Furthermore, a new band appeared in lane 9, consistent with the position in lane 10, and the band in lane 10 was the cleavage product P1. This result demonstrates the successful formation of the DNAzyme complex and the cleavage of the hairpin T2 containing the rA site.

[0119] Feasibility analysis of three-input AND gate ( Figure 5 B): Lane 4, where three target miRNAs were simultaneously input, showed a band at the same position as the product P1 strand in lane 3, proving that the DNAzyme combinatorial structure can cleave the H1 hairpin when three strands are input. Lanes 5–10, for inputting any two target strands and one target strand each, respectively, showed no bands at the same position as the band in lane 3, proving that the product P1 strand can only be output when three strands are input, successfully constructing a three-input AND logic gate.

[0120] Example 4

[0121] HCR reaction system validation

[0122] Step 1: Pre-processing of hairpins H1 and H2

[0123] H1 and H2 hairpin chains were dissolved separately in TAE buffer (containing 10 mM Mg). 2+ The solution is prepared to a final concentration of 10 μM, annealed at 95 °C for 5 minutes, and then slowly cooled to room temperature (about 1 hour) to form a stable hairpin stem-ring structure (to avoid non-specific hybridization between hairpins). It is then stored at 4 °C.

[0124] Step 2: HCR amplification reaction

[0125] Take 5 μL of the reaction solution after DNAzyme digestion in Example 3 (containing the P1 trigger strand), add 2 μL each of H1 and H2, and supplement with TAE / Mg. 2+ Add buffer to 20 μL (final concentration 0.1 μM for each component) and incubate at 37°C for 3 hours. The control group did not add the P1 trigger chain; all other conditions were the same. After the reaction, samples were taken for 6% non-denaturing PAGE electrophoresis analysis.

[0126] Results test:

[0127] HCR amplification PAGE verification ( Figure 5 A): Lane 1 (H1 annealing control) shows a single band, indicating a stable hairpin structure without self-opening; Lane 2 (H2 annealing control) also shows a single band; Lane 3 (H1+H2 without P1 trigger chain) shows no high molecular weight band, proving that H1 and H2 remain inert without the trigger chain, and background amplification is negligible; Lane 4 (P1 trigger chain + H1) shows a new band with a slightly slower migration rate than lane 1 (the linearized product of H1 after its hairpin is opened by P1); Lane 5 (P1+H1+H2) shows a distinct step-like high molecular weight band (extending downwards from the top of the gel well), with uniform band spacing (approximately 100 bp per step), proving that H1 and H2 undergo cascade alternating hybridization to form a long-chain DNA polymer; Lane 6 (P1+H1+H2+framework TSP chain) shows a composite band with an even higher molecular weight, indicating that the cleavage product P1 can still effectively initiate the HCR reaction after binding with the framework chain TSP1. The above results confirm that HCR amplification is strictly dependent on P1 triggering and the background is controllable.

[0128] Example 5

[0129] Construction and electrochemical characterization of the ECL sensing platform

[0130] Step 1: Electrode pretreatment and gold plating

[0131] A glassy carbon electrode (GCE, 3 mm in diameter) was polished to a mirror finish on chamois leather using 0.3 μm alumina powder, ultrasonically cleaned three times with ultrapure water (2 minutes each time), and air-dried. The electrode was then immersed in a 1% HauCl4 solution and electrodeposited at -0.2 V for 40 seconds using a potentiostatic method (approximately 2.5 × 10⁻⁶ ppm charge). -3 C), to obtain a gold nanoparticle modified electrode (depAu / GCE), rinsed with ultrapure water and dried at room temperature.

[0132] Step 2: Fix the hexahedral support

[0133] 10 μL of the DNA hexahedral functional scaffold solution (approximately 1 μM) prepared in Example 2 was dropped onto the surface of the depAu / GCE electrode and incubated overnight (approximately 12 hours) in a humidified chamber at 4°C. The scaffold was immobilized by the C6 thiol group at the end of the T1 chain to the Au-S bond on the gold surface (bond energy approximately 40 kcal / mol). Subsequently, the electrode surface was rinsed with ultrapure water to remove unimmobilized scaffolds, and 10 μL of 1 mM MCH solution (dissolved in PBS) was added for blocking at room temperature for 30 minutes to occupy unreacted active sites on the gold surface and reduce nonspecific adsorption. Finally, the electrode was rinsed three times with PBS.

[0134] Step 3: Target reaction and DNA zyme cleavage

[0135] 10 μL of the reaction solution from different input combinations in Example 3 was added to the electrode surface and incubated in a humidified chamber at 37°C for 30 minutes. If all three target miRNAs were present simultaneously, an active DNAzyme formed on the electrode surface and cleaved the rA site of the T2 hairpin, releasing the P1 trigger strand. After the reaction, the electrode was washed three times with PBS.

