Long fragment pre-amplification nested PCR amplicon library construction and application in polyploidy genotyping

Abstract

The application provides a long-fragment pre-amplification nested PCR amplicon library construction and application in polyploid genotyping, and belongs to the technical field of gene detection. The technical scheme of the application solves the problems that in a complex genome of a polyploid crop and the like, an existing amplicon library construction method cannot distinguish homologous genes with high sequence similarity of the polyploid crop, non-specific amplification is serious, sequencing reads cannot be accurately attributed, and the error rate of SNP genotyping is high.

Description

Technical Field

[0001] This application belongs to the field of gene detection technology, and more specifically, it relates to a long-fragment pre-amplified nested PCR amplicon library construction and its application in polyploid genotyping. Background Technology

[0002] Amplicon sequencing is a highly efficient method for targeted detection of variations in specific gene regions. It involves amplifying the target region by PCR and constructing a sequencing library, which is then combined with next-generation sequencing (NGS) to achieve high-throughput, low-cost genotyping. Currently, amplicon library preparation methods typically employ a two- or three-round PCR amplification strategy. For example, the Hi-TOM method (Liu Q, Wang C, et al. Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR / Cas systems. Sci China Life Sci. 2019;62(1):1-7.) uses a two-round PCR amplification strategy: the first round of PCR amplification uses target-specific primers (with a universal bridging sequence added to the 5' end) to amplify the target region; the second round of PCR amplification uses universal primers containing platform adapter sequences and barcodes for barcoding, and the amplified products are directly used for Illumina sequencing. A common feature of existing amplicon library preparation methods is their adaptation to the short read length characteristics of next-generation sequencing, resulting in good performance in simple genome species such as rice and humans.

[0003] The genomes of polyploid crops (such as soybean, tobacco, cotton, rapeseed and wheat) contain a large number of homologous genes and homologous regions, and the sequence similarity between different homologous copies is often as high as 90% or more. Existing amplicon library construction methods have the following defects in polyploid crops: (1) Non-specific amplification: primers cannot distinguish homologous genes, and multiple homologous copies are amplified at the same time, resulting in mixed amplification products; (2) Difficulty in assigning sequencing reads: the amplification products contain sequences of multiple homologous genes, and sequencing reads cannot be accurately assigned to specific homologous copies; (3) High genotyping error rate: SNP genotyping has serious false positives and false negatives, and differences between homologous genes are misjudged as allelic variations or real variations are masked by homologous sequences.

[0004] There is a lack of a standardized amplicon library construction method that can both physically distinguish homologous genes of polyploid crops from the amplification source and be compatible with mainstream second-generation sequencing platforms. Summary of the Invention

[0005] The purpose of this application is to provide a long-fragment pre-amplified nested PCR amplicon library construction method and its application in polyploid genotyping. This method solves the problem that existing amplicon library construction methods cannot distinguish highly similar homologous genes in complex genomes such as polyploid crops, resulting in severe non-specific amplification, inaccurate sequencing read attribution, and high SNP genotyping error rate.

[0006] A first aspect of this application provides a method for library construction of long-fragment pre-amplified nested PCR amplicon, comprising: Long fragment homology sorting and amplification: Using polyploid crop genomic DNA as a template, PCR amplification is performed using long fragment primer pairs to obtain long fragment amplification products. The length of the long fragment amplification products is 400~5000bp, containing the target variant region and its flanking sequences. The long fragment primer pairs are designed in the sequence difference segments between the target gene and the target homologous gene. Nested length conversion amplification: Using the amplification product of the long fragment as a template, PCR amplification is performed using nested primer pairs to obtain a short fragment amplification product with a length of 100~300bp that retains the target variant region. The binding site of the nested primer pair is located inside the binding site of the long fragment primer pair. Barcoding and Sequencing Adapter Addition: Using the short fragment amplification product as a template, sample-specific barcode sequences are introduced, and index sequences and sequencing adapter sequences from the next-generation sequencing platform are added to construct an amplicon library.

[0007] In one embodiment, the method for designing the long-fragment primer pair includes: The target gene sequence is compared with all its known homologous gene sequences using multiple sequence alignment. Identify differentially expressed sites between homologous genes, including SNPs and / or InDels; The long-fragment primer pairs are designed in segments containing ≥2 differential sites, such that the 3' end of the primer pair covers at least one differential site.

[0008] In one embodiment, the length of the long fragment amplification product is 400~2000bp.

[0009] In one embodiment, the forward primer binding site of the nested primer pair is located 50-200 bp downstream of the amplified inner side of the forward primer binding site of the long fragment primer pair, and the reverse primer binding site of the nested primer pair is located 50-200 bp upstream of the amplified inner side of the reverse primer binding site of the long fragment primer pair.

[0010] In one embodiment, the 5' end of the nested primer pair is fused with a universal bridging sequence used for the introduction of the barcode sequence and the sequencing adapter sequence.

[0011] In one embodiment, the introduction of the barcode sequence is completed in the same PCR amplification step as the addition of the index sequence and sequencing adapter sequence; or The introduction of the barcode sequence is completed in a one-step PCR amplification reaction, and the addition of the index sequence and sequencing adapter sequence is completed in another PCR amplification reaction.

[0012] In one embodiment, the barcode sequence has a length of 4-12 bp, a Hamming distance ≥3, and a GC content of 38%-62%; and / or The index sequence has a length of 6~10bp, a Hamming distance ≥3, and a GC content of 40%~60%.

[0013] In one embodiment, the barcode sequence comprises a nucleotide sequence as shown in SEQ ID NO. 17-28; and / or The index sequence includes nucleotide sequences as shown in SEQ ID NO.29~40.

[0014] In one embodiment, the method of using DNA polymerase in PCR amplification is selected from any one of A1 to A3 below: A1. All used Taq DNA polymerase; A2. All use high-fidelity DNA polymerase; A3. High-fidelity DNA polymerase is used for long-fragment homologous sorting and amplification, while Taq DNA polymerase is used for the remaining PCR amplification.

[0015] A second aspect of this application provides the application of the amplicon library obtained by the library construction method in genotyping, mutation detection, marker-assisted selection and variety identification of polyploid crops; The polyploid crops include soybeans, cotton, rapeseed, wheat, peanuts, and tobacco.

[0016] A third aspect of this application provides a method for detecting genotyping of polyploid crops, comprising: comparing the sequencing data obtained by sequencing an amplicon library constructed by the library construction method with a reference sequence to obtain homology differentiation results, wherein the polyploid crops include soybean, cotton, rapeseed, wheat, peanut and tobacco.

