A click chemistry-based method for capturing RNA-DNA interactions

Abstract

The application discloses an RNA-DNA interaction capture method based on click chemistry and belongs to the technical field of biology. The RNA-DNA interaction capture method comprises the following steps: performing cell membrane lysis and permeabilization treatment on fixed cells, then performing chromatin fragmentation, RNA fragmentation and modification, chimera connection and purification, DNA end linker incorporation, RNA reverse transcription, chimera magnetic bead enrichment and amplification in sequence. The RNA-DNA interaction capture method mainly uses copper-catalyzed azide-alkyne cycloaddition reaction to replace proximity ligation enzyme to realize efficient chemical connection of RNA and DNA. By the method, the cell input amount can be significantly reduced, the library construction process can be simplified, the data alignment quality can be improved, various different types of RNA-DNA interaction events can be captured, and low-abundance interactions can be effectively detected. Therefore, the RNA-DNA interaction capture method has a good application prospect.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a click chemistry-based method for capturing RNA-DNA interactions. Background Technology

[0002] Click-based RNA-DNA Interactions by Sequencing (CRIS-seq) is a technique that uses high-throughput sequencing based on the principle of proximity connectivity to systematically identify the spatial proximity relationships between RNA molecules and chromatin DNA within cells. A representative protocol in this class is GRID-seq, and other similar techniques include MARGI, ChAR-seq, RADICL-seq, and Red-C.

[0003] The core workflow of GRID-seq is as follows: First, cells are sequentially cross-linked and fixed using DSG and formaldehyde to stabilize the spatial proximity of RNA and chromatin. Then, the cell membrane is lysed and the nucleus is permeated. Biotinylated bivalent linkers are added into the nucleus, and spatially adjacent RNA and DNA fragments are linked into chimeric molecules under the catalysis of a proximity ligase. After ligation, restriction endonucleases are used to recognize the restriction sites on the linkers, generating 18-20 bp RNA and DNA end sequence tags. These chimeric fragments are then used for library construction and high-throughput paired-end sequencing, allowing simultaneous reading of RNA and DNA sequence information. The core principle of this technology is that within the cross-linked and fixed cell nucleus, biotinylated bivalent linkers and ligases achieve in-situ proximity ligation of RNA and chromatin, and then sequencing identifies RNA-chromatin interaction pairs across the entire genome, providing an important tool for studying the spatial function of RNA in chromatin regulation.

[0004] However, these technologies have the following limitations: the cell input volume is large, approximately 10... 6 -10 8The limited number of cells makes it unsuitable for use with precious cell samples and clinical samples; the proximity ligation step relies on ligases, resulting in low ligation efficiency and strong bias. In the linker-RNA ligation step, T4 RNA ligase is sensitive to RNA secondary structures and has difficulty capturing small RNAs with hairpin structures (such as miRNAs), introducing systematic bias in library construction; it only produces short RNA and DNA sequence tags, and the unique mapping rate of GRID-seq data is only about 14%, making it difficult to detect repetitive sequence-related interaction events; the operation is complex, the experimental cycle is long, and the reproducibility is low, easily causing RNA degradation and library loss during the experiment; it is difficult to detect low-abundance interaction events, such as promoter upstream transcripts and enhancer RNA (eRNA) and other regulatory element-derived RNAs that cannot be effectively captured.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The purpose of this invention is to provide a click chemistry-based RNA-DNA interaction capture method. This method mainly utilizes copper-catalyzed azide-alkynyl cycloaddition reaction (CuAAC) to replace the neighboring ligase to achieve efficient chemical ligation of RNA and DNA. This method can not only significantly reduce cell input, simplify the library construction process, and improve data comparison quality, but also capture various types of RNA and effectively detect low-abundance interactions.

[0007] This invention is implemented as follows: This invention provides a click chemistry-based RNA-DNA interaction capture method, the flowchart of which is shown below. Figure 1 As shown, the main processes include cell fixation, cell lysis and permeabilization, chromatin fragmentation, RNA fragmentation and modification, chimera ligation and purification, DNA end-linker incorporation, RNA reverse transcription, and chimeric magnetic bead enrichment and amplification. The specific steps are as follows: S1. Cell fixation In this invention, cell fixation can be performed using conventional fixation methods in the art, such as using formaldehyde for cell fixation. This invention does not impose any specific limitations on this method.

[0008] S2. Cell lysis and permeabilization treatment NP-40 buffer was added to the immobilized cells obtained from S1, and the nuclei were collected after lysis. SDS solution was added to the nuclei to permeate them. After permeation was terminated, carboxyl magnetic beads were added and incubated to obtain a bead-nucleus mixture.

[0009] In some embodiments, the SDS solution has a mass-volume fraction of 0.2% to 0.5%, and the permeation treatment conditions are: temperature of 60°C and incubation for 5 to 10 minutes.

[0010] In some embodiments, the cell input for lysis is <10 5 It can even be reduced to 10 4 The amount of cells input is reduced by at least two orders of magnitude compared to traditional techniques. The reason why the cell input amount can be significantly reduced in this invention is that: the use of click chemilinking greatly simplifies the experimental procedure and reduces the required cell input amount; the use of carboxylated magnetic beads as a carrier to fix and visualize the cell nucleus during in situ ligation, thereby adapting to conditions with a small number of cells; in addition, the purification of cell nuclei using PEG8000 / 2.5M NaCl can also promote the removal of free genomic fragments and excessive modified nucleotides, reducing background noise.

[0011] S3. Chromatin fragmentation Transposome-CRIS, formed by the combination of a transposase and a 5' azide-modified linker, was used to fragment chromatin and chemically modify magnetic bead-nucleus mixtures.

[0012] In this invention, Transposome-CRIS is formed by combining Tn5 enzyme with an annealed CRIS adapter; the 5' end of the forward strand of the CRIS adapter is azid-modified, and the 4th base T is biotin-labeled, and its nucleotide sequence is shown in SEQ ID No. 1; the 3' end of the reverse strand of the CRIS adapter is ddC-modified, and its nucleotide sequence is shown in SEQ ID No. 2.

