A method and kit for assessing abnormal splicing of RNA caused by mutations in genes associated with deafness

Abstract

The application discloses a method and a kit for evaluating abnormal RNA splicing caused by deafness-related gene mutation, and belongs to the technical field of molecular biology and genetics diagnosis. The method comprises the following steps: firstly, predicting abnormal splicing modes possibly caused by specific gene mutation through a bioinformatics tool; then, based on the prediction result, designing PCR primers so that the primers can effectively distinguish abnormal and normal splicing products; finally, verifying through RT-PCR and product sequencing. The method overcomes blindness in traditional primer design, and significantly improves the detection efficiency and accuracy of complex and subtle splicing abnormalities. The application further provides products and applications for verifying OTOF gene c.3409-11A>G mutation.

Description

Technical Field

[0001] This invention relates to the field of molecular biology and genetic diagnostic technology, specifically to a method and kit for assessing abnormal RNA splicing caused by mutations in deafness-related genes. Background Technology

[0002] RNA splicing is a crucial step in gene expression in eukaryotes, referring to the removal of introns (non-coding sequences) from primary RNA transcripts (such as hnRNA) produced by DNA transcription and the joining of exons (coding sequences) to form mature RNA. This process is catalyzed by the spliceosome (a complex composed of micronuclear RNA and proteins), achieving intron removal and exon splicing through two transesterification reactions. RNA splicing not only ensures the correct transmission of encoded information from RNA but also enables a single gene to produce multiple protein products through alternative splicing mechanisms, playing a vital role in biological development, functional regulation, and evolution.

[0003] RNA splicing abnormalities can lead to organ dysfunction and various diseases, and are one of the important causes of human genetic diseases. Mutations in exons and non-coding sequences can cause splicing abnormalities. The reason why mutation sites affect splicing may be the activation of hidden splice recognition sites, the formation of new splice sites, or the mutation site being located in the splicing regulatory sequence, affecting the binding of target proteins and indirectly affecting splicing. Generally, RNA splicing abnormalities caused by mutations mostly lead to exon skipping, partial exon deletion, deep intron fragment retention, and intron fragment retention near the boundary. It is estimated that pathogenic splicing abnormalities account for 10-50% of all pathogenic mutations, and pathogenic mutations located in exons or introns (more than 100 bp away from the intron / exon boundary) account for about 25%.

[0004] Defining the specific impact of splice region mutation sites on RNA splicing is crucial for assessing the pathogenicity of variants, aiding in further clinical diagnosis, helping clinicians develop clinical treatment strategies, and providing a basis for assisted reproduction. Commonly used experimental techniques include direct analysis of RNA and / or cDNA derivatives, and in vitro minigene techniques. Using biopsy tissues from patients or animal models directly is more convincing, but the appropriate sample type should be selected based on gene expression patterns, available sample types, and literature reports. While in vitro minigene methods can verify splicing abnormalities, they have significant limitations—the minigene system cannot fully simulate the complex in vivo splicing regulatory environment (such as chromatin structure and tissue-specific expression of splicing factors), potentially leading to false positive or false negative results.

[0005] Pathogenic mutations in deafness-related genes (such as OTOF, CD14A, DCDC2, ELMOD3, and ESPN) primarily manifest as hearing loss. While these genes are highly expressed in cochlear tissue, database searches and experimental verification in this invention have shown that transcripts also exist in peripheral blood. However, the abundance of these transcripts in peripheral blood is significantly lower than in cochlear tissue, classifying them as low-abundance transcripts. This places higher demands on the sensitivity of experimental methods. Theoretically, RNA could be extracted from peripheral blood samples, reverse transcribed into cDNA, and specific primers could be designed to amplify multiple exons / introns adjacent to the mutation site. Electrophoresis and sequencing could then be used to confirm the impact of the mutation on RNA splicing (e.g., exon deletion, intron retention). However, due to the low abundance of these genes in peripheral blood, conventional PCR methods are insufficient for effectively amplifying the target fragments, and existing primer design strategies have not been systematically optimized for these genes.

[0006] Currently, existing literature reports methods for splicing analysis of genes with low expression in blood. One study reported a short amplicon RT-PCR method for detecting aberrant splicing of genes with low expression in blood (transcriptum abundance TPM < 1). This method successfully detected splicing abnormalities in genes such as SYN1, TCF4, NTRK2, TTN, and TERT by designing primers to span the exon containing the mutation and one exon upstream and downstream. However, for deafness-related genes such as OTOF, CD14A, and DCCDC2, which are traditionally believed to be mainly expressed in the cochlea and whose presence of detectable transcripts in blood is unclear, the applicability of this method and how primers should be designed to cover multiple possible splicing abnormality patterns remain unproven by current technology.