[0017] The beneficial effects of this application are as follows: This application employs a method of "long-fragment primer pre-amplification homology sorting and nested primer pair PCR amplification length conversion" to physically sort target homologous genes from the amplification source, eliminating interference from other homologous copies. The long-fragment primer amplification products are then converted into short-fragment amplification products adapted for short-read sequencing, achieving specific homologous gene sorting and next-generation sequencing-compatible library construction. Specifically: (1) Solve the problem of homologous gene differentiation from the source. By pre-amplifying with long-fragment primer pairs, sorting is achieved by utilizing the cumulative sequence differences of flanking segments of homologous genes. Non-target homologous copies are excluded during the amplification stage, without relying on bioinformatics separation after sequencing.

[0018] (2) Compatible with mainstream second-generation sequencing platforms. The long-fragment primer pair amplification products are converted into short-fragment amplification products by nested primer pair PCR amplification, which is directly compatible with mainstream second-generation sequencing platforms such as Illumina and MGI. No long-read sequencing equipment is required, resulting in low cost and high throughput.

[0019] (3) The accuracy of genotyping is significantly improved. Since the pre-amplification of long-fragment primer pairs has eliminated cross-interference of homologous genes, the subsequent nested primer pair PCR amplification and sequencing are specific products of a single homologous gene, and the false positive rate and false negative rate of genotyping are significantly reduced.

[0020] (4) The method is simple and the cost is controllable. It only requires adding one round of long-fragment primer pre-amplification to the existing amplicon library construction process. No special equipment or expensive long-read sequencing platforms are required, making it suitable for high-throughput analysis of large-scale samples.

[0021] (5) Wide range of applications. The design of long-fragment primer pairs only requires information on the differential regions between homologous genes, and is applicable to a variety of polyploid crops such as soybean, cotton, rapeseed, wheat, peanut, and tobacco. There are no strict requirements on the completeness of the reference genome. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of this application, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 This diagram illustrates the ability of existing short-fragment amplicon library construction methods to distinguish between multiple copies of homologous genes. Figure 2 This diagram illustrates the ability of the long-fragment pre-amplification nested PCR amplicon library construction method of this application to distinguish between multiple copies of homologous genes. Figure 3 A flowchart for the four-step database construction process; Figure 4 A flowchart for the three-step database construction process; Figure 5 This diagram shows the specificity verification of long-fragment primer pairs for amplification of two homologous copies of the soybean ALS gene family. In the figure, A is the electrophoresis result and B is the sequencing peak diagram; Figure 6 Quality control image of soybean GmALS amplicon library; In the figure, A is the electrophoresis result of four rounds of PCR amplification library construction, and B is the Qsep peak diagram of the mixed library; Figure 7 This is a bar chart comparing the homology discrimination accuracy of sequencing data from libraries constructed using the present application and conventional methods in Example 1; Figure 8 This diagram shows the specificity verification of long-fragment primer pairs for two homologous copies of the soybean FAD2 gene family. In the figure, A is the electrophoresis result and B is the sequencing peak diagram; Figure 9 Quality control image of soybean GmFAD2 amplicon library; In the figure, A is the electrophoresis result of four rounds of PCR amplification library construction, and B is the Qsep peak diagram of the mixed library; Figure 10 This is a bar chart comparing the homology discrimination accuracy of sequencing data from this application and traditional methods in Example 2; Figure 11 A diagram verifying the specificity of long-fragment primer pairs for amplification of two homologous copies of the tobacco NbeSTOP1 gene family; In the figure, A is the electrophoresis result and B is the sequencing peak diagram; Figure 12 Quality control image of tobacco NbeSTOP1 amplicon library; In the figure, A is the electrophoresis result of four rounds of PCR amplification library construction, and B is the Qsep peak diagram of the mixed library; Figure 13 This is a bar chart comparing the homology discrimination accuracy of sequencing data from this application and traditional methods in Example 3. Detailed Implementation

[0024] The present application will now be described in detail with reference to preferred embodiments and comparative examples. The preferred embodiments described below according to the present application can be modified in various ways, and therefore the scope of the present application should not be construed as limited to the preferred embodiments described in detail below. Preferred embodiments are provided to help those skilled in the art to more readily understand the present application.

[0025] To make the technical solution of this application clearer, some of the terms involved in this application are explained below.

[0026] Long-fragment primer pairs: A pair of primers used to amplify longer DNA segments, with the amplification product typically being 400-5000 bp in length.

[0027] Target region: The specific nucleotide sequence segment that long primer pairs bind to and amplify on the target gene.

[0028] Differential sites: Locations where bases do not match when aligning the target gene with its homologous gene sequences, including SNPs or InDels.

[0029] Multiple sequence alignment: arranging nucleotide sequences in a homologous manner to identify conserved and variable regions.

[0030] Nested primer pairs: A pair of primers located inside the long-fragment primers, used for a second round of specific amplification of the amplified products from the first round of long-fragment primer pair amplification.

[0031] Target mutation region: The DNA segment where the nucleotide mutation to be detected is located, which is the core detection target.

[0032] Flanking sequences: sequences flanking the target variant region that are not directly used as detection targets but assist in amplification.

[0033] Forward primer binding site: The specific sequence position on the template DNA where the forward primer binds through complementary base pairing.

[0034] Reverse primer binding site: The specific sequence location on the template DNA where the reverse primer binds through complementary base pairing.

[0035] Downstream of the amplification inner side: Located downstream of the outer primer binding site, facing inward towards the amplification product.

[0036] Upstream of the inner side of the amplification: The position upstream of the outer primer binding site in the direction of the amplification product interior.

[0037] Barcode primer pairs: Primer pairs used to introduce sample tag sequences during library construction to distinguish different samples from mixed sequencing.

[0038] Index primer pairs: Primer pairs used to introduce index sequences into amplicon libraries for sample identification and multiplex sequencing.

[0039] Universal bridging sequence: A universal sequence fixed at the 5' end of the primer, which serves as the binding site for the universal primer in subsequent PCR.

[0040] GC content: The percentage of guanine (G) and cytosine (C) bases in a DNA sequence relative to the total number of bases.

[0041] Currently, genotyping of polyploid crops often employs post-sequencing bioinformatics clustering to separate homologous genes. However, this relies on a complete reference genome, resulting in low accuracy and computational complexity for separating highly similar homologous genes. Furthermore, it requires long-read sequencing platforms (PacBio, Nanopore), leading to high costs and low adoption rates. Existing short-fragment amplicon library construction methods (traditional methods) struggle to distinguish highly similar homologous genes, resulting in mixed amplification products. A schematic diagram illustrating their ability to distinguish multi-copy homologous genes is shown below. Figure 1 As shown.