[0013] In order to replace the neighboring ligase to achieve efficient chemical ligation of RNA-DNA, this invention performs azide modification on the 5' end of the adapter embedded in Tn5 transposase. Using this transposon, the CRIS adapter with the azide group is inserted into the 5' end of the DNA fragment while cutting the genomic DNA, so as to achieve the simultaneous completion of DNA fragmentation and chemical labeling.

[0014] This invention utilizes CuAAC chemical ligation to replace neighboring ligases, which is more efficient than enzymatic ligation, produces no ligation byproducts, and has no ligation bias. It fundamentally solves the technical bottleneck of low efficiency and strong bias of neighboring ligases in existing RNA-chromatin interaction technologies. In addition, because CuAAC greatly reduces the complexity of traditional reactions, reduces operation time and operation steps, it reduces cell loss and optimizes cell input.

[0015] Optionally, the Tn5 transposase can be replaced with a protein A / G-Tn5 fusion protein to target specific proteins and achieve protein-anchored RNA-chromatin interaction capture. This extended protocol utilizes protein A / G-Tn5 to target the target protein instead of immunoprecipitation, while simultaneously achieving chromatin fragmentation and chemical modification, further narrowing the captured genomic range and improving the sensitivity of target region interaction detection.

[0016] S4. RNA Fragmentation and Modification RNA fragmentation was performed by adding ribonuclease, followed by dephosphorylation and alkyne modification of the 3' end.

[0017] In some embodiments, alkyne modification includes adding the dephosphorylated RNA product to a reaction system containing yeast Poly(A) polymerase.

[0018] In some embodiments, the reaction system for alkyne modification is: a mixture of bead nuclei after dephosphorylation of the 3' end of RNA, 10 µL of 5× Poly(A) Polymerase Reaction Buffer, 2 µL of 25 mM 3-(O-propynyl)-ATP and 4 µL of yeast Poly(A) polymerase, with water added to a final volume of 50 µL.

[0019] S5. Chimeric Ligation and Purification The product of alkynyl modification at the 3' end of RNA was added to the CuAAC reaction system for chimeric ligation; after decrosslinking and purification, RNA-DNA chimeras were obtained.

[0020] In some embodiments, the CuAAC reaction system contains: 28.2 µL 50 mM HEPES, 37.8 µL 100 (V / V)% DMSO, and 9.6 µL CuAAC mixture; the CuAAC mixture is a pre-mixed solution of 8 µL Copper(II)-TBTA and 1.6 µL 50 mM sodium ascorbate.

[0021] By introducing azide modification at the 5' end of DNA and alkyne modification at the 3' end of RNA, and then under CuAAC reaction conditions, DNA and RNA are linked by a triazole linker structure to form an RNA-DNA chimera.

[0022] Compared to the CuAAC reaction, the copper-free SPAAC reaction can replace the CuAAC reaction to link DNA and RNA, but the resulting triazole linker structure has greater steric hindrance and poor reverse transcriptase compatibility.

[0023] The DNA-RNA chimera is released by decrosslinking. In some embodiments of the present invention, the decrosslinking system consists of: the washed RNA-DNA chimera product, 10 µL 1M Tris-HCl (pH 7.0), 20 µL 10% SDS, 0.4 µL 0.5 MEDTA (pH 8.0), 4 µL 5 M NaCl, 10 µL Proteinase K, and water added to a final volume of 200 µL. The decrosslinking conditions are: incubation at 58°C for 4 hours.

[0024] In some embodiments, purification includes: adding magnetic beads to the decrosslinked product, allowing the RNA-DNA chimera to bind to the surface of the magnetic beads after sufficient reaction, washing away residual impurities, and then eluting to release the RNA-DNA chimera from the magnetic beads back into the solution.

[0025] S6. DNA end-fitter ligation Chromatin DNA that was not linked to RNA by the CuAAC reaction was removed, and after elution, an S7 adapter was introduced into the DNA end of the RNA-DNA chimera using Transposome-S7.

[0026] In some embodiments, the method for removing cell-free DNA includes: adding RecJ to the product obtained in step S5. f Exonuclease. Compared to not performing RecJ... f Exonuclease treatment, RecJ f Exonuclease treatment can effectively recognize single-stranded DNA ends with an 5' azide group and perform nucleotide excision in the 5' to 3' direction. Using RecJ... f By removing the biotin-modified bases at the 5' overhang of the free DNA single strand along the 5' to 3' direction, the free DNA cannot be captured by streptavidin magnetic beads, effectively removing background DNA noise.

[0027] In some embodiments, Transposome-S7 is formed by combining Tn5 enzyme with an annealed synthesized S7 linker; the nucleotide sequence of the forward strand of the S7 linker is shown in SEQ ID No. 3; the 3' end of the reverse strand of the S7 linker is modified with ddC, and its nucleotide sequence is shown in SEQ ID No. 4.

[0028] The principle of Transposome-S7 is the same as that of Transposome-CRIS. It uses the Tn5 enzyme to cut DNA and simultaneously attaches the S7 adapter to the ends of all the cut DNA fragments to facilitate subsequent library sequencing.

[0029] S7. RNA reverse transcription RNA-DNA chimeras with S7 linkers attached to their DNA ends are added to a reverse transcription system containing template-converting oligonucleotides to perform reverse transcription of RNA.

[0030] In some embodiments, RT buffer and dNTPs are added to the obtained chimeric product, and the mixture is incubated at 65°C for 5 min and then quickly transferred to ice; RiboLock RNase Inhibitor, Maxima H Minus, and PEG8000 are then added, and the mixture is incubated at 50°C for 60 min; template-converting oligonucleotides are then added, and the mixture is incubated at 50°C for 60 min.

[0031] In some embodiments, the sequence of the template-converted oligonucleotide is shown in SEQ ID No. 5.

