Colorectal cancer biomarker crcst1 and uses thereof

Abstract

The application discloses a biomarker of colorectal cancer and application thereof, and the biomarker is a transcript CRCST1 which is specifically expressed in colorectal cancer tissue. The application firstly finds that, compared with normal colorectal tissue, a newly found transcript CRCST1 exists in colorectal cancer tissue, and the CRCST1 is significantly highly expressed in the colorectal cancer tissue, and the expression change of the CRCST1 significantly influences the proliferation and invasion ability of colorectal cancer cells; in addition, compared with normal people, the RNA of the CRCST1 is also significantly highly expressed in the plasma exosome of a colorectal cancer patient. It is shown that the CRCST1 can be used as a colorectal cancer biomarker, and provides a new way for early diagnosis, prognosis and treatment of the colorectal cancer.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a colorectal cancer biomarker and its application. Background Technology

[0002] Because colorectal cancer often presents with few or no symptoms in its early stages and lacks specific and effective early diagnostic markers, most patients are already in the middle or late stages when they seek medical attention, resulting in poor treatment outcomes. Furthermore, the pathogenesis and molecular mechanisms of colorectal cancer remain largely unclear. Therefore, there is an urgent need to explore specific molecular markers for colorectal cancer and its molecular regulatory mechanisms, which is of great significance for the early and accurate diagnosis and treatment of colorectal cancer.

[0003] The rapid development of high-throughput RNA sequencing technology and bioinformatics has revealed the diversity and complexity of the human transcriptome from a novel perspective. Malignant tumors are highly heterogeneous diseases with extremely complex transcriptional processes. Within tumors, there exists a class of RNA molecules expressed only in tumor cells, exhibiting a different expression pattern than in normal cells; these are known as "tumor-specific transcripts" (TSTs). The expression of these transcripts may be due to gene mutations, rearrangements, fusions, or epigenetic alterations in tumor cells, leading to abnormal expression of normal genes or the creation of new fusion genes. However, the origins and regulatory mechanisms of most tumor-specific transcripts remain poorly understood.

[0004] Studies have shown that tumor-specific transcripts are closely related to the development and progression of various tumors, but the functions of only a very small number of these transcripts have been reported. For example, research in triple-negative breast cancer has revealed a tumor-specific splicing variant of a macrophage receptor with a collagen structure, MARCO-TST. MARCO-TST enhances PLOD2 enzyme activity, activates the hypoxia signaling pathway, and ultimately promotes the progression of triple-negative breast cancer. However, the specific transcripts present in colorectal cancer and their biological functions remain unclear.

[0005] Exosomes are nanoscale extracellular vesicles widely distributed in various biological fluids, containing a variety of complex components such as DNA, RNA, lipids, and proteins. Increasing research indicates that exosomes play an important role in the progression of various diseases, including cancer, and their components can serve as potential biomarkers for disease diagnosis and prognosis.

[0006] Therefore, identifying specific transcripts in colorectal cancer and elucidating their functions and molecular mechanisms regulating tumor progression may provide potential diagnostic biomarkers and therapeutic targets for the diagnosis and treatment of colorectal cancer, which has important biological significance and clinical application value. Summary of the Invention

[0007] The purpose of this invention is to provide a colorectal cancer biomarker and its use in medicine or biology.

[0008] To achieve the above-mentioned objectives, the technical solution of this invention is as follows: A colorectal cancer biomarker, which is a colorectal cancer-associated transcript named CRCST1, has the base sequence shown in SEQ ID NO.1.

[0009] The inventors assembled and compared transcripts from transcriptome sequencing data of normal, adjacent normal, and colorectal cancer tissues to analyze transcripts specifically expressed in colorectal cancer. They discovered a newly discovered, unannotated transcript with the highest expression frequency in colorectal cancer tissue, named CRCST1. Coding potential analysis using the CPAT tool revealed that CRCST1 is a non-coding RNA.

[0010] This invention provides the application of the colorectal cancer biomarker CRCST1 in the preparation of reagents or drugs for the diagnosis, prognosis or treatment of colorectal cancer.