[0042] Based on this, this application proposes a long-fragment pre-amplification nested PCR amplicon library construction method. This method can effectively distinguish similar genes, reduce non-specific amplification, and improve identification accuracy. A schematic diagram illustrating its ability to distinguish multi-copy homologous genes is shown below. Figure 2 As shown. The method includes: Long fragment homology sorting and amplification: Gene-specific long fragment primers designed in the differential regions of homologous genes are used to specifically amplify long fragments (400~5000bp) of target homologous genes from complex genomes. Physical sorting is achieved by utilizing the cumulative differences in flanking sequences to exclude other homologous copies. Nested length conversion amplification: Using long fragment amplification products as templates, nested primer pairs located inside the long fragment primer pairs are used to amplify short fragments of 100~300bp, converting the long fragments into a format suitable for short read sequencing while preserving the target variant regions; Barcoding and Sequencing Adapter Sequence Addition: Sample-specific barcode sequences are introduced, index sequences and sequencing adapter sequences are added to complete the construction of the amplicon library.

[0043] The detailed steps are broken down as follows: The first round of PCR amplification (long-fragment homology sorting amplification): Using polyploid crop genomic DNA as a template, PCR amplification is performed using gene-specific long-fragment primer pairs. The long-fragment primers are designed in regions of sequence difference between the target gene and its homologous genes, ensuring that only the target homologous gene is specifically amplified in the complex genome, rather than other homologous copies. The long-fragment primer design strategy is as follows: (a) performing multiple sequence alignment of the target gene sequence with all its homologous gene sequences; (b) identifying differentially expressed sites (SNPs, InDels) between homologous genes; (c) designing long-fragment primers in regions containing ≥2 differentially expressed sites, ensuring that the 3' end of the primer covers at least one differentially expressed site. The amplification product length is 400–5000 bp, preferably 400–2000 bp, and the amplification product contains the target variant region and its flanking sequences.

[0044] The second round of PCR amplification (nested length conversion amplification): Using the first round of long-fragment PCR products as templates, nested primer pairs are used for PCR amplification. The nested primer binding site is located inside the long-fragment primer binding site. The forward primer of the nested primer pair is located 50-200 bp downstream of the forward primer of the long-fragment primer pair, and the reverse primer of the nested primer pair is located 50-200 bp upstream of the reverse primer of the long-fragment primer pair. The nested PCR amplification product is 100-300 bp in length and contains the target variant region to be detected. The 5' end of the nested primer pair can be fused with a universal bridging sequence for the subsequent introduction of barcode sequences and sequencing adapter sequences. This step converts the long-fragment product into a short-fragment product adapted for short-read sequencing.

[0045] The third round of PCR amplification (sample barcode introduction): Using the second round of PCR products as templates, PCR amplification is performed using primer pairs containing barcode sequences and universal bridging sequences. A specific barcode sequence with a length of 4~12bp is introduced for each sample. The Hamming distance between different barcode sequences is ≥3, and the GC content is balanced, preferably 38%~62%.

[0046] Fourth-round PCR amplification (sequencing adapter addition): Using the third-round PCR product as a template, PCR amplification is performed using primer pairs containing the index sequence and the adapter sequence from the next-generation sequencing platform. Complete sequencing adapters are added to construct an amplicon library suitable for next-generation sequencing. The index sequence length is 6–10 bp, the Hamming distance between different index sequences is ≥3, and the GC content is balanced, preferably 40%–60%.

[0047] The above steps constitute a four-step database creation method, as shown in the flowchart below. Figure 3 As shown. Furthermore, depending on actual needs, the third and fourth rounds of PCR amplification can be combined into a single PCR amplification step, simultaneously adding barcode sequences, index sequences, and sequencing adapter sequences, i.e., a three-step library construction method. The flowchart is shown below. Figure 4 As shown.

[0048] To make the technical solution of the present invention clearer, the experimental materials used in the embodiments are described below. Unless otherwise specified, they can all be obtained commercially. Experimental methods without specific conditions are generally carried out under conventional conditions or according to the conditions recommended by the manufacturer.

[0049] Example 1: Construction of a soybean ALS gene family amplicon library 1.1 Materials and Target Genes Soybeans Glycine maxThis is an ancient allotetraploid with a large number of homologous genes in its genome. The acetyllactone synthase (ALS) gene family has four homologous copies in soybean: GmALS1 (Glyma.04G196100), GmALS2 (Glyma.06G169700), GmALS3 (Glyma.13G241000), and GmALS4 (Glyma.15G072500). The genome sequences and annotation information of these four genes can be obtained from the following public database platforms: Phytozome (JGI / DOE Joint Genome Institute, https: / / phytozome-next.jgi.doe.gov / ), SoyBase (https: / / www.soybase.org / ), Ensembl Plants (https: / / plants.ensembl.org / ), and the NCBI Gene database (https: / / www.ncbi.nlm.nih.gov / gene / ). The coding region sequences of the four homologous copies showed high similarity, with GmALS1 and GmALS2 exhibiting 92.7% similarity and GmALS3 and GmALS4 showing 93.4% similarity, making them difficult to distinguish under short amplification conditions. ALS is a target gene for sulfonylurea and imidazolinone herbicides, and its mutations are associated with herbicide resistance. Accurately distinguishing the variations among the homologous copies is of great significance for soybean herbicide resistance breeding.

[0050] 1.2 Design of long-fragment primer pairs Multiple sequence alignment (MSA) was performed on the genomic sequences (including coding regions and flanking sequences) of the four GmALS homologous copies to identify differentially expressed sites (SNPs, InDels) between homologous genes. Long primer pairs were designed from the upstream and downstream flanking sequences of the target variant region, containing ≥2 differentially expressed sites, ensuring that the 3' end of the primers covered at least one differentially expressed site to specifically amplify only the target homologous copy. Four pairs of long primers were designed for each of the four homologous copies, with each primer pair amplifying only the corresponding homologous copy. For example, GmALS1-1st-F only targets and amplifies GmALS1, exhibiting 3 differentially expressed sites with GmALS2 (3nt, 4nt, and 18nt at the 3' end of the primer), 8 differentially expressed sites with GmALS3 (1nt, 3nt, 4nt, 9nt, 10nt, 15nt, and 18nt at the 3' end of the primer), and 8 differentially expressed sites with GmALS4 (1nt, 3nt, 4nt, 9nt, 10nt, and 15nt at the 3' end of the primer). (t, 18nt); GmALS2-1st-F only targets and amplifies GmALS2, with 3 differential sites compared to GmALS1 (2nt, 5nt, 23nt at the 3' end of the primer), 5 differential sites compared to GmALS3 (2nt, 8nt, 14nt, 20nt, 23nt at the 3' end of the primer), and 6 differential sites compared to GmALS4 (2nt, 5nt, 8nt, 14nt, 20nt, 23nt at the 3' end of the primer).