[0032] The principle of reverse transcription and template conversion between reverse transcriptase and TSO in S7 is as follows: While synthesizing the first strand of cDNA, reverse transcriptase utilizes its terminal transferase activity to add three additional cytosine deoxyribonucleotides (dCs) to the 3' end of the newly synthesized cDNA. These three dCs complementarily pair with the rGrG+G in the template conversion oligonucleotide TSO, achieving template conversion and adding the TSO sequence to the 3' end of the cDNA. In TSO, LNA-G forms a methylene bridge between the 2'-O and 4'-C atoms on the ribose through a condensation reaction, creating a more stable double-stranded structure with the dCs and improving template conversion efficiency.

[0033] In some embodiments, the reverse transcription system consists of: 12.8 µL chimera, 8 µL 5×RT buffer, 2 µL 10mM dNTP, 1 µL RiboLock RNase Inhibitor, 3 µL Maxima H Minus, 12.8 µL 50 (W / V)% PEG8000, and 0.4 µL 100 µM template-converting oligonucleotides.

[0034] It is important to note that because the transposition reaction of the Tn5 enzyme creates a 9-base gap on the other strand of the target DNA, the presence of both the ME sequence and the 9-bp gap at the RNA-DNA ligation site leads to competition between reverse transcription strand substitution extension, gap filling, and template conversion. This results in some RNA sequences successfully ligating to DNA via CuAAC, but the reverse transcriptase may not extend to the RNA and may stop at the ME sequence, causing errors in the GGG RNA initiation sequence and incomplete reverse transcription leading to the ME sequence initiating at the RNA end. To address these issues, this invention employs three optimizations: dissociating the ME sequence at 65°C, using ddC to block extension at the 3' end of the ME sequence, and performing reverse transcription and template conversion stepwise. These optimizations increase the proportion of the characteristic GGG sequence at the RNA end and reduce the proportion of the ME sequence appearing at the RNA initiation site.

[0035] S8. Enrichment and Amplification of Chimeric Magnetic Beads The reverse transcription product was enriched, amplified by PCR, purified, and fragments were screened to form a DNA library. The DNA library was then sequenced and subjected to subsequent bioinformatics analysis to obtain the results of RNA-chromatin DNA interactions.

[0036] The methods for enrichment, PCR amplification, purification, and fragment screening in S8 are all conventional techniques in the field, and this invention does not limit them.

[0037] The present invention has the following beneficial effects: (1) Significantly reduce the initial sample size and greatly simplify the experimental process, greatly improving technical feasibility and efficiency.

[0038] This invention uses carboxylated magnetic beads as carriers to immobilize cell nuclei in situ, effectively reducing experimental losses and lowering the cell input by at least two orders of magnitude compared to traditional detection techniques. This opens up a feasible pathway for studying RNA-chromatin interactions in precious clinical samples and rare cell types. Simultaneously, the overall library construction time is shortened to approximately 3 days, significantly simplifying the process. This not only reduces sample loss during library construction but also greatly improves experimental throughput and operational efficiency. Furthermore, the sequence characteristics of the reverse transcription product are highly consistent with theoretical expectations, confirming the high efficiency of the template transformation process and laying a high-quality initial foundation for subsequent data analysis.

[0039] (2) The data comparison accuracy and system repeatability are outstanding, ensuring the robustness and reliability of the analysis conclusions.

[0040] This invention enables the acquisition of longer RNA and DNA capture sequences, significantly improving the unique alignment capability of sequencing reads across the genome, particularly offering a clear advantage in acquiring information from highly repetitive regions, thus providing more comprehensive coverage of valid interaction events. Furthermore, the high consistency between biological replicates demonstrates the method's excellent robustness, meeting the stringent data reproducibility requirements of differential analysis and dynamic change studies.

[0041] (3) To fully reveal the characteristics of genome distribution and the association with regulatory regions, and to expand the depth and breadth of non-coding functional annotation.

[0042] At the DNA level, interaction sites are mainly located in introns and intergenic regions, and are preferentially enriched in regulatory regions with high chromatin accessibility. These sites highly overlap with transcription start sites and open chromatin regions. Therefore, this invention can simultaneously reflect chromatin accessibility and RNA binding sites, providing dual information for studying the RNA participation mechanisms in active regulatory regions. At the RNA level, the captured transcripts are abundant, including protein-coding transcripts and various non-coding RNA types. Transcripts from intergenic regions include RNAs derived from repetitive sequence elements and cis-regulatory elements, providing candidate regulatory elements for subsequent functional studies.

[0043] (4) The system depicts the whole genome RNA-chromatin interaction network and effectively captures rare interaction events, revealing the multifunctional role of RNA in three-dimensional spatial organization.

[0044] This invention can simultaneously detect intrachromosomal cis interactions and transchromosomal trans interactions, demonstrating that RNA is widely involved in spatial structural regulation across the entire genome. Furthermore, this invention can obtain an extremely rich and diverse range of unique interaction pairs, sufficient to cover interaction types that were previously difficult to detect, such as low-abundance transcripts, regulatory element-derived RNAs, and repetitive element-derived RNAs. Through refined annotation, a large number of previously unclassified intergenic transcripts have been successfully mapped to known functional elements, providing a genome-wide data foundation for in-depth exploration of the regulatory mechanisms of specific caRNAs and the construction of a three-dimensional RNA-chromatin interaction network. Attached Figure Description