[0011] The colorectal cancer described in this invention includes colon cancer and rectal cancer.

[0012] The application of reagents for detecting CRCST1 expression levels in the preparation of diagnostic or prognostic products for colorectal cancer; said reagents include one or more of the following: (a) primers or primer sets that specifically amplify the sequence shown in SEQ ID NO.1; (b) probes that specifically recognize the sequence shown in SEQ ID NO.1; (c) small molecule compounds that specifically recognize the sequence shown in SEQ ID NO.1.

[0013] The use of CRCST1 inhibitors in the preparation of drugs for treating colorectal cancer; the CRCST1 inhibitors include one or more of the following: (a) siRNA, shRNA or functionally similar interfering small RNA that targets the sequence shown in SEQ ID NO.1; (b) gene editing tools that knock out or disrupt the sequence shown in SEQ ID NO.1.

[0014] in, The siRNA sequence for knocking down CRCST1 is as follows: CRCST1 knockdown group #1: 5'-GGATTCCCAGCCATATGAATT-3'; CRCST1 knockdown group #2: 5'-TCAGACAAACAACCTACAATT-3'.

[0015] The shRNA targeting sequence for knocking down CRCST1 is as follows: Chain of Justice: 5'- CCGGGGTTCACCATTCCAGAATAAACTCGAGTTTATTCTGGAATGGTGAACCTTTTTG-3'; Antonym chain: 5'- AATTCAAAAAGGTTCACCATTCCAGAATAAACTCGAGTTTATTCTGGAATGGTGAACC-3'.

[0016] Preferably, the gene editing tool that knocks out or disrupts the sequence shown in SEQ ID NO.1 is: TALEN gene editing system, Cre / Loxp recombination system, Flp-FRT recombination system or CRISPR gene editing system, etc.

[0017] The inventors discovered in their research that CRCST1 expression promotes the proliferation, growth, migration, and invasion of colorectal cancer cells. Therefore, by inhibiting CRCST1 expression, the growth and metastasis of colorectal cancer cells can be suppressed, thereby achieving the purpose of treating or preventing colorectal cancer.

[0018] The present invention may include a drug used for at least one of the following: inhibiting the increased expression of CRCST1 in colorectal cancer tumor cells, inhibiting the growth of colorectal cancer cells, and inhibiting the migration and invasion of colorectal cancer cells.

[0019] This invention proposes the use of CRCST1 as a biomarker for colorectal cancer. The inventors, through quantitative real-time PCR detection of tissue samples from colorectal cancer patients, found that CRCST1 was significantly highly expressed in colorectal cancer tissues compared to adjacent or normal tissues. Furthermore, detection of CRCST1 expression in plasma exosomes of colorectal cancer patients revealed that its expression level was significantly higher than that of normal individuals. Moreover, ROC curve fitting of CRCST1 expression with a colorectal cancer prediction model showed that the expression level of CRCST1 in plasma exosomes has good sensitivity and specificity as a model for differentiating colorectal cancer, and may serve as a potential diagnostic biomarker.

[0020] The present invention also provides a reagent or kit for detecting the expression level of the colorectal cancer biomarker CRCST1 and its application, wherein the reagent is used to detect the expression level of CRCST1.

[0021] A reagent for diagnosing or prognosing colorectal cancer, comprising one or more of the following: (a) primers or primer sets that specifically amplify the sequence shown in SEQ ID NO. 1; (b) probes that specifically recognize the sequence shown in SEQ ID NO. 1; and (c) small molecule compounds that specifically recognize the sequence shown in SEQ ID NO. 1.

[0022] Reagents for diagnosing or prognosing colorectal cancer are used in the preparation of colorectal cancer detection kits.

[0023] A kit for the detection or prognosis of colorectal cancer, comprising reagents for the diagnosis or prognosis of colorectal cancer, including one or more of the following: (a) primers or primer sets that specifically amplify the sequence shown in SEQ ID NO.1; (b) probes that specifically recognize the sequence shown in SEQ ID NO.1; and (c) small molecule compounds that specifically recognize the sequence shown in SEQ ID NO.1.