[0007] More importantly, both direct analysis and Minigene methods face a critical and often overlooked problem in the early stages of the experiment: how to design PCR amplification primers to optimally capture potential, especially atypical, splicing abnormalities. Conventional primer designs for validation experiments are usually conservative, only spanning the nearest exons on either side of the mutation site. This design may be effective for classic splicing site disruptions that cause entire exon skipping or intron retention. However, when the mutation is located in a deep intron region and may activate hidden splicing sites (such as hidden acceptors or donors), conventional primer designs may face two major risks: (1) the length of the abnormal splice product is too close to that of the normal product, making it impossible to effectively distinguish them by conventional electrophoresis, leading to misjudgment or missed detection; (2) the primer binding site may be partially cleaved or affected by the abnormal splicing event, resulting in low amplification efficiency or even failure. This "blindness" in design reduces the first-time success rate and reliability of functional validation experiments.

[0008] In summary, existing technologies still lack a systematic solution to the aforementioned problems. Specifically, for deafness-related genes traditionally considered not to be expressed (or expressed at extremely low levels) in blood, how to effectively amplify target regions from low-abundance transcripts in peripheral blood and accurately assess their splicing status, and how to flexibly adjust primer design strategies based on expected splicing changes to ensure the distinguishability between normal and abnormal products, are all pressing technical challenges in this field. Therefore, there is an urgent need to develop an RNA aberration splicing assessment method and corresponding kit capable of achieving the above objectives. Summary of the Invention

[0009] To address the shortcomings of existing technologies, this invention provides a method and kit for evaluating RNA aberrations caused by mutations in deafness-related genes, solving the technical problems of blind primer design and low efficiency in capturing complex splicing aberrations in existing RNA splicing verification experiments.

[0010] To achieve the above objectives, the present invention provides the following technical solution: The first aspect of this invention provides a method for assessing abnormal RNA splicing caused by mutations in deafness-related genes, the method comprising: RNA was extracted from peripheral blood samples of the subjects and reverse transcribed into cDNA; The cDNA was amplified by PCR using at least one pair of specific amplification primers. The amplification products are analyzed by nucleic acid electrophoresis. The position and / or number of bands are used to determine whether RNA splicing is normal. Abnormal bands are sequenced to confirm the specific pattern of splicing abnormality. The aforementioned deafness-related gene mutations are characterized by hearing loss as the main clinical manifestation.

[0011] Furthermore, the deafness-related genes include at least one selected from OTOF, CD14A, DCDC2, ELMOD3, ESPN, GAB1, GIPC3, GPSM2, HGF, KARS1, LOXHD1, MARVELD2, MSRB3, PDZD7, PJVK, PNPT1, RDX, SERPINB6, SYNE, TMPRSS3, TPRN, WHRN, PPIP5K2, EPS8, DIAPH1, GSDME, and WFS1.

[0012] Furthermore, the deafness-related gene is the OTOF gene, and the mutation of the deafness-related gene is the OTOF gene c.3409-11A>G mutation.

[0013] In some implementations, the primers refer to 7-50 nucleic acid sequences capable of forming base pairs complementary to the template strand and serving as a starting point for template strand replication. Primers are typically synthesized, but naturally occurring nucleic acids can also be used. The primer sequence does not necessarily need to be identical to the template sequence, as long as it is sufficiently complementary to hybridize with the template.

[0014] Furthermore, the primers include an upstream primer OTOF-F1 and a downstream primer OTOF-R1. OTOF-F1 is located at the junction of exon 26 and exon 27 upstream of the c.3409-11A>G mutation site, and OTOF-R1 is located at exon 30 downstream of the c.3409-11A>G mutation site.

[0015] Furthermore, the sequence of OTOF-F1 is SEQ ID NO.2, and the sequence of OTOF-R1 is SEQ ID NO.3.

[0016] In some embodiments, the primers used are not limited to the specific sequences described in this invention, but include those sequences that have at least 75%, preferably at least 80%, more preferably at least 85%, more preferably at least 90%, and even more preferably at least 95% identity with the primers and still retain their function. Those skilled in the art can determine sequence identity through conventional procedures.

[0017] Furthermore, the PCR amplification is a single-round PCR.

[0018] Furthermore, the PCR amplification is nested PCR.

[0019] Furthermore, when the deafness-related gene is a low-abundance transcript in peripheral blood, the PCR amplification is nested PCR, including a first round of amplification using outer primers and a second round of amplification using inner primers.

[0020] Furthermore, the primers are trans-exon primers, and the binding sites of the upstream and / or downstream primers span the junctions of adjacent exons.

[0021] Furthermore, the binding site of at least one primer is selected such that, in the event of splicing anomalies, there is an electrophoretically resolvable length difference between the amplified and normal amplified products.

[0022] Furthermore, the nucleic acid electrophoresis includes agarose gel electrophoresis, polyacrylamide gel electrophoresis, and pulsed field gel electrophoresis, and the gene sequencing includes Sanger sequencing, NGS sequencing, and long read sequencing.

[0023] Furthermore, the verification of abnormal RNA splicing and its specific patterns is achieved by agarose gel electrophoresis and / or Sanger sequencing.