[0045] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0046] Figure 1 This is a schematic flowchart of the RNA-DNA interaction capture method of the present invention; Figure 2 This is a schematic diagram of the current conventional RNA-DNA interaction capture method; Figure 3 A comparison of relevant information for current conventional RNA-DNA interaction capture methods; Figure 4 The results of CRIS-seq RNA terminology distribution in Example 1; Figure 5 The alignment rates of GRID-seq in Comparative Example 1, iMARGI-seq in Comparative Example 2, and CRIS-seq in Example 1 were compared. Figure 6 For in 10 4 Correlation analysis between the CRIS-seq group of Example 1 and the iMARGI group of Comparative Example 2 under the condition of cell input amount; each CRIS-seq group had two replicates; Figure 7 The data features of the CRIS-seq RNA and DNA ends in Example 1; Figure 8 The distribution characteristics of DNA around the transcription start site (TSS) in CRIS-seq of Example 1; Figure 9 This is an enrichment analysis of DNA fragments in open chromatin regions in CRIS-seq of Example 1; Figure 10 This is the whole-genome RNA-DNA 2D interaction map of Example 1; Figure 11 The whole-genome interaction map of MALAT1 in Example 1; Figure 12 This is a genome-wide, cross-chromosomal RNA-DNA interaction chord diagram from CRIS-seq in Example 1; Figure 13 This is a comparison of the intron / exon ratio of caRNA in RNA interactions at different distance scales in Example 1; Figure 14 The overall distribution characteristics and transcriptional diversity characteristics of intergenic caRNAs in Example 1 and Comparative Example 3; Figure 15 To add or not add RecJ f Comparison of DNA enrichment results by streptavidin magnetic beads under exonuclease conditions, where control1 and control2, experiment1 and experiment2 represent two replicates respectively; Figure 16 The percentages of GGG and ME sequences at the RNA terminus before and after optimization of the reverse transcription reaction are represented by rep1 and rep2, respectively, indicating two repetitions. Detailed Implementation

[0047] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0048] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0049] The formulations of the relevant solutions used in the embodiments of the present invention are as follows:

[0050] The preparation methods of Transposome-CRIS and Transposome-S7 used in the embodiments of the present invention are as follows: (1) Joint assembly The primers were dissolved to 100 µM using primer dissolution buffer. Equal volumes of the forward and reverse primers were annealed to synthesize CRIS adapters and S7 adapters, respectively.

[0051] The annealing procedure is as follows: pre-deformation at 95°C for 2 min; then, decreasing the temperature sequentially to 75°C, 60°C, 50°C, and 40°C at a cooling rate of 5%, holding each temperature for 10 min; finally, decreasing the temperature to 25°C at the same cooling rate and holding for 30 min. The synthesized joint can be used directly for transposable construction, or... Store at 20°C.

[0052] The CRIS adapter's forward and reverse primers are as follows: CRIS connector forward chain: / 5azide / TAA / BiodT / AATAATAATAAAGATGTGTATAAGAGACAG (5' end azide modification, the 4th base T is biotinylated) - SEQ ID No. 1; CRIS connector Reverse chain: CTGTCTCTTATACACAT / ddC / (3' end ddC modification)-SEQ ID No.2.

[0053] The forward and reverse primers for the S7 connector are as follows: S7 Connector Forward Chain: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-SEQ ID No.3; S7 connector Reverse chain: CTGTCTCTTATACACAT / ddC / (3' end ddC modification)-SEQ ID No.4.

[0054] (2) Construction of the transposable body Transposons were formed by combining transposase with annealed synthesized linkers. Specifically, 20 µL of transposase and 5 µL of linker were thoroughly mixed and incubated at 25 °C for 60 min to construct transposons corresponding to the CRIS and S7 linkers, which were named Transposome-CRIS and Transposome-S7, respectively.

[0055] Example 1 This embodiment describes a click chemistry-based RNA-DNA interaction capture method, the process of which is as follows: Figure 1 As shown, the specific operation steps are as follows: 1. Cell fixation 1) Remove the culture medium from the culture dish, wash the cells with 5 mL of 1×PBS and discard the solution.

[0056] 2) Add 7 mL of freshly prepared 1% formaldehyde fixative to the petri dish and gently shake for 10 min at room temperature.

[0057] 3) Add 4.6 mL of 0.5 M glycine to terminate the cross-linking reaction, incubate at room temperature for 10 min, and then incubate on ice for another 10 min.

[0058] 4) Wash the cells twice with 5 mL of pre-cooled 1×PBS. Collect the cells into a 15 mL centrifuge tube using a cell scraper. Take a small amount of the cell suspension for counting. The cell count in a 10 cm culture dish is approximately 1×10⁻⁶ cells. 7 Centrifuge at 2000 g for 5 minutes to precipitate the cells, and carefully aspirate the supernatant.

[0059] 5) Fixed cells can be used directly for subsequent library construction, or rapidly frozen in liquid nitrogen and stored at -80°C.

[0060] 2. Cell lysis 1) Fixing cells from Remove from the freezer at 80°C and thaw slowly on ice; cell infusion volume is 5 × 10⁻⁶. 4 .

[0061] 2) Add 200 µL of NP-40 buffer to the fixed cells to lyse the cell membrane, gently pipette to mix, and place on ice for 30 min.

[0062] 3) Pre-cool the centrifuge to 4°C, centrifuge at 1500 g for 5 min to collect cell nuclei, and discard the supernatant.

[0063] 4) Add 100 µL of 0.3% SDS to permeate the cell nucleus and incubate at 60°C for 5 min.

[0064] 5) After incubation, quickly transfer to ice and place for 3 min; add 100 µL 5% Triton X-100 (Sigma93443) and 2.6 µL RiboLock RNase Inhibitor (Thermo Fisher EO0382) to terminate the SDS effect, gently mix and place on ice for 10 min.

[0065] 6) Add 350 µL of VAHTS DNA Clean Beads (Vazyme N411) and mix well. Incubate at room temperature for 5 min. Place the mixture on a magnetic rack to separate the magnetic beads-cell nuclei for 2 min. Remove the supernatant after the solution becomes clear. Wash the bead-nucleus mixture twice with 80% ethanol and then air dry for 2 min.

[0066] 3. Chromatin fragmentation 1) Wash the bead-nucleus mixture once with 1×tagmentation buffer to reduce the effect of residual ions on Tn5 activity.

[0067] 2) Chromatin fragmentation: Add 10 µL of 5×tagmentation buffer (BGI) and 15 µL of Transposome-CRIS to the bead-nucleus mixture, and add water to a final volume of 50 µL. Incubate at 55°C for 4 hours, then reduce the temperature to 30°C and incubate overnight.

[0068] 3) Add 12.5 µL of 5×NT buffer (BGI), let stand at room temperature for 10 min to terminate the transposon reaction.

[0069] 4) Pre-cool the centrifuge to 4°C, centrifuge at 1500 g for 2 min, and discard the supernatant.