[0024] The present invention also provides a drug for treating colorectal cancer and its application.

[0025] A drug for treating colorectal cancer, the drug comprising compounds, biological agents and combinations thereof, the active ingredient comprising one or more of the following: (a) siRNA, shRNA or functionally similar interfering small RNA targeting the sequence shown in SEQ ID NO.1; (b) a gene editing tool that knocks out or disrupts the sequence shown in SEQ ID NO.1.

[0026] in, The siRNA sequence for knocking down CRCST1 is as follows: CRCST1 knockdown group #1: 5'-GGATTCCCAGCCATATGAATT-3'; CRCST1 knockdown group #2: 5 '-TCAGACAAACAACCTACAATT-3 '.

[0027] The shRNA targeting sequence for knocking down CRCST1 is as follows: Chain of Justice: 5'-CCGGGGTTCACCATTCCAGAATAAACTCGAGTTTATTCTGGAATGGTGAACCTTTTTG-3'; Antonym chain: 5'-AATTCAAAAAGGTTCACCATTCCAGAATAAACTCGAGTTTATTCTGGAATGGTGAACC-3'.

[0028] Gene editing tools that knock out or disrupt the sequence shown in SEQ ID NO.1 include: TALEN gene editing system, Cre / Loxp recombination system, Flp-FRT recombination system, or CRISPR gene editing system, etc.

[0029] Compared with the prior art, the technical effects of the present invention are reflected in: This invention marks the first discovery of a novel, unannotated transcript, CRCST1, in colorectal cancer tissues. Furthermore, the expression level of CRCST1 in colorectal cancer tissues is significantly upregulated compared to normal tissues, and changes in CRCST1 expression significantly affect the proliferation and invasiveness of colorectal cancer cells. In addition, the expression level of CRCST1 in the plasma exosomes of colorectal cancer patients is significantly higher than that in the plasma exosomes of healthy individuals. These findings suggest that CRCST1 can serve as a biomarker for colorectal cancer, possessing significant potential clinical value for the early and rapid diagnosis, prognosis, and treatment of colorectal cancer. Attached Figure Description

[0030] Figure 1 The expression frequency and annotation of specific transcripts in TCGA colorectal cancer samples are shown. Among them, CRCST1 is the most frequently expressed transcript in colorectal cancer tissues and is a newly discovered transcript that has not been annotated.

[0031] Figure 2 Coding potential analysis of CRCST1 showed that it is a non-coding RNA.

[0032] Figure 3 This is a map showing the location of the CRCST1 gene in the genome.

[0033] Figure 4 This shows the expression of CRCST1 in normal tissues, adjacent normal tissues, and colorectal cancer tissues in the ENCODE, GEO, and TCGA databases.

[0034] Figure 5 This study shows the expression of CRCST1 in cancerous and adjacent tissues of colorectal cancer patients.

[0035] Figure 6 To analyze the correlation between CRCST1 expression levels in colorectal cancer samples and patient prognosis.

[0036] Figure 7 The proliferation of colorectal cancer cells after CRCST1 gene knockdown.

[0037] Figure 8 This shows the proliferation of colorectal cancer cells after CRCST1 gene overexpression.

[0038] Figure 9 The effect of CRCST1 gene knockdown on the ability of colorectal cancer cells to form tumors subcutaneously in mice.

[0039] Figure 10 This is a representative immunohistochemical staining image of Ki67, a cell proliferation marker, in a subcutaneous tumor in a mouse.

[0040] Figure 11The effect of CRCST1 gene knockdown on the migration and invasion ability of colorectal cancer cells.

[0041] Figure 12 The effect of CRCST1 gene overexpression on the migration and invasion ability of colorectal cancer cells.

[0042] Figure 13 The expression level of CRCST1 in plasma exosomes of colorectal cancer patients and healthy individuals.