[0024] In some implementations, the sample includes samples obtained from cell, tissue, or body fluid collections of any subject origin. Specifically, the sample includes, but is not limited to: tissue or cell samples that may be derived from solid tissue of a fresh, frozen, and / or preserved organ or tissue sample, or from a biopsy or aspirate; blood or any blood component; body fluids such as cerebrospinal fluid, amniotic fluid, peritoneal fluid, or interstitial fluid. Tissue samples may be primary or in vitro cultured cells or cell lines. Optionally, tissue or cell samples may be obtained from diseased tissue / organ. Tissue samples may contain compounds naturally mixed with the tissue, such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or similar compounds.

[0025] Furthermore, the samples include tissues, body fluids, cells, and exosomes.

[0026] Furthermore, the sample is blood.

[0027] In this invention, the subjects include humans and non-human animals. Non-human animals include all vertebrates (e.g., mammals and non-mammals), such as non-human primates (e.g., cynomolgus monkeys), sheep, dogs, cattle, chickens, amphibians, and reptiles.

[0028] A second aspect of the present invention provides a kit for assessing abnormal RNA splicing caused by mutations in deafness-related genes. The kit includes at least one pair of specific amplification primers for amplifying the deafness-related genes described in the first aspect of the present invention, and at least one selected from RNA extraction reagents, reverse transcription reagents, PCR amplification reagents, and nucleic acid electrophoresis reagents.

[0029] Furthermore, the deafness-related gene is the OTOF gene, and the primers include primer pairs for amplifying the region of exons 26 to 30 of the OTOF gene.

[0030] Furthermore, the primer pair includes an upstream primer OTOF-F1 (SEQ ID NO.2) and a downstream primer OTOF-R1 (SEQ ID NO.3).

[0031] In some embodiments, the kit may further include a label, a positive control, a negative control, a buffer, an adjuvant, or a solvent, and one or more containers for containing the compositions contained in the kit. The compositions may be in liquid form or lyophilized. Suitable containers for the compositions include, for example, bottles, vials, syringes, and test tubes. Containers may be formed from a variety of materials, including glass or plastic. The instructions or label detail how to use the kit to test samples and how the kit is used to verify RNA aberrations caused by the OTOF gene c.3409-11A>G mutation.

[0032] A third aspect of the present invention provides a system for assessing abnormal RNA splicing caused by mutations in deafness-related genes, the system comprising: Sample processing module: used to extract RNA from the peripheral blood of the subject and reverse transcribe it into cDNA; Amplification module: used for PCR amplification of the cDNA using at least one pair of specific amplification primers; Analysis module: Used to analyze amplification products by nucleic acid electrophoresis and determine whether RNA splicing is normal based on band position and / or band number, as well as to sequence abnormal bands to confirm the specific pattern of splicing abnormality.

[0033] In some embodiments, the above-described modules or steps can be implemented using a computing device. In some embodiments, the modules or steps can be centralized on a single computing device. In some embodiments, the modules or steps can be distributed across multiple computing devices linked by a network or other means. In some embodiments, the computing device stores program code for executing the above-described modules or steps in a storage device. In some embodiments, the modules or steps can be fabricated as integrated circuits individually or combined into a single integrated circuit. No particular implementation method, whether hardware or software, is limited in the specific embodiments of this invention.

[0034] The fourth aspect of the present invention provides for any of the following applications: 1) The application of the method described in the first aspect of the present invention, the kit described in the second aspect of the present invention, or the system described in the third aspect of the present invention in evaluating abnormal RNA splicing caused by mutations in deafness-related genes.

[0035] 2) The application of the method described in the first aspect of the present invention, the kit described in the second aspect of the present invention, or the system described in the third aspect of the present invention in the preparation of products for diagnosing diseases caused by abnormalities in deafness-related genes.

[0036] Furthermore, the diseases caused by the aforementioned deafness-related gene abnormalities include recessive or dominant hereditary deafness.

[0037] Compared with the prior art, the present invention has the following advantages: 1. Improve the targeting and success rate of validation: By using the specific results of bioinformatics predictions (such as abnormal patterns and retained fragment lengths) as key inputs to guide the design of PCR primers, the experimental protocol can be directly optimized for the "predicted abnormalities", avoiding blind experiments and significantly improving the success rate of the first validation.

[0038] 2. Enhanced detection capability for subtle splicing abnormalities: By strategically designing primers to be placed further downstream in the exons, the length difference between normal and abnormal products can be artificially increased, so that even subtle splicing changes with only a few to dozens of base differences can be clearly distinguished in agarose gel electrophoresis, reducing the risk of false negatives caused by similar product lengths.

[0039] 3. Achieving closed-loop verification of prediction and experiment: This method establishes a complete process from prediction to design, then to verification, and finally to comparison. The final experimental results can not only confirm whether the mutation affects splicing, but also directly verify the accuracy of the previous bioinformatics predictions, providing more solid two-layer evidence for interpreting the pathogenicity of variants.