[0070] 5) Resuspend the bead-nucleus mixture precipitate in 200 µL of enzyme-free water, add 165 µL of 20% PEG8000 / 2.5M NaCl to remove unbound transposon complexes, small fragments of free nucleic acids and other soluble reaction components; mix thoroughly and incubate at room temperature for 5 min, then place on a magnetic rack to separate the bead-nucleus mixture; remove the supernatant after the solution becomes clear; wash the bead-nucleus mixture with 80% ethanol, and then remove any ethanol residue.

[0071] 6) Repeat the cleaning steps from the previous step once.

[0072] 4. RNA fragmentation and modification 1) Resuspend the bead-nucleus mixture in 300 µL of 1×rCutSmart Buffer (NEB B6004), and add 1 µL of RNase I diluted 10-fold. f RNA fragmentation was performed using (NEB M0243S), and the cells were incubated at 37°C for 3 minutes.

[0073] 2) After incubation, quickly transfer to ice for at least 5 minutes, and add 1 µL of 10% SDS to terminate the fragmentation reaction.

[0074] 3) Centrifuge the bead-nucleus mixture at 1500 g for 2 min and discard the supernatant.

[0075] 4) The bead-nucleus mixture precipitate was resuspended in 200 µL of enzyme-free water, and 165 µL of 20% PEG8000 / 2.5M NaCl was added to remove free RNA. The mixture was thoroughly mixed and incubated at room temperature for 5 min. The bead-nucleus mixture was separated by a magnetic rack. After the solution was clarified, the supernatant was removed. The bead-nucleus mixture was washed once with 80% ethanol to remove ethanol residue.

[0076] 5) Repeat the cleaning steps from the previous step once.

[0077] 6) RNA 3′ dephosphorylation. Resuspend the bead-nucleus mixture in the dephosphorylation system: 20 µL 10× pH 6.5 PNK phosphatase buffer (NEB B0201S), 10 µL T4 PNK (NEB M0201L), and 2 µL RiboLockRNase Inhibitor, and add water to a final volume of 200 µL; incubate at 37°C for 30 min, and add 1 µL 10% SDS to terminate the reaction.

[0078] 7) Centrifuge the bead-nucleus mixture at 1500 g for 2 min and discard the supernatant.

[0079] 8) The bead-nucleus mixture precipitate was resuspended in 200 µL of enzyme-free water, and 165 µL of 20% PEG8000 / 2.5M NaCl was added to remove soluble free nucleotides. After thorough mixing and incubation at room temperature for 5 min, the mixture was placed on a magnetic rack for separation. The beads were washed once with 80% ethanol to remove any ethanol residue.

[0080] 9) Repeat the cleaning steps from the previous step once.

[0081] 10) Introduction of alkyne modification at the 3′ end of RNA: The bead-nucleus mixture was resuspended in a Poly(A) polymerase mixture: 10 µL 5× Poly(A) Polymerase Reaction Buffer (Thermo Fisher PN 74226), 2 µL 25 mM 3-(O-propynyl)-ATP (Jena Bioscience NU-945), and 4 µL yeast Poly(A) polymerase (Thermo Fisher 74225Z25KU), with water added to a final volume of 50 µL. Incubate at 37°C for 60 min; stop the reaction by adding 0.5 µL 0.5 M EDTA.

[0082] 11) Centrifuge the bead-nucleus mixture at 1500 g for 2 min and discard the supernatant.

[0083] 12) The bead-nucleus mixture precipitate was resuspended in 200 µL of enzyme-free water, and 165 µL of 20% PEG8000 / 2.5M NaCl was added to remove residual free 3-(O-propynyl)-ATP. After thorough mixing and incubation at room temperature for 5 min, the mixture was separated on a magnetic rack; it was then washed once with 80% ethanol to remove any ethanol residue.

[0084] 13) Repeat the above washing steps twice to avoid free 3-(O-propynyl)-ATP affecting the subsequent CuAAC reaction.

[0085] 5. Chimeric ligation and purification 1) The bead-nucleus mixture was washed once with 50 mM HEPES, incubated at room temperature for 5 min, and then separated on a magnetic rack. After the solution became clear, the supernatant was removed to reduce the influence of residual ions on the CuAAC reaction.

[0086] 2) CuAAC reaction for RNA-DNA chimera ligation. The bead-nucleus mixture was resuspended in the CuAAC reaction system: 28.2 µL 50 mM HEPES, 37.8 µL 100% DMSO, and 9.6 µL CuAAC mixture (premixed with 8 µL Copper(II)-TBTA and 1.6 µL 50 mM sodium ascorbate). After thorough mixing, the mixture was incubated at 37 °C for 60 min.

[0087] 3) Centrifuge the bead-nucleus mixture at 1500 g for 2 min and discard the supernatant.

[0088] 4) The bead-nucleus mixture precipitate was resuspended in 200 µL of enzyme-free water, and 165 µL of 20% PEG8000 / 2.5M NaCl was added to remove residual free nucleotides and other soluble reaction components from the solution. After thorough mixing and incubation at room temperature for 5 min, the bead-nucleus mixture was separated on a magnetic rack. The mixture was washed once with 80% ethanol to remove any ethanol residue.

[0089] 5) Decrosslinking of the chimera. The bead-nucleus mixture was resuspended in the decrosslinking system: 10 µL 1M Tris-HCl (pH 7.0), 20 µL 10% SDS, 0.4 µL 0.5 M EDTA (pH 8.0), 4 µL 5 M NaCl, 10 µL Proteinase K (NEBP8107S), and water was added to a final volume of 200 µL. After thorough mixing, the mixture was incubated at 58°C for 4 hours.

[0090] 6) Purify RNA-DNA chimeras.

[0091] Take 150 µL of Dynabeads Myone Silane beads (Invitrogen 37002D) into a new centrifuge tube and separate the beads using a magnetic rack. After the solution becomes clear, remove the storage solution and wash the beads once with 500 µL Buffer RLT (QIAGEN 79216).