[0136] Step 4: HCR amplification and signal probe binding

[0137] 5 μL each of H1 and H2 hairpin probes (final concentration 1 μM each) were sequentially added to the electrode surface, and incubated at 37°C for 3 hours to trigger the HCR reaction. After rinsing with PBS, 10 μL of the H3-NH2-RuSiNPs signal probe solution prepared in Example 1 (approximately 0.5 mg / mL) was added, and the electrode was incubated at 37°C in the dark for 2 hours. After each step, the electrode surface was rinsed three times with PBS buffer to remove unbound reactants.

[0138] Step 5: Electrochemical characterization and ECL detection

[0139] The above-described layer-by-layer modified electrodes were placed in a solution containing 5 mM [Fe(CN)6]. 3- / 4-In PBS solutions of (1:1) and 0.1 M KCl, cyclic voltammetry (CV, scan range -0.2–0.6 V, scan rate 50 mV / s) and electrochemical impedance spectroscopy (EIS, frequency range 10 mV / s) were used. -1 -10 5 The electrode modification process was monitored layer by layer (Hz, amplitude 5 mV).

[0140] The final modified electrode was placed in 5 mL of co-reactant solution (0.05 M PBS, 0.05 M TPrA, pH 7.4), and the ECL signal was detected using an electrochemical analyzer (MPI-B). The scan potential range was set to 0-1.3 V, the scan rate to 100 mV / s, and the photomultiplier tube (PMT) voltage to 800 V. The ECL luminescence intensity and potential-intensity curve were recorded.

[0141] Results test:

[0142] CV layer-by-layer characterization Figure 7 A): Bare GCE (curve a) shows [Fe(CN)6] 3- / 4- The reversible redox peak (ΔEp≈78mV) was observed; the depAu / GCE peak current (curve b) increased significantly (increased electroactive area); after hexahedral fixation (curve c), the peak current decreased significantly (electrostatic repulsion of the DNA phosphate backbone); after DNAzyme cleavage (curve d), the peak current slightly increased (decreased steric hindrance); after HCR amplification (curve e), the peak current decreased again (long DNA chains hinder electron transfer); after RuSiNPs binding (curve f), the peak current reached its lowest point (thickening of the insulating layer). The trends of change at each step were clear.

[0143] EIS layer-by-layer characterization ( Figure 7 B): The charge transfer impedance of bare GCE, Rct ≈ 48Ω (curve a); depAu / GCE decreases to Rct ≈ 32Ω (curve b, increased conductivity of the gold layer); after hexahedral fixation, Rct increases sharply to 485Ω (curve c); after dicing, Rct decreases to 395Ω (curve d); after HCR, Rct increases to 718Ω (curve e); after RuSiNPs bonding, Rct increases to 1095Ω (curve f). The variation of Rct is completely consistent with CV.

[0144] ECL signal layer-by-layer monitoring ( Figure 7C, 7D): The bare GCE and hexahedral modified electrodes showed extremely low background ECL signals (<50 arb.units, curves a-e); after the introduction of three target miRNAs, following DNAzyme cleavage, HCR amplification, and RuSiNPs signal probe binding, the final electrode (curve f) exhibited a significant ECL emission peak at 1.15V, with an intensity of 3750 arb.units; the control group lacking any target or without the HCR step showed signals below the 1800 threshold. These results comprehensively validated, from the three dimensions of CV, EIS, and ECL, that all steps of the sensor modification and molecular reaction were successfully completed, and that the signal output strictly depended on the simultaneous presence of the three targets.

[0145] Example 6

[0146] Quantitative performance and specificity testing of the sensing platform

[0147] Step 1: Gradient Concentration Detection

[0148] Under optimal experimental conditions (TPrA concentration 50 mM, HCR incubation time 3 h, DNAzyme digestion time 30 min), three target miRNA mixed solutions with seven concentration gradients of 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, and 10 nM were prepared (1:1:1 molar ratio).

[0149] Perform target reaction, HCR amplification and ECL detection according to steps 3-5 of Example 5. Repeat each concentration group three times independently (with different electrodes), record the ECL signal intensity (at the peak potential of 1.15 V), and take the average value to plot the calibration curve.

[0150] Step 2: Stability Test

[0151] After constructing the sensor according to Example 5, a standard reaction solution containing 10 nM of each of the three targets was taken. Continuous cyclic voltammetry scans (potential 0-1.3 V, scan rate 100 mV / s, PMT voltage 800 V) were performed on the same electrode in the co-reactant solution for 20 consecutive scans. The relative standard deviation (RSD) of the ECL peak intensity was recorded.