[0040] 4. Possesses good universality and scalability: The core method of this invention (i.e., adjusting primer design positions according to predicted abnormal patterns) is not only applicable to the OTOF gene or the c.3409-11A>G site, but can also be extended to the verification of other genes, other deep intron mutations that may activate cryptic splicing sites, or atypical splicing events. Attached Figure Description

[0041] Figure 1 The splicing prediction results of the OTOF gene c.3409-11A>G site RNA Splicer software in Example 1 are shown.

[0042] Figure 2 This is an agarose gel electrophoresis image of the RT-PCR amplification products of the patient and control samples in Example 1.

[0043] Figure 3 This is a sequencing diagram of the RT-PCR amplification product of the wild-type control sample in Example 1.

[0044] Figure 4 This is a sequencing diagram of the RT-PCR amplification product of the mutant patient sample in Example 1.

[0045] Figure 5 The sequencing results for other deafness genes in Example 2 include the CD14A, DCDC2, ELMOD3, ESPN, and GAB1 genes.

[0046] Figure 6 The sequencing results for other deafness genes in Example 2 include GIPC3, GPSM2, HGF, KARS1, and LOXHD1 genes.

[0047] Figure 7 The sequencing results for other deafness genes in Example 2 include MARVELD2, MSRB3, PDZD7, PJVK, and PNPT1 genes.

[0048] Figure 8 The sequencing results for other deafness genes in Example 2 include RDX, SERPINB6, SYNE4, TMPRSS3, and TPRN genes.

[0049] Figure 9 The sequencing results for other deafness genes in Example 2 include WHRN, PPIP5K2, EPS8, DIAPH1, GSDME, and WFS1 genes.

[0050] Figure 10 The splicing prediction results of the RNA Splicer software at the c.2704-11T>C site of the RBL2 gene in Example 3 are shown.

[0051] Figure 11 This is an agarose gel electrophoresis image of the RT-PCR amplification products of the heterozygous mutant sample and the wild-type control sample in Example 3.

[0052] Figure 12 This is a sequencing diagram of the RT-PCR amplification product of the wild-type sample in Example 3.

[0053] Figure 13 This is a sequencing diagram of the RT-PCR amplification product of the heterozygous mutant sample in Example 3. Detailed Implementation

[0054] All embodiments, corresponding results, and accompanying figures were provided by the Eye, Ear, Nose and Throat Hospital affiliated with Fudan University.

[0055] The technical solutions in the embodiments of the present invention have been clearly and completely described. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0056] Example 1: Verification of OTOF gene c.3409-11A>G mutant mRNA splicing abnormality This embodiment discloses an accurate and efficient verification method that reflects the true state of RNA splicing.

[0057] The OTOF gene is located on human chromosome 2, p23.3, and contains a total length of 101,554 bases with 48 exons. This gene is expressed in human peripheral blood, and its effects on precursor RNA splicing can be directly verified using peripheral blood samples.

[0058] Clinically, patients carrying the OTOF gene c.3409-11A>G mutation have been found. This mutation is located at the 11th deoxynucleotide position from the end of intron 27. The length of this intron is 223 bp. The partial nucleotide sequence of the genome carrying the OTOF gene c.3409-11A>G mutation is shown in SEQ ID NO.1.

[0059] SEQ ID NO.1: (Underlined area indicates mutation site) CCTTCCCTGGGGGGCGTGGAGCCAGGCTTGGTGGCAGGGTGGATGTGGCCATACCCGTGGTGTTCCAGCTGGGGGCCGAGCGGTCTGGGGGCCGGTAGATGAAGCGTCGCAGGGAGCTGACGGCA TGGGAGCCCACCAGTGTGTAGCGACCGAAGGCCCGGCAGTCCACCACACGGATGTTCAAGGGCGGGTGCAGCAGCTCGTTCTGGGAGGTCCTGGGGTGTTGGCGACAGGAGCCTGAGCCTCCA AGAAGGGGCAGAGGAAGCCGGCTGGCTGAGTGGAGCCACACTGGCCACAGGATTCCTCCGCCAGGGCCTGCACTCACCACTTCAAACCACTTGACGAGGGTTGTTGAAGTTGGGGTTCTTCTTATAATTGTGGATCAGGGACGACTGCCCCTTCCCTGCACACTCGATGTCCACCCGTGGCCGGTCCACCTGGGCCAGGTTCACCCGCTTTAGGTCCCGTAGGCCCCAGAACAGCACCTGGGAGAGG TTGGAGGGTGGGTGCAGAGAAGAGGCCCCTTAGTCAAGGGAGCCAGCCATGGGGTGCTGGACCATCCAATAGGGAACCGGGCAGTGGGATGGGCAGTAGTTCACCCCAGATTTCAAAGGGTGGG AGCAGGGCCAGGAGAGCAGAGGAGGGGCAGGCGTTCTCCAGGGATGAGGGTGGGGCTGCCCGGAGAAGGGGTGCAGGGTCAGGGGTGCAGACAGGAGGGCTGGGCATGGTCCTGGGACATGGGAG TGCGACTTGGTGCAGATGGGGGCAGGCCCTGGGCTGGGGCAGGAGCCTGGGTCTGCTGCTGGCTCCTGGTGATGGTGGTGGGAGGGGGATGACAAGCCACTTCCCCTCCTGGGTCCTCAGACTCC TCATCCAAAAGGGAAGGGCCACACAGAGCCCTCGCACCTCCACTCGGTACTTGCTGAGCACGGGCCGGATGCCCATGGGCACGGGCATGATGGGACCTCGGTCCACGTCCACCGGGCATTGATG Experimental steps: (1) Based on the RNA splicing prediction tool—RNA Splicer mutation site—splicing prediction was performed on the mutation site of the target gene. The prediction results showed that two splicing abnormalities may occur: 1) the generation of a new splice acceptor, resulting in the retention of part of the posterior intron 27, with a retained fragment length of 10 bp; 2) the entire intron 27 is retained, with a retained fragment length of 423 bp. Specific information is as follows: Figure 1 As shown.