[0051] Long-fragment primers GmALS1-1st-F were designed based on the 1709–1730 bp region of the coding region of the GmALS1 genome sequence; long-fragment primers GmALS1-1st-R were designed based on the 184–210 bp region of the 3'UTR region of the GmALS1 genome sequence; long-fragment primers GmALS2-1st-F were designed based on the 1524–1546 bp region of the coding region of the GmALS2 genome sequence; long-fragment primers GmALS2-1st-R were designed based on the 361–384 bp region after the stop codon of the GmALS2 genome sequence; and long-fragment primers GmALS3-1st-R were designed based on the GmALS3 genome sequence. Long-fragment primers GmALS3-1st-F were designed for the 561-585 bp region of the coding region; GmALS3-1st-R was designed for the 109-134 bp region of the 3'UTR of the GmALS3 genome sequence; GmALS4-1st-F was designed for the 615-640 bp region of the coding region of the GmALS4 genome sequence; and GmALS4-1st-R was designed for the 113-142 bp region of the 3''UTR of the GmALS4 genome sequence.

[0052] The nucleotide sequences of the four long-fragment primer pairs are as follows: GmALS1-1st-F: 5'-AGACATTCCAGGACGCGATTTCTC-3', as shown in SEQ ID NO.1; GmALS1-1st-R: 5'-GGCACAATACAGACAACAGGAGATATC-3', as shown in SEQ ID NO.2; GmALS2-1st-F: 5'-CGCTGCTGTTGCTAACCCCGGCG-3', as shown in SEQ ID NO.3; GmALS2-1st-R: 5'-CCAACCGCTAAAAAAGGAAACAGA-3', as shown in SEQ ID NO.4; GmALS3-1st-F: 5'-CGAGGTAACACGTTCCATCACTAAG-3', as shown in SEQ ID NO.5; GmALS3-1st-R: 5'-GTACTAAAAGAAACCAACATCGTATG-3', as shown in SEQ ID NO.6; GmALS4-1st-F: 5'-CTATCTCGTTCTAGATGTTGATGATA-3', as shown in SEQ ID NO.7; GmALS4-1st-R: 5'-GAGACATATAATTAACAAAAATAACCAACA-3', as shown in SEQ ID NO.8.

[0053] 1.3 First round of PCR amplification: long fragment homology sorting and amplification Using soybean genomic DNA as a template, the first round of PCR amplification was performed using the aforementioned long-fragment primer pairs. Following the sequence of the long-fragment primer pairs, the amplification product lengths were 857 bp, 832 bp, 1512 bp, and 1490 bp, respectively.

[0054] The PCR reaction system (20 μL) consisted of: 10 μL of 2× PCR Mix (high-fidelity DNA polymerase GXL 0.05 U / μL, Tris-HCl pH 8.3 40 mM, KCl 100 mM, MgCl2 3.0 mM, dNTP 0.4 mM), 0.5 μL of forward primer (0.5 μM), 0.5 μL of reverse primer (0.5 μM), 1.0 μL of template DNA (100 ng genomic DNA), and ddH2O (sterile deionized water) to a total volume of 20 μL.

[0055] PCR reaction conditions: Stage 1 Pre-denaturation: 95℃, 2 min; Stage 2 Touchdown cycling: 15 cycles, denaturation: 95℃, 10 s, annealing: 65℃→58℃ (decreasing by 0.5℃ per cycle), 15 s, extension: 72℃, 1 min (adjusted by 1 kb / min); Stage 3 Standard cycling: 20 cycles, denaturation: 95℃, 10 s, annealing: 58℃ (fixed), 15 s, extension: 72℃, 1 min (adjusted by 1 kb / min); Stage 4 Final extension: 72℃, 3 min.

[0056] 5 μL of the first-round PCR amplification product was subjected to 1% agarose gel electrophoresis to verify that a specific long fragment band of the expected size was obtained.

[0057] 1.4 Second round of PCR amplification: Nested length conversion amplification Using the first-round PCR amplification product (diluted 30-fold) as a template, a second-round PCR amplification was performed using nested primer pairs located inside the long-fragment primer pairs, containing the target variant region. In the nested primer pairs, a universal bridging sequence is fused to the 5' end of the primers for the subsequent introduction of barcode and sequencing adapter sequences. The nucleotide sequences of the nested primer pairs are as follows, with lowercase sequences indicating the universal bridging sequence: GmALS1-2nd-F: 5'-gtacttgggaagctgcgaGGACACCCCTGGCCCCTACCT-3', as shown in SEQ IDNO.9; GmALS1-2nd-R: 5'-gtacgtggtggacgagagTGGTCTAGGCAATCAGTACCTCG-3', as shown in SEQ IDNO.10; GmALS2-2nd-F: 5'-gtacttgggaagctgcgaCCTGGCCCCTACCTTCTTGATGT-3', as shown in SEQ IDNO.11; GmALS2-2nd-R: 5'-gtacgtggtggacgagagTCTAGGCAATCAGTACCTCG-3', as shown in SEQ IDNO.12; GmALS3-2nd-F: 5'-gtacttgggaagctgcgaCCCCTATCTTCTTGATGTCATTGTACC-3', as shown in SEQ ID NO.13; GmALS3-2nd-R: 5'-gtacgtggtggacgagagGAAATCAGTAACTTGTCCTGCCATC-3', as shown in SEQ ID NO.14; GmALS4-2nd-F: 5'-gtacttgggaagctgcgaCCTGGCCCCTATCTTCTTGATGT-3', as shown in SEQ IDNO.15; GmALS4-2nd-R: 5'-gtacgtggtggacgagagTGCTCAGGAAATCAGTAACTTGTC-3', as shown in SEQ ID NO. 16.

[0058] The PCR reaction system (20 μL) consisted of: 10 μL of 2× PCR Mix (Taq DNA polymerase 0.05 U / μL, Tris-HCl pH 8.3 40 mM, KCl 100 mM, MgCl2 3.0 mM, dNTP 0.4 mM), 0.5 μL of forward primer (0.5 μM), 0.5 μL of reverse primer (0.5 μM), 1.0 μL of template DNA (the first round of PCR amplification product diluted 30 times), and ddH2O (sterile deionized water) to a total volume of 20 μL.