[0152] Step 3: Selective Testing

[0153] Prepare the following 9 sets of interference input combinations (each with a final concentration of 100 nM), and detect the ECL intensity according to the procedure in Example 5:

[0154] Group A: miR-21 + miR-155 + miR-133 (irrelevant interference combination)

[0155] Group B: miR-21 + miR-155 + miR-328

[0156] Group C: miR-21 + miR-155 + miR-499

[0157] Group d: miR-21 + miR-155 + miR-208

[0158] Group E: miR-21 + miR-328 + miR-499

[0159] Group f: miR-21 + miR-328 + miR-208

[0160] Group G: miR-21 + miR-499 + miR-208

[0161] Group h: miR-328 + miR-499 + miR-208 (target combination)

[0162] Group i: miR-21+miR-155+miR-133+miR-328+miR-499+miR-208 (mixed multiple interfering agents)

[0163] Repeat each group three times and record the peak ECL signal.

[0164] Results test:

[0165] Gradient concentration ECL response ( Figure 9 A, 9B): ECL spectra at 7 concentration gradients show that the signal intensity increases with the target concentration, and can be clearly distinguished at 10 fM (signal-to-noise ratio S / N≈4.2), and reaches a plateau region at 10 nM.

[0166] Calibration curve ( Figure 9 C): Linear fitting of ECL peak intensity (I) to the logarithmic values ​​(lgC) of the three target concentrations yielded the regression equation I = 999.8lgC + 17808.6, with a linear correlation coefficient R0. 2 =0.999, linear dynamic range 10 fM to 10 nM (covering 4 orders of magnitude). Based on the 3-fold blank standard deviation method (LOD = 3σ / k, where σ is the standard deviation of the blank sample and k is the slope), the detection limit is calculated to be 0.8 fM, which is superior to most reported miRNA electrochemiluminescence detection methods.

[0167] Stability test ( Figure 9 D): After 20 consecutive cyclic scans, the peak intensity RSD of ECL was 2.79% (n=20), and the signal fluctuation was small, proving that RuSiNPs were firmly fixed on the electrode surface and had stable luminescence performance, meeting the requirements for repeated detection.

[0168] Selective testing ( Figure 9E): The ECL intensities of group h (miR-328+miR-499+miR-208) and group i (containing three targets + three interferences) were 6690 and 6328 arb.units, respectively, both significantly higher than the threshold (>1800); the ECL intensities of groups a–g (excluding combinations of the complete three targets) were all lower than the threshold, close to the blank control. The results indicate that even with high concentrations (100 nM, which is 10 times the target concentration), [the situation is still possible]. 4 Despite interference from unrelated miRNAs (multiple times), the sensor still only responds to the (1,1,1) combination, demonstrating excellent selectivity and effectively distinguishing the target from homologous or non-homologous interference sequences.

[0169] Example 7

[0170] Logic gate performance verification in serum samples

[0171] Step 1: Serum sample pretreatment

[0172] Serum samples from healthy volunteers (ethically approved) were collected from the First People's Hospital of Ma'anshan City. Large protein molecules were removed by centrifuging at 14,000 rpm for 10 minutes using ultrafiltration centrifuge tubes (10 kDa molecular weight cutoff). The filtrate was diluted to 10% (v / v) with PBS buffer and set aside.

[0173] Step 2: Spike Recovery and Logic Response Detection

[0174] Three different combinations of target miRNAs (final concentration 100 nM each) were added to a 10% serum matrix. Eight input combinations were set up, the same as in Example 6 (as shown in Table 2, combinations A / B / C). Sensor construction and ECL detection were performed according to the steps in Example 5. 10% serum without any target was used as a blank control, and each group was repeated 3 times.

[0175] Step 3: Quantitative detection in serum

[0176] Three target mixed solutions with concentration gradients of 10 fM to 10 nM were prepared (in 10% serum matrix), and the results were detected according to the procedure in Example 5. A serum matrix calibration curve was plotted and compared with the results of the buffer system in Example 6.

[0177] Results test:

[0178] Logic gate response in serum ( Figure 10 A, 10C, 10E: Of the 8 input groups, only the (1,1,1) combination produces a strong ECL signal (peak intensity approximately 6980 arb.units), while the other 7 signals are all below the 1800 threshold, consistent with the logic output pattern in the buffer ( Figure 8A) Completely consistent. The absolute signal intensity decreased by approximately 6.5% compared to the buffer solution, but the logical judgment ("0" or "1") of all samples matched the buffer solution results by 100%.