[0060] The RNA Splicer not only predicted the “possible” abnormality, but more importantly, it provided two specific and quantifiable abnormality patterns (10 bp retention or full-length intron retention).

[0061] Based on the prediction results of step (1) and the sequences before and after the locus, primers OTOF-F1 / OTOF-R1 were designed. OTOF-F1 is located at the junction of exon 26 and exon 27 upstream of the locus, and OTOF-R1 is located at exon 30 downstream of the locus. The theoretical RT-PCR amplification fragment length is 472 bp. Specifically, based on the accurate prediction results of step (1), this invention performed targeted primer design. The prediction showed that the most likely anomaly was the generation of a new splice acceptor within intron 27, resulting in the retention of the subsequent 10 bp fragment. To ensure that the experiment could clearly distinguish between normal splicing products and this predicted anomalous product, we strategically chose the design position of the reverse primer (OTOF-R1). Conventional designs might place the reverse primer in exon 28 or 29. However, if OTOF-R1 is designed in exon 30, then: when splicing is normal, the amplification product spans exons 26 to 30 (normal product); when the c.3409-11A>G mutation activates the predicted new splice acceptor, the amplification product will contain an additional 10 bp retained sequence (anomalous product). This design strategy is an active optimization of the experimental protocol based on prediction information, with the aim of directly verifying the predicted specific anomalous pattern. The forward primer OTOF-F1 is located in exon 26. In conventional design, if the reverse primer is placed at exon 28, the length difference between the normal product and the predicted 10 bp abnormal retention product is minimal, making them almost indistinguishable in ordinary agarose gel electrophoresis and prone to missed detection. However, if the prediction is "entire intron retention," the reverse primer needs to be designed further downstream (such as at exon 31 or 32) to generate a significant length difference (>200 bp) sufficient for separation in electrophoresis. The primer sequences are shown in Table 1.

[0062] Table 1 OTOF-F1 / OTOF-R1 sequence information

[0063] (2) Total RNA was extracted from each sample using Red Blood Cell Lysis Buffer (Yisheng) / FreeZol Reagent (Novizan).

[0064] According to the design principles of this invention, when the prediction results show that there may be abnormal retention of large fragments (such as more than 100 bp), the reverse primer should be designed in a more downstream exon to ensure that the normal and abnormal products obtain sufficient resolution in electrophoresis.

[0065] (3) RNA from each sample was quantified using the Equalbit RNA HS Assay Kit (Novizan).

[0066] (4) Reverse transcription experiment using HiScript III RT SuperMix for qPCR (+gDNA wiper) (Novizan): Add 10 pg - 500 ng total RNA to an RNase-free centrifuge tube, heat at 65°C for 5 min, quickly cool on ice, and incubate on ice for 2 min. Then add 2 μL of 5 × gDNA wiper Mix, gently mix with a pipette, and incubate at 42°C for 2 min. Prepare the first-strand cDNA synthesis reaction solution according to the system in Table 2, and gently mix with a pipette. Perform the first-strand cDNA synthesis reaction according to the procedure in Table 3.

[0067] Table 2 First-strand cDNA Synthesis Reaction System

[0068] Table 3. First-strand cDNA synthesis reaction procedure

[0069] Note: This step is only required when using Random hexamers; omit this step when using Oligo(dT)20 VN or GSP.

[0070] (5) After reverse transcription, the OTOF gene Exon26-Exon27-Exon28-Exon29-Exon30 (nucleotide sequence as shown in SEQ ID NO.4) was amplified by PCR using the primers shown in Table 1. The PCR amplification reaction system was configured according to Table 4 and the PCR amplification reaction program was set according to Table 5.