[0059] PCR reaction conditions: Stage 1 pre-denaturation: 95℃, 2 min; Stage 2 conventional cycling: 25 cycles, denaturation: 95℃, 10 s, annealing: 58℃ (fixation), 15 s, extension: 72℃, 1 min (adjusted according to 1 kb / min); Stage 3 final extension: 72℃, 3 min.

[0060] 1.5 Third round of PCR amplification: Sample barcode introduction Using the second-round PCR amplification products as templates, a third round of PCR amplification was performed using primer pairs containing barcode sequences and universal bridging sequences, introducing specific barcode sequences for each sample.

[0061] The nucleotide sequences of the barcode primer pairs are as follows, where M represents the barcode sequence, which is selected from Table 1, and lowercase sequences represent universal bridging sequences: The general structure of the forward primer of the barcode primer pair is: 5'-ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttMtgtacttgggaagctgcga-3', as shown in SEQ ID NO.17; The universal reverse primer structure for the barcode primer pair is: 5'-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTctgtMtgtacgtggtggacgagag-3', as shown in SEQ ID NO.18.

[0062] The PCR reaction system (20 μL) consisted of: 10 μL of 2× PCR Mix (Taq DNA polymerase 0.05 U / μL, Tris-HCl pH 8.3 40 mM, KCl 100 mM, MgCl2 3.0 mM, dNTP 0.4 mM), 0.5 μL of forward primer (0.5 μM), 0.5 μL of reverse primer (0.5 μM), 1.0 μL of template DNA (second round PCR amplification product diluted 30 times), and ddH2O (sterile deionized water) to a total volume of 20 μL.

[0063] PCR reaction conditions: Stage 1 pre-denaturation: 95℃, 2 min; Stage 2 conventional cycling: 25 cycles, denaturation: 95℃, 10 s, annealing: 58℃ (fixation), 15 s, extension: 72℃, 1 min (adjusted according to 1 kb / min); Stage 3 final extension: 72℃, 3 min.

[0064] 1.6 Fourth round of PCR amplification: Sequencing adapter addition Using the third-round PCR amplification product as a template, a fourth round of PCR amplification was performed using primer pairs containing the index sequence and the adapter sequence of the next-generation sequencing platform, with the addition of complete sequencing adapters.

[0065] The nucleotide sequences of the index primer pairs are as follows, where M represents the index sequence, which is selected from Table 1: The general structure of the forward primer of the index primer pair is: 5'-CAAGCAGAAGACGGCATACGAGATMGTGACTGGAGTTCAGACGTGTGCTCTT-3', as shown in SEQ ID NO.19; The reverse universal fixed primer for amplification in combination with the Index forward primer is 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT-3', as shown in SEQ ID NO.20.

[0066] The PCR reaction system (20 μL) consisted of: 10 μL of 2× PCR Mix (Taq DNA polymerase 0.05 U / μL, Tris-HCl pH 8.3 40 mM, KCl 100 mM, MgCl2 3.0 mM, dNTP 0.4 mM), 0.5 μL of forward primer (0.5 μM), 0.5 μL of reverse primer (0.5 μM), 1.0 μL of template DNA (the third round of PCR amplification product diluted 30 times), and ddH2O (sterile deionized water) to a total volume of 20 μL.

[0067] PCR reaction conditions: Stage 1 pre-denaturation: 95℃, 2 min; Stage 2 conventional cycling: 25 cycles, denaturation: 95℃, 10 s, annealing: 58℃ (fixation), 15 s, extension: 72℃, 1 min (adjusted according to 1 kb / min); Stage 3 final extension: 72℃, 3 min.

[0068] Table 1 Barcode Sequences and Index Sequences

[0069] 1.7 Library Quality Control and Sequencing The fourth round of PCR amplification products were mixed in equal volumes, purified using magnetic beads, and then subjected to library concentration determination (Qubit) and fragment size verification (Agilent Bioanalyzer / Fragment Analyzer). After confirming that the library fragment size met expectations, sequencing was performed on a next-generation sequencing platform.

[0070] 1.8 Data Analysis and Results of Distinguishing Between Sources After quality filtering, sequencing reads were aligned with reference sequences of four homologous copies of the soybean ALS gene family. Since homology sorting was achieved in the first round of PCR amplification, reads from each sample could be accurately assigned to their corresponding homologous copies. Results showed that the method described in this application achieved a homology discrimination accuracy of 97%–100% for the four homologous copies of the soybean ALS gene family, with a non-specific amplification rate of 0%–3%. The amplification specificity verification diagram of long-fragment primer pairs for the four homologous copies of the soybean ALS gene family is shown below. Figure 5 As shown. The quality control image of the soybean GmALS amplicon library is shown below. Figure 6 As shown in the figure, the final fragment length is approximately 300 bp, with a clear main band. The Qsep peak diagram of the mixed library shows that the library has no adapter dimers, no primer residues, and a concentrated fragment length, indicating high library quality. The sequencing results and read assignments of the soybean GmALS1 gene are shown in Table 2. From the sequencing results in Table 2, the corresponding sample DNA sequences can be identified. Using Snapgene software, these sequences were compared with the reference sequences, confirming that the wild-type and gene-edited reads were accurately assigned to the GmALS1 gene.

[0071] Table 2 Sequencing results and read assignments of the soybean GmALS1 gene

[0072]

[0073]

[0074] 1.9 Homology Distinction between Sequencing Data and Traditional Library Construction Methods The traditional method for building a database is as follows: First round of PCR amplification: Using soybean genomic DNA as a template, PCR amplification was performed using the nested primer pairs described above (section 1.4 of Example 1) (no pre-amplification or length conversion required). The PCR reaction system (20 μL) consisted of: 10 μL of 2× PCR Mix (high-fidelity DNA polymerase GXL 0.05 U / μL, Tris-HCl pH 8.3 40 mM, KCl 100 mM, MgCl2 3.0 mM, dNTP 0.4 mM), 0.5 μL of forward primer (0.5 μM), 0.5 μL of reverse primer (0.5 μM), 1.0 μL of template DNA (100 ng genomic DNA), and ddH2O (sterile deionized water) to a total volume of 20 μL.