[0179] Serum calibration curve ( Figure 11 A-11C): The regression equation is Iserum = 985.2lgC + 17120.5 (R0). 2 =0.997), detection limit is 1.0 fM. Comparison with buffer curve ( Figure 9 C: I = 999.8lgC + 17808.6, R 2 Compared to (=0.999, LOD=0.8 fM), the slope deviation was only 1.46% and the intercept deviation was about 3.9%, proving that the serum matrix has little effect on the detection sensitivity.

[0180] Comparison of buffer and serum signals ( Figure 11 D): At each concentration of the three targets, the ECL strength in serum was 91%-95% of the buffer solution, with the deviation within an acceptable range. Furthermore, the low concentrations (10 fM, 100 fM) could still be clearly distinguished from the blank control (S / N > 3).

[0181] Actual sample spiked recovery rate: Three targets (10 pM each) were spiked and recovered in 10% of serum samples. The recovery rate was 92.3%-104.7% in three parallel determinations, with RSD < 5.2%, indicating that the method is accurate and reliable.

[0182] The above embodiments demonstrate that the three-input AND logic gate ECL sensing platform of this invention not only exhibits an extremely low detection limit of 0.8 fM and a wide linear range of four orders of magnitude for the three AMI-related miRNAs, but also possesses excellent logic recognition specificity (distinguishing (1,1,1) from the other seven input combinations), good resistance to serum matrix interference, and stable luminescence performance, with good recovery rates in clinical serum samples. Compared to traditional single-marker detection methods, this platform significantly reduces the false positive rate through logic gate operations, providing a reliable technical means for the early and accurate diagnosis of acute myocardial infarction.

[0183] The above are merely preferred embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention, such as replacing the detection of other miRNA target combinations (by modifying the L1 / Lock-1, L2 / Lock-2 recognition sequences), adjusting the logic gate type (such as constructing OR, NOR, INHIBIT, etc. logic), replacing the ECL luminescent material or co-reactant system, etc., should all be covered within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.

[0184] Any aspects of this invention not described in detail are well-known to those skilled in the art.

Claims

1. A logic gate ECL sensing platform based on HCR-DNAzyme cascade amplification, characterized in that: Including hexahedral framework nucleic acid nanostructures, DNAzymes composed of three-input AND logic reactions, HCR modules, and ECL signal probes H3-NH2-RuSiNPs; The four sides of the hexahedral framework nucleic acid nanostructure are self-assembled by backbone chains TSP1, TSP2, TSP3, and TSP4. One end of the tubular structure formed by the four sides is self-assembled with multiple T1 chains with thiol groups modified at the 3' end, which are used to fix the structure to the gold-plated electrode surface via gold-sulfur bonds. The other end is self-assembled with multiple T2 hairpin chains with cleavage recognition sites in the stem-loop region, which are used for DNAzyme-specific cleavage. DNAzyme is formed by the self-assembly of L1, L2 and miRNA-208 triple strands. A base pair on L1 is complementary to Lock-1 and exists in the form of L1-Lock-1 double strand, and a base pair on L2 is complementary to Lock-2 and exists in the form of L2-Lock-2 double strand. L1 needs to be released by strand displacement between miRNA-328 and Lock-1, and L2 needs to be released by strand displacement between miRNA-499 and Lock-2. The HCR module includes hairpin strands H1 and H2. The portion of the T2 hairpin strand released after being cleaved and attached to the hexahedral framework nucleic acid nanostructure is the trigger strand P1. A sequence exposed in P1 is used to identify and open the H1 hairpin and form a complementary pairing connection with H1. The opened H1 is used to identify and open the H2 hairpin and form a complementary pairing connection with H2. The opened H2 is used to identify and open another H1 hairpin and form a complementary pairing connection with it. This cascades sequentially to form a long-chain DNA double helix polymer. The ECL signal probe is prepared by introducing amino groups into the surface of RuSiNPs nanoparticles through APTES modification, and then covalently coupling it with hairpin DNA H3 modified with a carboxyl group at the 5' end via an amide bond. The 3' end sequence of the H3 chain on the ECL signal probe is complementary to the 3' end exposed sequences of H1 and H2 on the long chain of the HCR product, and is used to introduce ECL luminescent material. The sequences of TSP1, TSP2, TSP3, TSP4, T1, and T2 are SEQ ID No. 4 to SEQ ID No. 9 in the sequence list, and the sequences of P1, L1, L2, Lock-1, Lock-2, H1, H2, and H3 are SEQ ID No. 11 to SEQ ID No. 18 in the sequence list, respectively.