[0071] SEQ ID NO.4: GGCAAAGCTGACTTCATGGGCCGGACCTTCGCCAAACCCCTGGTGAAGATGGCAGACGAGGCGTACTGCCCACCCCGCTTCCCACCTCAGCTCGAGTACTACCAGATCTACCGTGGCAACGCCACAGCTGGAGACCTGCTGGCGGCCTTCGAGCTGCTGCAGATTGGACCAGCAGGGAAGGCTG ACCTGCCCCCCATCAATGGCCCGGTGGACGTGGACCGAGGTCCCATCATGCCCGTGCCCATGGGCATCCGGCCCGTGCTCAGCAAGTACCGAGTGGAGGTGCTGTTCTGGGGCCTACGGGACCTAAAGCGGGTGAACCTGGCCCAGGTGGACCGGCCACGGGTGGACATCGAGTGTGCAGGGAAG GGGGTGCAGTCGTCCCTGATCCACAATTATAAGAAGAACCCCAACTTCAACACCCTCGTCAAGTGGTTTGAAGTGGACCTCCCAGAACGAGCTGCTGCACCCGCCCTTGAACATCCGTGTGGTGGACTGCCGGGCCTTCGGTCGCTACACACTGGTGGGCTCCCATGCCGTCAGCTCCCTGC GACGCTTCATCTACCGGCCCCCAGACCGCTCGGCCCCCAGCTGGAACACCACGGTCAGGCTTCTCCGGCGCTGCCGTGTGCTGTGCAATGGGGGCTCCTCCTCTCACTCCACAGGGGAGGTTGTGGTGACTATGGAGCCAGAGGTACCCATCAAGAAACTGGAGACCATGGTGAAGCTGGACGCG Table 4 PCR amplification reaction system

[0072] Table 5 PCR amplification reaction procedure

[0073] (6) Since this experiment aims to distinguish fragments with small length differences (the difference between normal and abnormal products is about 10 bp), a high-resolution 1.5% agarose gel was used for electrophoresis analysis, and the electrophoresis conditions (200 V, 25 min) were optimized to ensure that the target bands could be clearly distinguished.

[0074] The amplification products were subjected to electrophoresis on a 1.5% TAE agarose gel. The sample loading volume was 20 μL, and the marker loading volume was 5 μL. After electrophoresis at 200 V for 25 min, the gel electrophoresis images were taken and saved using a gel imaging system. The gel electrophoresis images are shown below. Figure 2 As shown, the target DNA band was cut from the agarose gel and placed into a clean centrifuge tube, and then recovered using the FastPure Gel DNA Extraction MiniKit (Novizan).

[0075] To fully separate DNA fragments that differ in length by only about 10 bp, this example uses a high-resolution 1.5% agarose gel and optimizes the electrophoresis conditions (200 V, 25 min) to ensure that normal and abnormal bands can be separated at baseline, facilitating subsequent gel recovery and sequencing.

[0076] (7) Quantify the recovered product and perform Sanger sequencing experiments. The peak plot file (.ab1) can be opened and analyzed using Chromas or SeqMan software. The sequencing results are as follows: Figure 3 (wild type) and Figure 4 (Patient sample) is shown.

[0077] Figure 3 The sequence shows a complete and correctly assembled Exon26-Exon27-Exon28-Exon29-Exon30. Crucially, Figure 4 The sequencing chromatogram showed a clear bimodal signal at the boundary between Exon 27 and Exon 28. Reverse sequencing confirmed that a 10 bp sequence (5'-CCTCTCCCAG-3') from intron 27 was inserted after Exon 27. The insertion location and length of this anomalous sequence perfectly matched the prediction made by the RNA Splicer tool in step S1, which stated that "activation of the new splice acceptor leads to a 10 bp retention." This not only confirmed the pathogenicity of c.3409-11A>G but also directly demonstrated the effectiveness and accuracy of the primer design strategy based on prediction in this invention.

[0078] The above results indicate that the method of this application can accurately reflect the effect of gene mutations on RNA splicing and has the potential to detect whether other unknown mutations will cause abnormal RNA splicing.

[0079] In summary, this embodiment demonstrates an innovative workflow for verifying RNA aberration splicing. Compared to conventional direct RT-PCR analysis, the core advantage of this method lies in elevating bioinformatics prediction from a preliminary reference to a key decision-making basis driving the entire experimental design. Successful verification at the OTOF gene c.3409-11A>G site demonstrates that prospectively designing the reverse primer in exon 30, based on the prediction of "potential new splice acceptor activation leading to 10bp retention," is crucial for successfully capturing and confirming this subtle splicing anomaly. This method is particularly suitable for verifying mutations that may produce atypical, subtle splicing changes, providing a systematic and highly successful solution for the functional interpretation of VUS in clinical settings.

[0080] Example 2: Feasibility Analysis of Transcription Splicing Validation of Other Deafness Genes To demonstrate the versatility of the verification method of this invention, nested PCR amplification and sequencing were performed on multiple deafness genes in this embodiment. The nested PCR amplification primer sequences are shown in Table 6, the amplification sequences are shown in Table 7, the amplification reaction system and amplification reaction procedure are as described in Example 1, and the sequencing results are shown in the figure. Figure 5-9 .