[0075] PCR reaction conditions: Stage 1 Pre-denaturation: 95℃, 2 min; Stage 2 Touchdown cycling: 15 cycles, denaturation: 95℃, 10 s, annealing: 65℃→58℃ (decreasing by 0.5℃ per cycle), 15 s, extension: 72℃, 1 min (adjusted by 1 kb / min); Stage 3 Standard cycling: 20 cycles, denaturation: 95℃, 10 s, annealing: 58℃ (fixed), 15 s, extension: 72℃, 1 min (adjusted by 1 kb / min); Stage 4 Final extension: 72℃, 3 min.

[0076] 5 μL of the first-round PCR amplification product was subjected to 1% agarose gel electrophoresis to verify that a specific long fragment band of the expected size was obtained.

[0077] Second round of PCR amplification: Sample barcode introduction Using the first-round PCR amplification product as a template, a second round of PCR amplification was performed using primer pairs containing a barcode sequence and a universal bridging sequence, introducing the barcode sequence described above (section 1.5 in Example 1) into each sample.

[0078] The PCR reaction system (20 μL) consisted of: 10 μL of 2× PCR Mix (Taq DNA polymerase 0.05 U / μL, Tris-HCl pH 8.3 40 mM, KCl 100 mM, MgCl2 3.0 mM, dNTP 0.4 mM), 0.5 μL of forward primer (0.5 μM), 0.5 μL of reverse primer (0.5 μM), 1.0 μL of template DNA (the first round of PCR amplification product diluted 30 times), and ddH2O (sterile deionized water) to a total volume of 20 μL.

[0079] PCR reaction conditions: Stage 1 pre-denaturation: 95℃, 2 min; Stage 2 conventional cycling: 25 cycles, denaturation: 95℃, 10 s, annealing: 58℃ (fixation), 15 s, extension: 72℃, 1 min (adjusted according to 1 kb / min); Stage 3 final extension: 72℃, 3 min.

[0080] Third round of PCR amplification: Sequencing adapter addition Using the second-round PCR amplification product as a template, a fourth round of PCR amplification was performed using the primer pair containing the Index sequence and the adapter sequence of the second-generation sequencing platform (section 1.6 in Example 1), and complete sequencing adapters were added.

[0081] The PCR reaction system (20 μL) consisted of: 10 μL of 2× PCR Mix (Taq DNA polymerase 0.05 U / μL, Tris-HCl pH 8.3 40 mM, KCl 100 mM, MgCl2 3.0 mM, dNTP 0.4 mM), 0.5 μL of forward primer (0.5 μM), 0.5 μL of reverse primer (0.5 μM), 1.0 μL of template DNA (second round PCR amplification product diluted 30 times), and ddH2O (sterile deionized water) to a total volume of 20 μL.

[0082] PCR reaction conditions: Stage 1 pre-denaturation: 95℃, 2 min; Stage 2 conventional cycling: 25 cycles, denaturation: 95℃, 10 s, annealing: 58℃ (fixation), 15 s, extension: 72℃, 1 min (adjusted according to 1 kb / min); Stage 3 final extension: 72℃, 3 min.

[0083] The results are as follows Figure 7 As shown, the accuracy of this application is 97%~100%, while the accuracy of traditional methods is only 9%~16%, showing a significant difference. Compared with traditional methods, the accuracy of this application is significantly improved.

[0084] Example 2 Construction of soybean FAD2-1 gene family amplicon library 2.1 Target genes The FAD2-1 gene: The soybean fatty acid desaturase 2-1 (GmFAD2-1) gene has two homologous copies: GmFAD2-1A (Glyma.10g278000) and GmFAD2-1B (Glyma.20g111000). The genomic sequences and annotation information of these two genes can be obtained from the following public database platforms: Phytozome (JGI / DOE Joint Genome Institute, https: / / phytozome-next.jgi.doe.gov / ), SoyBase (https: / / www.soybase.org / ), Ensembl Plants (https: / / plants.ensembl.org / ), and the NCBI Gene database (https: / / www.ncbi.nlm.nih.gov / gene / ). The two sequences are highly similar, with a similarity of 94.8%, making them difficult to distinguish using traditional library construction methods. GmFAD2-1 controls the oleic acid / linoleic acid ratio in soybeans and is an important target for improving soybean oil quality. Accurately distinguishing the variations of each homologous copy is of great significance for breeding high-quality soybeans.

[0085] 2.2 Methods Following the procedure in Example 1, long-fragment primer pairs and nested primer pairs were designed for FAD2-1A and FAD2-1B, respectively, and four rounds of PCR amplification and library construction were performed. For example, FAD2-1A-1st-F only targets and amplifies FAD2-1A, and has 5 differential sites compared to FAD2-1B (1nt, 2nt, 3nt, 6nt, and 17nt at the 3' end of the primer); FAD2-1A-1st-R only targets and amplifies FAD2-1A, and has 3 differential sites compared to FAD2-1B (3nt, 11nt, and 15nt at the 3' end of the primer); FAD2-1B-1st-F only targets and amplifies FAD2-1B, and has 8 differential sites compared to FAD2-1A (1nt, 2nt, 3nt, 4nt, 6nt, 7nt, 9nt, and 21nt at the 3' end of the primer); FAD2-1B-1st-R only targets and amplifies FAD2-1B, and has 8 differential sites compared to FAD2-1A (3nt, 11nt, and 15nt at the 3' end of the primer).

[0086] Long-fragment primers FAD2-1A-1st-F were designed based on the -99 to -73 bp region of the FAD2-1A genome sequence promoter; long-fragment primers FAD2-1A-1st-R were designed based on the 850 to 872 bp region of the coding region of the FAD2-1A genome sequence; long-fragment primers FAD2-1B-1st-F were designed based on the 360 ​​to 381 bp region of the FAD2-1B genome sequence; and long-fragment primers FAD2-1B-1st-R were designed based on the 1280 to 1302 bp region of the FAD2-1B genome sequence.

[0087] The nucleotide sequences of the two long-fragment primer pairs are as follows: FAD2-1A-1st-F: TTGTAGTTCTGTTGGTACATATTACAC, as shown in SEQ ID NO.77; FAD2-1A-1st-R: GCCAAAGCTCCCTTCAGCCAGTC, as shown in SEQ ID NO.78; FAD2-1B-1st-F: AGACATTCAGCAACAACAACTG, as shown in SEQ ID NO.79; FAD2-1B-1st-R: GCCAAAGCACCCCTCAGCCAATC, as shown in SEQ ID NO.80; The FAD2 long-fragment primer pair amplified products with lengths of 971bp and 943bp.