2. The sensing platform according to claim 1, characterized in that: In the hexahedral framework nucleic acid nanostructure, the molar ratio of TSP1, TSP2, TSP3, TSP4, T1, and T2 is 1:1:1:1:3:

3.

3. The sensing platform according to claim 1, characterized in that: In the DNAzyme, the molar ratio of L1, L2, and miRNA-208 is 1:1:1; in the strand replacement of L1 release, the molar ratio of miRNA-328 and Lock-1 is 1:1; in the strand replacement of L2 release, the molar ratio of miRNA-499 and Lock-2 is 1:

1.

4. The sensing platform according to claim 1, characterized in that: The 3' end of the T1 chain is modified with a C6 thiol group protected by a disulfide bond to ensure that there are no free thiol groups during the assembly stage.

5. A method for preparing the sensing platform according to any one of claims 1 to 4, characterized in that, Includes the following: S1 uses annealing to self-assemble TSP1, TSP2, TSP3, TSP4, T1, and T2 into a hexahedral framework nucleic acid nanostructure; After S2 polishing, the glassy carbon electrode is immersed in chloroauric acid solution for electrodeposition to obtain a gold-plated electrode modified with gold nanoparticles. A hexahedral framework nucleic acid nanostructure solution is dropped onto the surface of the gold-plated electrode and fixed to the surface of the gold-plated electrode through the thiol-sulfur bond at the end of the T1 chain, and then sealed with MCH. S3 anneals L1 and Lock-1 to form a double chain, and anneals L2 and Lock-2 to form a double chain. S4 prepared amino-modified RuSiNPs by modifying the surface of RuSiNPs nanoparticles with APTES to introduce amino groups. The amino-modified RuSiNPs were then reacted with hairpin DNA H3 modified with a 5' carboxyl group in PBS buffer to prepare ECL signal probe H3-NH2-RuSiNPs.

6. The preparation method according to claim 5, characterized in that: In step S1, the T1 chain is first added to the mixture containing TCEP and Mg. 2+ The hexahedral framework nucleic acid nanostructure solution was incubated in Tris-HCl buffer at 37°C for 30 min, and then the remaining strands were dissolved in the buffer and annealed at 95°C for 5 min. The resulting solution was stored at 4°C.

7. The preparation method according to claim 5, characterized in that: In step S2, electrodeposition was performed using a 1% chloroauric acid solution at a constant potential of -0.2V for 40 seconds. In step S3, during the preparation of both double-stranded forms, all single strands were added at the same concentration to a pH of 7.4 containing Mg. 2+ It was prepared by heating at 90°C for 10 min in a Tris-HCl buffer solution containing NaCl.

8. The preparation method according to claim 5, characterized in that: In step S4, RuSiNPs are dispersed in anhydrous ethanol, APTES is added and stirred to react, and the mixture is washed several times by centrifugation with anhydrous ethanol. The product is dispersed in ultrapure water to obtain an aminolated RuSiNPs solution, washed once by centrifugation with PBS buffer, and resuspended in PBS buffer containing EDC and NHS. After activation at room temperature, hairpin DNA H3 is added, and the volume is adjusted with PBS. The reaction is carried out at room temperature in the dark by shaking. After the reaction is completed, the uncoupled DNA is removed by centrifugation and washing several times. The obtained probe is dispersed in PBS buffer and stored at 4°C in the dark.

9. The application of the sensing platform according to any one of claims 1 to 4, characterized in that: It is used for the combined detection of serum miRNAs in acute myocardial infarction for non-diagnostic purposes.

10. The application according to claim 9, characterized in that: Sufficient amounts of the two types of double-stranded DNA and the test sample were incubated at 37°C for 2 hours. The reaction solution was then dropped onto the surface of a gold-plated electrode with a hexahedral framework nucleic acid nanostructure immobilized, and incubated at 37°C for 30 minutes. Sufficient amounts of H1 and H2 were added to the electrode surface, and the electrode was incubated at 37°C for 3 hours. Sufficient amounts of ECL signal probes were then added to the electrode surface, and the electrode was incubated at 37°C in the dark for 2 hours. After each incubation, the electrode surface was rinsed with PBS buffer to remove unbound reactants. Finally, the ECL signal was detected in the co-reaction mixture. The scan voltage was set to 0–1.3 V, the scan rate to 100 mV / s, and the photomultiplier tube voltage to 800 V. An ECL signal with an intensity higher than the threshold could be detected only when miRNA-208, miRNA-328, and miRNA-499 were simultaneously present in the test sample.

Images