[0081] Table 6 Primer sequences for nested PCR amplification of other deafness genes.

[0082] Table 7 Nested PCR amplification sequences of other deafness genes

[0083] The results above show that the verification method of this invention can achieve RNA amplification for multiple deafness genes. When RNA splicing abnormalities occur in genes, the verification method of this invention can be used to distinguish between normal transcription samples and abnormal transcription samples.

[0084] Example 3: Verification of abnormal splicing of RBL2 gene c.2704-11T>C mutant mRNA The RBL2 gene c.2704-11T>C mutation is located in intron 17. The partial nucleotide sequence of the genome carrying the RBL2 gene c.2704-11T>C mutation is shown in SEQ ID NO.161.

[0085] SEQ ID NO.161: (Underlined area indicates mutation site) GAGAGAGAGTCTTGCTCTGTCACCCAGGCTGTACAGTGGCTCAATCTCAGCTCACTGCAACCTCCATCTCCCAGGTTCAAGTGATTCTCCTGCCTCAGCCTCCCCAGTAGCTGGGATTACAGGCATGTGCCACCATGCCCGGCTAATTTTTGTATTTTTAGTAGATACTGGGTTTCACCATGATGGCCAGGCTGGTCTTGAACTCGTGACTTCAAGTGATCCACCCTCCTCAGCCTCCCAAAGTGCTGGGATTACAGGTGTGAACCACCGCACCTGGCCTCTAAGTCTTGATTCACATACTATAGACTCCTATTGTTTTTATTGAATTTTAATAGATATTCTTGAATCGATGTATCTTCATTTGCTATATGCCGTTAATACCATTTCCAGAGACTTTAAATAGCTTTTATATAATTTTCACCCCTTTTACTGGGCAGCAGGTTCACAGAGCTCCTCACACTATTATGGTGGTAGTTGCCATGTCTCTCAGAGCACTCTTA TTGTTTGCCAGGTCACAAAAGAAGATAAGTCCTTCCAGAACATTATGCGTTGTTATAGGACTCAGCCGCAGGCCCGGAGCCAGGTAACTACATTTTTCTCTATGGGCTGAAAAATAAAGCTTAAAGTCTGTGATGAATACAAAAAATTAACCATAGTTGACTCTGTGGCCTTTTTTCCAAGATAAACACCTGGGACTCTACTTAAGGGAAGTTTCTACTTTAATCTTTATTCTTGATGTCACATGTTGATTA AGGTCTCTTTTCCTCAAAAGGCAACAATGTTAAATATTTGATTGCCTTTTTAATTCAGAAAAATCACAAGATAGGAATTAAGAAGTTACTTGGTTTCTATGTCACCTTTCATTCTGGTTTAGTAAACATACTGTAGGTTTAACCAACAGAATGTCACATGGAAATTTAAAACCCACTTTGCCTTTATTACCATTCATCTCTGAGAGGCAAATCGGCCAGATCTGTGTATCTTACTTAGAATGACTTGACA Experimental steps: (1) Based on the RNA splicing prediction tool—RNA Splicer mutation site—splicing prediction was performed on the mutation site of the target gene. The prediction results showed that two splicing abnormalities may occur: 1) The backup splice acceptor is activated, which retains 176 bp of intron 11, causing a frameshift and ultimately leading to premature protein termination; 2) Exon 11 skips, resulting in a 72 bp deletion, which ultimately leads to a shorter protein length. Specific information is as follows: Figure 10 As shown.

[0086] Based on the prediction results of step (1) and the sequences before and after the site, primers RBL2-2704-11-F / RBL2-2704-11-R were designed. RBL2-2704-11-F is located in exons 15 and 16 upstream of the site, and RBL2-2704-11-R is located in exons 19 and 20 downstream of the site. The theoretical RT-PCR amplification fragment length is 663 bp. The primer sequences are shown in Table 8.

[0087] Table 8. Sequence Information of RBL2-2704-11-F / RBL2-2704-11-R

[0088] Steps (2)-(4) are the same as in Example 1.

[0089] (5) After reverse transcription, the primers shown in Table 7 were used to perform PCR amplification of the RBL2 gene Exon15-Exon16-Exon17-Exon18-Exon19-Exon20 (nucleotide sequence as shown in SEQ ID NO.164). The PCR amplification reaction system was configured according to Table 9 and the PCR amplification reaction procedure was set according to Table 10.

[0090] SEQ ID NO.164: Table 9 PCR amplification reaction system

[0091] Table 10 PCR Amplification Reaction Procedure

[0092] (6) The amplified products were electrophoresed on a 1.5% TAE agarose gel. The sample loading volume was 20 μL and the marker loading volume was 5 μL. After electrophoresis at 200 V for 25 min, the gel electrophoresis image was taken and saved using a gel imaging system. The gel electrophoresis image is shown below. Figure 11 As shown, the target DNA band was cut from the agarose gel and placed into a clean centrifuge tube, and then recovered using the FastPure Gel DNA Extraction Mini Kit (Novizan).