[0088] The nucleotide sequences of the two nested primer pairs are as follows: FAD2-1A-2nd-F:gtacttgggaagctgcgaTCCTATGTTGTTTATGACCTTTC,as shown in SEQ ID NO.81; FAD2-1A-2nd-R: gtacgtggtggacgagagGTGACCACACTCGTGAGCAATC, as shown in SEQ ID NO.82; FAD2-1B-2nd-F:gtacttgggaagctgcgaCCTCCTCACTTCATTCTCCTATGTTG,as shown in SEQ ID NO.83; FAD2-1B-2nd-R: gtacgtggtggacgagagCAACCCATTGGTACTTGCTGAAGG, as shown in SEQ ID NO.84.

[0089] 2.3 Results This application achieved 100% accuracy in homology differentiation for both FAD2-1A and FAD2-1B, with a non-specific amplification rate of 0%. The results indicate that this application is effective for homologous gene families with different copy numbers.

[0090] The specificity verification diagram of long-fragment primer pairs for two homologous copies of the soybean FAD2 gene family is shown in the figure below. Figure 8 As shown in the figure, the pre-amplification long fragment primer pair in this application exhibits specificity in amplifying only the target homologous copy and not other homologous copies. The quality control diagram of the soybean GmFAD2 amplicon library is shown below. Figure 9 As shown in the figure, the final fragment length for sequencing is approximately 300 bp, with a clear main band. The Qsep peak diagram of the mixed library shows that the library has no adapter dimers, no primer residues, and a concentrated fragment length, indicating high library quality. The sequencing results and read assignments of the soybean GmFAD2-1A gene are shown in Table 3. From the sequencing results in Table 3, the corresponding sample DNA sequences can be identified. Using Snapgene software, these sequences were compared with the reference sequences, confirming that the wild-type and gene-edited reads were accurately assigned to the GmFAD2-1A gene.

[0091] Table 3 Sequencing results and read assignments of the soybean GmFAD2-1A gene

[0092]

[0093] 2.4 Homology Distinction between Sequencing Data and Traditional Library Construction Methods The traditional method for library construction is the same as part 1.9 in Example 1, except that the primer pairs used are replaced with the primer pairs corresponding to part 2.2 in Example 2.

[0094] The results are as follows Figure 10 As shown, the accuracy of this application is 100%, while the accuracy of traditional methods is only 15% to 18%, showing a significant difference.

[0095] Example 3 Construction of tobacco NtSTOP1 / NtSTOP2 gene amplicon library 3.1 Materials and Target Genes tobacco( Nicotiana benthamianaThis genome is an allotetraploid with numerous homologous gene pairs. STOP1 is a key transcription factor for aluminum toxicity tolerance. In tobacco, NbeSTOP1-1 (Nbe07g10800) and NbeSTOP1-2 (Nbe08g27900) exist, exhibiting high sequence similarity (97.4%), making them difficult to distinguish under short amplification conditions. The gene IDs can be found in the public genome database Phytozome (https: / / phytozome-next.jgi.doe.gov), belonging to the genome "Nicotiana benthamiana var. NbeHZ1 v1.0" (Phytozome genome ID: 946, NCBI taxonomy ID: 4100). The corresponding NCBI genome assembly number is GCA_034376525.1 (ASM3437652v1), and the BioProject number is PRJNA1034276, submitted by the Korea Institute of Bioscience and Biotechnology (KRIBB). NbeSTOP1 is an important target for improving tobacco stress tolerance, and accurately distinguishing the variations of each homologous copy is of great significance for tobacco breeding.

[0096] 3.2 Methods Following the procedure in Example 1, long-fragment primer pairs and nested primer pairs were designed for homologous copies of NbeSTOP1-1 and NbeSTOP1-2, respectively. Differential sites were identified by using the sequence alignment software Snapgene. Long-fragment primer pairs were designed for segments containing ≥2 differential sites, ensuring that the 3' end of the primers covered at least one differential site. For example, NbeSTOP1-1st-F only targets and amplifies NbeSTOP1, and has four different sites from NbeSTOP2 (4nt, 14nt, 17nt, and 19nt at the 3' end of the primer); NbeSTOP1-1st-R only targets and amplifies NbeSTOP1, and has three different sites from NbeSTOP2 (3nt, 6nt, and 22nt at the 3' end of the primer); NbeSTOP2-1st-F only targets and amplifies NbeSTOP2, and has four different sites from NbeSTOP1 (2nt, 4nt, 12nt, and 24nt at the 3' end of the primer); NbeSTOP2-1st-R only targets and amplifies NbeSTOP2, and has three different sites from NbeSTOP1 (3nt, 6nt, and 22nt at the 3' end of the primer).

[0097] Long-fragment primers NbeSTOP1-1-1st-F were designed based on the 244-267 bp segment of the coding region of the NbeSTOP1-1 genome sequence; long-fragment primers NbeSTOP1-1-1st-R were designed based on the 1383-1406 bp segment of the coding region of the NbeSTOP1-1 genome sequence; long-fragment primers NbeSTOP1-2-1st-F were designed based on the -5-20 bp segment of the promoter and coding region of the NbeSTOP1-2 genome sequence; and long-fragment primers NbeSTOP1-2-1st-R were designed based on the 1383-1406 bp segment after the stop codon of the NbeSTOP1-2 genome sequence.

[0098] The nucleotide sequences of the two long-fragment primer pairs are as follows: NbeSTOP1-1-1st-F: CATGATTTGATCAGCACAAAAGAC, as shown in SEQ ID NO.107; NbeSTOP1-1-1st-R: CTCGTATCAAAGTTCAAAGGCAAG, as shown in SEQ ID NO.108; NbeSTOP1-2-1st-F: CGGATATGGATCCTGATGACATTCT, as shown in SEQ ID NO.109; NbeSTOP1-2-1st-R: CTAGTATCAAAGTTCAAATGCGAG, as shown in SEQ ID NO.110.

[0099] The amplification products of the long primer pairs were 1163bp and 1411bp in length.

[0100] The nucleotide sequences of the two nested primer pairs are as follows: NbeSTOP1-1-2nd-F: gtacttgggaagctgcgaCCAATTGGTTTCAACGGCAGG, as shown in SEQ IDNO.111; NbeSTOP1-1-2nd-R: gtacgtggtggacgagagTGATTCATGTTCATCAACAGCATGG, as shown in SEQ IDNO.112; NbeSTOP1-2-2nd-F: gtacttgggaagctgcgaCAATTGGTTTCAACTGCAGGAAG, as shown in SEQ IDNO.113; NbeSTOP1-2-2nd-R: gtacgtggtggacgagagTGACTCATGTCCATCAACAGCATGG, as shown in SEQ IDNO.114.