[0092] Resuspend the Silane beads in 700 µL Buffer RLT, mix thoroughly, and add to the previous decrosslinking reaction. Add 900 µL isopropanol, invert the centrifuge tube, mix thoroughly, and incubate at room temperature for 15 min.

[0093] Separate the magnetic beads using a magnetic rack, and remove the supernatant after the solution has clarified. Wash the magnetic beads twice with 80% ethanol, and then air dry them thoroughly to avoid residual ethanol affecting downstream reactions.

[0094] Add 80 µL of enzyme-free water to the magnetic beads, mix thoroughly, and incubate at room temperature for 10 min to elute the chimera.

[0095] 6. DNA end-fitter ligation 1) Removal of chromatin DNA that has not been ligated to RNA via the CuAAC reaction: Add 10 µL of 10× NEBuffer 2 and 10 µL of RecJ to the 80 µL chimera from the previous step. f (NEB M0264L), incubate at 37°C for 60 min.

[0096] 2) The chimera was purified using an RNA column purification kit and eluted with 36 µL of enzyme-free water.

[0097] 3) Introduce S7 adapters to the chimeric DNA ends using Transposome-S7: Add 10 µL of 5×tagmentation buffer and 4 µL of Transposome-S7 to the 36 µL chimera from the previous step, for a final volume of 50 µL. Incubate at 55°C for 10 min.

[0098] 4) Add 12.5 µL of 5×NT buffer to the reaction system, mix thoroughly, and let stand at room temperature for 10 min to terminate the transposon reaction.

[0099] 5) Purify the chimera using an RNA column purification kit and elute with 12.8 µL of enzyme-free water.

[0100] 7. RNA reverse transcription 1) Add 8 µL of 5× RT buffer (Thermo Fisher B91) and 2 µL of 10 mM dNTP to 12.8 µL of chimera. Incubate at 65 °C for 5 min and then quickly transfer to ice.

[0101] 2) Add 1 µL RiboLock RNase Inhibitor, 3 µL Maxima H Minus (Thermo Fisher EP0752), and 12.8 µL 50% PEG8000 to the above system. Incubate at 50°C for 60 min.

[0102] 3) Add 0.4 µL of 100 µM TSO to the above system and incubate at 50 °C for 60 min.

[0103] The nucleotide sequence of TSO is as follows: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGrGrG+G (rG is riboguanosine, +G is LNA-modified guanosine) - SEQ ID No. 5.

[0104] 4) Purify the chimera using an RNA column purification kit, and elute with 50 µL of enzyme-free water.

[0105] 8. Bead-based enrichment and amplification of chimeras 1) Take 60 µL of C1 Streptavidin Magnetic Beads (Invitrogen 65001), wash 3 times with 1× Binding / Wash Buffer, and resuspend in 50 µL of 2× Binding / Wash Buffer. Add to the chimera purified in the previous step, and incubate at room temperature for 60 min.

[0106] 2) Wash multiple times with salt ion buffer to remove non-specific binding.

[0107] Wash the C1 Streptavidin Magnetic Beads 6 times with high-salt buffer and 2 times with low-salt buffer, and separate the magnetic beads with a magnetic stand during the process.

[0108] 3) PCR amplification.

[0109] After washing the bead-nucleus mixture, add 25 µL of KAPA HiFi HotStart ReadyMix (KAPABiosystems KK2601), 2.5 µL of Index primer i5 (TRANS KI101-02), 2.5 µL of Index primer i7, and supplement with water to a final volume of 50 µL. The PCR program is: pre-denaturation at 98°C for 3 min; 18 cycles of denaturation at 98°C for 30 sec, annealing at 62°C for 30 sec, extension at 72°C for 60 sec; extension at 72°C for 3 min; and holding at 4°C.

[0110] 4) Product purification and fragment selection.

[0111] Add 35 µL of VAHTS DNA Clean Beads to the PCR product, mix thoroughly, and place at room temperature for 10 min. Separate the magnetic beads using a magnetic stand, and remove the supernatant after the solution becomes clear; wash the magnetic beads twice with 80% ethanol and air-dry. Add 20 µL of enzyme-free water to resuspend the magnetic beads, mix well, and place at room temperature for 10 min to elute the PCR product, and determine the library concentration using the Qubit fluorometric quantitation kit.

[0112] 5) On-machine sequencing.

[0113] Perform PE150 sequencing using the Illumina NovaSeq X Plus platform.

[0114] Comparative Example 1 The cell samples from Example 1 were analyzed using traditional GRID-seq technology, with a cell input volume of 5 × 10⁻⁶. 6 .

[0115] Comparative Example 2 The cell samples from Example 1 were analyzed using traditional iMARGI-seq technology, with a cell input volume of 5 × 10⁻⁶. 6 .

[0116] The flowchart of the detection technology in Comparative Examples 1-2 is shown below. Figure 2 As shown, the corresponding relevant information is as follows: Figure 3 As shown.

[0117] Comparative Example 3 The cell samples from Example 1 were analyzed using traditional RNA-seq technology (referenced from the public database GSE180581).

[0118] Experimental Example 1 The detection results of Example 1 are compared with those of Comparative Examples 1-3, as follows: (1) such as Figure 4 As shown: The data quality control results of Example 1 show that the RNA ends start with GGG as expected, which proves the high template conversion rate in the reverse transcription reaction and suggests that the CRIS-seq technology in Example 1 has a very high effective data ratio.

[0119] (2) For example Figure 5 As shown, the CRIS-seq in Example 1 can capture RNA and DNA sequences up to 150 bp in length, with a unique mapping rate of 70%-80%, significantly higher than the approximately 14% of GRID-seq in Comparative Example 1. The longer capture sequences allow CRIS-seq to more efficiently capture effective RNA-chromatin interaction information, including repetitive sequences widely distributed throughout the genome. This result demonstrates that Example 1 significantly improves data alignment quality compared to traditional detection methods.