[0093] (7) Quantify the recovered product and perform Sanger sequencing experiments. The peak plot file (.ab1) can be opened and analyzed using Chromas or SeqMan software. The sequencing results are as follows: Figure 12 (wild-type sample) and Figure 13 (Heterozygous mutant sample) is shown.

[0094] Figure 12 The sequence is displayed as a complete and correctly assembled Exon15-Exon16-Exon17-Exon18-Exon19-Exon20. Figure 13 The sequencing chromatogram results showed that the c.2704-11T>C mutation in the RBL2 gene did not cause abnormal RNA splicing. These results indicate that not all gene mutations affect RNA splicing.

[0095] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0096] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A method for assessing abnormal RNA splicing caused by mutations in deafness-related genes, characterized in that, The method includes: RNA was extracted from peripheral blood samples of the subjects and reverse transcribed into cDNA; The cDNA was amplified by PCR using at least one pair of specific amplification primers. The amplification products are analyzed by nucleic acid electrophoresis. The position and / or number of bands are used to determine whether RNA splicing is normal. Abnormal bands are sequenced to confirm the specific pattern of splicing abnormality. The aforementioned deafness-related gene mutations are characterized by hearing loss as the main clinical manifestation.

2. The method according to claim 1, characterized in that, The deafness-related genes include at least one selected from OTOF, CDCI14A, DCDC2, ELMOD3, ESPN, GAB1, GIPC3, GPSM2, HGF, KARS1, LOXHD1, MARVELD2, MSRB3, PDZD7, PJVK, PNPT1, RDX, SERPINB6, SYNE, TMPRSS3, TPRN, WHRN, PPIP5K2, EPS8, DIAPH1, GSDME, and WFS1; Preferably, the deafness-related gene is OTOF, and the mutation of the deafness-related gene is the OTOF gene c.3409-11A>G mutation; Preferably, the primers include an upstream primer OTOF-F1 and a downstream primer OTOF-R1, wherein OTOF-F1 is located at the junction of exon 26 and exon 27 upstream of the c.3409-11A>G mutation site, and OTOF-R1 is located at exon 30 downstream of the c.3409-11A>G mutation site; Preferably, the sequence of OTOF-F1 is SEQ ID NO.2, and the sequence of OTOF-R1 is SEQ ID NO.

3.

3. The method according to claim 1, characterized in that, The PCR amplification was performed in a single round.

4. The method according to claim 1, characterized in that, The PCR amplification was nested PCR; Preferably, when the deafness-related gene is a low-abundance transcript in peripheral blood, the PCR amplification is nested PCR, including a first round of amplification using outer primers and a second round of amplification using inner primers.

5. The method according to claim 1, characterized in that, The primers are trans-exon primers, and the binding sites of the upstream and / or downstream primers span the junctions of adjacent exons.

6. The method according to claim 1, characterized in that, The binding site of at least one primer is selected such that, in the event of splicing anomalies, there is an electrophoretically resolvable length difference between the amplified and normal amplified products.

7. The method according to claim 1, characterized in that, The nucleic acid electrophoresis includes agarose gel electrophoresis, polyacrylamide gel electrophoresis, or pulsed field gel electrophoresis, and the sequencing includes Sanger sequencing, NGS sequencing, or long read sequencing.

8. A kit for assessing abnormal RNA splicing caused by mutations in deafness-related genes, characterized in that, The kit includes at least one pair of specific amplification primers for amplifying the deafness-related gene of claim 2, and at least one selected from RNA extraction reagents, reverse transcription reagents, PCR amplification reagents, and nucleic acid electrophoresis reagents; Preferably, the deafness-related gene is the OTOF gene, and the primers include primer pairs for amplifying the region of exons 26 to 30 of the OTOF gene; Preferably, the primer pair includes an upstream primer OTOF-F1 (SEQ ID NO.2) and a downstream primer OTOF-R1 (SEQ ID NO.3).

9. A system for assessing abnormal RNA splicing caused by mutations in deafness-related genes, characterized in that, The system includes: Sample processing module: used to extract RNA from the peripheral blood of the subject and reverse transcribe it into cDNA; Amplification module: used for PCR amplification of the cDNA using at least one pair of specific amplification primers; Analysis module: Used to analyze amplification products by nucleic acid electrophoresis and determine whether RNA splicing is normal based on band position and / or band number, as well as to sequence abnormal bands to confirm the specific pattern of splicing abnormality.

10. Any of the following applications: 1) The use of the method of any one of claims 1-7, the kit of claim 8, or the system of claim 9 in evaluating abnormal RNA splicing caused by mutations in deafness-related genes; 2) The use of the method according to any one of claims 1-7, the kit according to claim 8, or the system according to claim 9 in the preparation of products for diagnosing diseases caused by abnormalities in deafness-related genes; Preferably, the diseases caused by the deafness-related gene abnormalities include recessive or dominant hereditary deafness.

Images