[0101] 3.3 Results This application demonstrates a homology differentiation accuracy of 96%–99% for both NbeSTOP1-1 and NbeSTOP1-2 tobacco species, with a nonspecific amplification rate of 2%–4%. The results indicate that this application is also effective in allotetraploid tobacco, demonstrating cross-species applicability.

[0102] The specificity verification diagram for amplification of long fragment primer pairs containing two homologous copies of the tobacco NbeSTOP1 gene family is shown in the figure below. Figure 11 As shown in the figure, the pre-amplification long-fragment primer pair in this application exhibits specificity in amplifying only the target homologous copy and not other homologous copies. The quality control diagram of the tobacco NbeSTOP1 amplicon library is shown below. Figure 12 As shown in the figure, the final fragment length is approximately 300 bp, with a clear main band. The Qsep peak diagram of the mixed library shows that the library has no adapter dimers, no primer residues, and a concentrated fragment length, indicating high library quality. The sequencing results and read assignments of the tobacco NbeSTOP1-1 gene are shown in Table 4. From the sequencing results in Table 4, the corresponding sample DNA sequences can be identified. Using Snapgene software, these sequences were compared with the reference sequences, confirming that the wild-type and gene-edited reads were accurately assigned to the NbeSTOP1 gene.

[0103] Table 4. Sequencing results and read assignments of the tobacco NbeSTOP1 gene in Example 3.

[0104]

[0105] 3.4 Homology Distinction between Sequencing Data and Traditional Library Construction Methods The traditional method for library construction is the same as part 1.9 in Example 1, except that the primer pairs used are replaced with the primer pairs corresponding to part 3.2 in Example 3.

[0106] The results are as follows Figure 13 As shown, the accuracy of this application is 96%~99%, while the accuracy of traditional methods is only 2%~4%, showing a significant difference. Compared with traditional methods, the accuracy of this application is significantly improved.

[0107] The above are merely specific embodiments of this application, but the scope of protection of this application is not limited thereto. Any person skilled in the art can easily conceive of various equivalent modifications or substitutions within the technical scope disclosed in this application, and these modifications or substitutions should all be covered within the scope of protection of this application. Therefore, the scope of protection of this application should be determined by the scope of the claims.

Claims

1. A method for constructing a library of long-fragment pre-amplified nested PCR amplicon, characterized in that, include: Long fragment homology sorting and amplification: Using polyploid crop genomic DNA as a template, PCR amplification is performed using long fragment primer pairs to obtain long fragment amplification products. The length of the long fragment amplification products is 400~5000bp and contains the target variant region and its flanking sequences. The long fragment primer pairs are designed in the sequence difference segments between the target gene and the target homologous gene. The design method for the long-fragment primer pairs includes: Perform multiple sequence alignment of the target gene sequence with all its homologous gene sequences; Identify differentially expressed sites between homologous genes, including SNPs and / or InDels; The long-fragment primer pairs are designed in segments containing ≥2 differential sites, such that the 3' end of the primer pair covers at least one differential site; Nested length conversion amplification: Using the amplification product of the long fragment as a template, PCR amplification is performed using nested primer pairs to obtain a short fragment amplification product with a length of 100~300bp that retains the target variant region. The binding site of the nested primer pair is located inside the binding site of the long fragment primer pair. Barcoding and Sequencing Adapter Addition: Using the short fragment amplification product as a template, sample-specific barcode sequences are introduced, and index sequences and sequencing adapter sequences from the next-generation sequencing platform are added to construct an amplicon library.

2. The method for constructing a library of long-fragment pre-amplified nested PCR amplicon according to claim 1, characterized in that, The length of the long fragment amplification product is 400~2000bp.

3. The method for constructing a library of long-fragment pre-amplified nested PCR amplicon according to claim 1, characterized in that, The forward primer binding site of the nested primer pair is located 50-200 bp downstream of the amplified inner side of the forward primer binding site of the long fragment primer pair, and the reverse primer binding site of the nested primer pair is located 50-200 bp upstream of the amplified inner side of the reverse primer binding site of the long fragment primer pair.

4. The method for constructing a library of long-fragment pre-amplified nested PCR amplicon according to claim 1, characterized in that, The nested primer pair has a universal bridging sequence fused to its 5' end, which is used to introduce the barcode sequence and the sequencing adapter sequence.

5. The method for constructing a library of long-fragment pre-amplified nested PCR amplicon according to claim 1, characterized in that, The introduction of the barcode sequence is completed in the same PCR amplification step as the addition of the index sequence and sequencing adapter sequence; or The introduction of the barcode sequence is completed in a one-step PCR amplification reaction, and the addition of the index sequence and sequencing adapter sequence is completed in another PCR amplification reaction.

6. The method for constructing a library of long-fragment pre-amplified nested PCR amplicon according to claim 1, characterized in that, The barcode sequence has a length of 4~12bp, a Hamming distance ≥3, and a GC content of 38%~62%; and / or The index sequence has a length of 6~10bp, a Hamming distance ≥3, and a GC content of 40%~60%.

7. A method for constructing a library of long-fragment pre-amplified nested PCR amplicon according to claim 1, characterized in that, The barcode sequence comprises the nucleotide sequence shown in SEQ ID NO. 17~28; and / or The index sequence includes nucleotide sequences as shown in SEQ ID NO.29~40.

8. The method for constructing a library of long-fragment pre-amplified nested PCR amplicon according to claim 1, characterized in that, The method of using DNA polymerase in PCR amplification is selected from any one of A1 to A3 below: A1. All used Taq DNA polymerase; A2. All use high-fidelity DNA polymerase; A3. High-fidelity DNA polymerase is used for long-fragment homologous sorting and amplification, while Taq DNA polymerase is used for the remaining PCR amplification.

9. The application of the amplicon library obtained by the long-fragment pre-amplified nested PCR amplicon library construction method according to any one of claims 1 to 8 in genotyping, mutation detection, molecular marker-assisted selection and variety identification of polyploid crops; The polyploid crops include soybeans, cotton, rapeseed, wheat, peanuts, and tobacco.

10. A method for detecting genotypes in polyploid crops, characterized in that, include: The sequencing data obtained by sequencing the amplicon library constructed by the library construction method according to any one of claims 1 to 8 is compared with the reference sequence to obtain homology differentiation results. The polyploid crops include soybean, cotton, rapeseed, wheat, peanut and tobacco.

Images