[0120] (3) such as Figure 6 As shown, the consistency coefficient between CRIS-seq biological replicates in Example 1 is as high as 0.88, indicating high reproducibility compared to existing technologies due to the stability of the CuAAC chemical linking strategy. However, due to inherent differences in library construction strategies and data structures, the consistency between the CRIS-seq data of Example 1 and the iMARGI data of Comparative Example 2 is 0.62.

[0121] (4) Perform genomic distribution analysis on CRIS-seq DNA data, such as... Figure 7As shown, DNA mainly originates from intronic regions and intergenic regions. Annotation of RNA ends revealed that the captured RNA primarily consists of protein-coding genes and intergenic regions, indicating that the RNA originates from various types of RNA, including protein-coding RNA, long non-coding RNA, and repetitive sequences derived from intergenic regions.

[0122] The above distribution characteristics indicate that Example 1 successfully avoids the inability of traditional methods to cover low-abundance caRNA-chromatin interaction events due to low reverse transcription efficiency or connection bias. The high proportion of introns / intergenic regions in this dataset confirms that the interaction events captured by this protocol cover potential regulatory non-coding RNAs and repetitive sequence RNA-chromatin interactions, which is one of the core features that makes this technology superior to existing commercial kits.

[0123] (5) Figure 8 and Figure 9 The results indicate that the CRIS-seq method in Example 1 can simultaneously detect chromatin openness and RNA-chromatin interactions. Since the CRIS-seq method in Example 1 utilizes the Tn5 transposase to fragment DNA, and Tn5 primarily inserts into exposed DNA regions, the DNA captured by CRIS-seq is naturally enriched in open chromatin regions. The DNA captured by CRIS-seq exhibits highly specific enrichment at transcription start sites (TSS) and ATAC-seq peak regions, providing a unique perspective for elucidating the RNA regulatory network in active regulatory regions.

[0124] (6) Use CRIS-seq to draw a global RNA-chromatin interaction map, such as Figure 10 As shown, extensive cis-interactions exist within chromosomes. Furthermore, certain specific RNAs engage in extensive interchromosomal interactions, such as classic non-coding RNAs like RN7SK and RN7SL, global housekeeping non-coding RNAs responsible for signal recognition and related to transcription elongation regulation, which possess extensive chromatin interaction capabilities within the nucleus. CRIS-seq captured extensive RNA-chromatin interaction signals within the nucleus targeting the nuclear backbone lncRNA MALAT1. Previous studies have shown that the highly abundant MALAT1 binds to thousands of gene loci in active transcription across the entire genome. This study further utilized Circos plots (… Figure 11 The interactions of a single MALAT1 cell across the entire genome were visualized, demonstrating its extensive genome-wide interactions through cis and trans actions.

[0125] To further reveal the RNA-mediated interchromosomal interaction map at the whole-genome level, this experiment also extracted all interchromosomal interaction data and visualized the interchromosomal contact matrix through chord diagrams across the entire genome. The results are as follows: Figure 12As shown, there are extensive interchromosomal interactions across the entire genome.

[0126] (7) Comparison of the intron / exon ratio of caRNA in RNA-DNA interaction at different distance scales is shown in the figure. Figure 13 As shown, these results reveal the correlation between the dynamic process of RNA maturation and interaction distance. With increasing interaction distance, the overall intron / exon ratio of distant interactions and interchromosomal RNA-chromatin interactions shows a significant decreasing trend, falling below that of TT-seq. This means that the farther the genomic target sequence is from the RNA transcription site, the less contribution from intron-derived RNA gradually decreases, while the relative proportion of exon-derived RNA continuously increases. Since TT-seq primarily enriches newly formed transcripts, the decrease in the intron / exon ratio in distant interactions indicates a gradual shift from local interactions dominated by newly formed transcripts to distant chromatin interactions dominated by mature RNA. This result suggests that not all chromatin-associated RNAs are newly formed transcripts, and the maturity state of RNA is a crucial factor influencing the range of its chromatin interactions. Intron RNAs, primarily representing newly formed transcripts, interact mainly within proximal transcriptional events and tend to be rapidly degraded posttranscribedly. Exon RNAs, on the other hand, are retained in mature transcripts, exhibiting greater stability and longer residence time in the nucleus, and establishing long-distance chromatin interactions with genomic loci during the nuclear exit of mature RNA. This discovery reveals a close link between RNA processing and maturation and RNA-DNA spatial interaction patterns, providing a new perspective for understanding the function of RNA in the three-dimensional organization of the genome.

[0127] (8) The results of the comparison between the overall distribution characteristics of intergenic caRNA in Example 1 and Comparative Example 3, and the results of the transcriptional diversity characteristics in Example 1 are as follows: Figure 14 As shown, CRIS-seq can detect a variety of low-abundance non-coding RNAs, active regulatory element-related caRNAs, and repeat element caRNAs. Refined functional element annotation was performed on unannotated transcripts labeled as intergenic regions. Approximately 37.5% of the intergenic region RNAs were classified as repeat sequence-derived RNAs, and approximately 31.3% were labeled as cis-regulatory element-derived RNAs. Notably, intergenic region RNAs labeled as CREs covered more than half of the CREs annotated by ENCODE; intergenic region RNAs labeled as Repeat sequences accounted for approximately one-third of the total. This result indicates that Example 1 can effectively detect interactions originating from repeat sequences and low-abundance CREs.

[0128] Experimental Example 2 To compare whether RecJ was added during the DNA end-fitting step. f The effect of exonuclease on detection results was investigated in this experiment, which did not involve RecJ.f The control group treated with exonuclease (other conditions were the same as in Example 1) was compared with Example 1.

[0129] The results are as follows Figure 15 As shown, the streptavidin magnetic beads in the control group were enriched with more than 80% DNA, while those processed by RecJ... f In the exonuclease-treated experimental group (Example 1), streptavidin magnetic beads only enriched about 10% of the DNA. Therefore, RecJ f Exonucleases can effectively recognize single-stranded DNA ends with an azide group at 5′ and perform nucleotide excision from 5′ to 3′. This invention validates RecJ... f The effectiveness of exonucleases on single-stranded DNA modified with a 5' azido group. Using RecJ... f By removing the biotin-modified bases at the 5' overhang of the free DNA single strand along the 5' to 3' direction, the free DNA cannot be captured by streptavidin magnetic beads, effectively removing background DNA noise.

[0130] Experimental Example 3 The use of Tn5 enzyme causes a reverse transcription conflict due to the 9bp gap at the RNA-DNA junction and the ME sequence. This conflict leads to reaction conflicts during reverse transcriptase elongation and TSO incorporation. Although RNA successfully ligates to DNA via CuAAC, the reverse transcriptase may not extend to the RNA and may stop at the ME sequence, resulting in errors in the RNA initiation sequence (GGG) and incomplete RNA reverse transcription. To address this technical problem, this experiment specifically optimized the dissociation temperature in the RNA reverse transcription step, introduced ddC modification at the 3' end of the ME sequence to block nucleic acid chain elongation, and implemented a stepwise approach for reverse transcription and template conversion, thus obtaining the detection method of Example 1.

[0131] Before optimization, the 3' end of the ME sequence was not modified with ddC in the RNA reverse transcription step, and reverse transcription and template conversion were carried out simultaneously without a dissociation step.

[0132] Compare the detection results before and after optimization, such as Figure 16 As shown, after optimization, the proportion of the characteristic sequence GGG at the RNA end of CRIS-seq increased from about 75% to about 95%, and the proportion of ME sequences appearing at the RNA end start position in the data containing ME sequences was significantly reduced.

[0133] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A click chemistry-based RNA-DNA interaction capture method, characterized in that, Includes the following steps: 1) The fixed cells were subjected to cell membrane lysis and permeabilization treatment, and carboxylated magnetic beads were added to obtain a magnetic bead-cell nucleus mixture; 2) The magnetic bead-nucleus mixture was subjected to chromatin fragmentation and chemical modification using a transposome-CRIS formed by the combination of a transposase and a 5' azide-modified linker; 3) Add ribonuclease to fragment the RNA, and dephosphorylate and modify the 3' end of the RNA; 4) The product obtained in step 3) is subjected to CuAAC reaction to perform chimera ligation; then, after decrosslinking and purification, RNA-DNA chimera is obtained; 5) Introduce an S7 adapter into the DNA end of the RNA-DNA chimera using Transposome-S7; 6) Add RNA-DNA chimeras with S7 adapters at their DNA ends to a reverse transcription system containing template-converting oligonucleotides to perform reverse transcription of RNA; 7) The product obtained in step 6) is enriched, amplified by PCR, purified and screened for fragments to form a DNA library; the DNA library is sequenced and subjected to subsequent bioinformatics analysis to obtain the results of RNA-chromatin DNA interaction.

2. The RNA-DNA interaction capture method according to claim 1, characterized in that, The Transposome-CRIS is formed by combining Tn5 enzyme with an annealed CRIS adapter; the 5' end of the forward strand of the CRIS adapter is azid-modified, and the 4th base T is biotin-labeled, and its nucleotide sequence is shown in SEQ ID No. 1; the 3' end of the reverse strand of the CRIS adapter is ddC-modified, and its nucleotide sequence is shown in SEQ ID No.

2.

3. The RNA-DNA interaction capture method according to claim 1, characterized in that, The alkyne modification includes adding the product after dephosphorylation of the 3' end of RNA to a reaction system containing yeast Poly(A) polymerase; Preferably, the reaction system contains: 10 µL 5×Poly(A) Polymerase Reaction Buffer, 2 µL 25 mM 3-(O-propynyl)-ATP and 4 µL yeast Poly(A) polymerase, with water added to a final volume of 50 µL.

4. The RNA-DNA interaction capture method according to claim 1, characterized in that, The CuAAC reaction system contains: 28.2 µL 50 mM HEPES, 37.8 µL 100 (V / V)% DMSO, and 9.6 µL CuAAC mixture; the CuAAC mixture is a pre-mixed solution of 8 µL Copper(II)-TBTA and 1.6 µL 50 mM sodium ascorbate.

5. The RNA-DNA interaction capture method according to claim 1, characterized in that, The RNA-DNA interaction capture method further includes: removing chromatin DNA that has not been linked to RNA via the CuAAC reaction before performing S7 adapter ligation in step 5); Preferably, RecJ is added to the product obtained in step 4). f Nucleotide exonuclease.

6. The RNA-DNA interaction capture method according to claim 1, characterized in that, The transposome-S7 is formed by combining Tn5 enzyme with an S7 linker synthesized by annealing; the nucleotide sequence of the forward strand of the S7 linker is shown in SEQ ID No. 3; the 3' end of the reverse strand of the S7 linker is modified with ddC, and its nucleotide sequence is shown in SEQ ID No.

4.

7. The RNA-DNA interaction capture method according to claim 1, characterized in that, The reverse transcription includes: Add RT buffer and dNTP to the chimeric product obtained in step 5), incubate at 65°C for 5 min, and then quickly transfer to ice; then add RiboLock RNase Inhibitor, Maxima H Minus, and PEG8000, and incubate at 50°C for 60 min; then add template conversion oligonucleotides and incubate at 50°C for 60 min. The sequence of the template-converted oligonucleotide is shown in SEQ ID No.

5.

8. The RNA-DNA interaction capture method according to claim 7, characterized in that, The reverse transcription system consisted of: 12.8 µL of the chimera obtained in step 5), 8 µL of 5×RT buffer, 2 µL of 10 mM dNTP, 1 µL of RiboLock RNase Inhibitor, 3 µL of Maxima H Minus, 12.8 µL of 50 (W / V)% PEG8000, and 0.4 µL of 100 µM template-converting oligonucleotides.

9. The RNA-DNA interaction capture method according to any one of claims 1 to 8, characterized in that, The RNA-DNA interaction capture method requires a cell input as low as 10. 5 .

10. The RNA-DNA interaction capture method according to claim 9, characterized in that, Step 7) The chromatin-associated RNAs obtained include protein-coding RNAs, long non-coding RNAs, and potential regulatory elements and repetitive sequence transcripts in intergenic regions.

Images