[0043] Figure 14 This is an ROC curve used to show the fit between CRCST1 expression levels and a colorectal cancer prediction model. The horizontal axis represents specificity (percentage), and the vertical axis represents sensitivity (percentage). Detailed Implementation

[0044] The technical solution of the present invention will be further described in detail below with reference to embodiments and specific implementation methods. The embodiments are shown in the accompanying drawings.

[0045] To systematically screen for colorectal cancer-related specific transcripts, the inventors integrated transcriptome sequencing data from normal tissues, adjacent normal tissues, and colorectal cancer tissues in the ENCODE and GEO databases. They then performed transcript assembly and comparative screening, and further validated the data in the TCGA database of colorectal cancer transcriptome sequencing data, ultimately discovering 245 potential colorectal cancer-specific transcripts.

[0046] In Example 1, the inventors analyzed the distribution and annotation of some high-frequency expressed specific transcripts in TCGA colorectal cancer samples and found that CRCST1 is the most frequently expressed transcript in colorectal cancer tissue, and it is a newly discovered transcript that has not been annotated.

[0047] Example 2: Coding potential analysis using CPAT revealed that CRCST1 is a non-coding RNA. MALAT1 served as a negative control, showing no protein-coding ability; GAPDH served as a positive control, demonstrating protein-coding ability.

[0048] Example 3: Bioinformatics analysis of transcriptome sequencing data showed that the CRCST1 gene is located on chromosome 19 and is an intergenic transcript. Figure 3 Using sequencing data from two colorectal cancer and adjacent normal tissues in the TCGA database as examples, we demonstrate the location of CRCST1 in the genome and its significantly higher expression in cancerous tissues compared to adjacent normal tissues.

[0049] Example 4: Figure 4The analysis of A in the study examined the expression of CRCST1 in sequencing data of normal tissues, adjacent normal tissues, and colorectal cancer tissues from the ENCODE and GEO databases. The results showed that CRCST1 was almost not expressed in normal tissues, but was significantly highly expressed in colorectal cancer tissues compared to adjacent normal tissues. Figure 4 B in the analysis examined the expression of CRCST1 in colorectal cancer and adjacent normal tissue sequencing data from the TCGA database, showing that CRCST1 expression was significantly upregulated in colorectal cancer tissues compared to adjacent normal tissues. Here, n represents the number of samples.

[0050] Example 5: The inventors collected tissues from 78 colorectal cancer patients and 10 adjacent normal tissues, and performed transcriptome sequencing. Then, they analyzed the expression of CRCST1, which showed that CRCST1 was significantly more expressed in colorectal cancer tissues than in adjacent normal tissues.

[0051] Example 6: The inventor's... Figure 5 Kaplan-Meier survival curve analysis of 78 colorectal cancer patients collected in China revealed that high expression of CRCST1 was significantly associated with poor prognosis in colorectal cancer patients.

[0052] Example 7: The inventors investigated the effect of downregulating CRCST1 on the proliferative capacity of colorectal cancer cells.

[0053] To knock down CRCST1, siRNA was transfected into colorectal cancer cells using RNAiMAX reagent. The control group consisted of colorectal cancer cells transfected with control siRNA, while the CRCST1 knockdown group consisted of colorectal cancer cells transfected with CRCST1-targeting siRNA. The siRNA sequences for each group are as follows: Control group: 5'-TTCTCCGAACGTGTCACGTTT-3'; CRCST1 knockdown group #1: 5'-GGATTCCCAGCCATATGAATT-3'; CRCST1 knockdown group #2: 5 '-TCAGACAAACAACCTACAATT-3 '.

[0054] To determine the knockdown efficiency of CRCST1, total RNA was extracted from the transfected cells using TRIzol reagent. The total RNA was then reverse transcribed into cDNA, and finally, qRT-PCR (real-time quantitative reverse transcription PCR) was performed using SYBR Green qPCR Master Mix to detect the expression level of CRCST1 in the cells. GAPDH was used as a standardized control. The primers used for the qRT-PCR reaction were as follows: CRCST1 people TTACGGTGGAGGATTCCCAG GGTTGTTTGTCTGATCGGC GAPDH people GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG GAPDH people GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG Depend on Figure 7 As can be seen from A, the expression level of CRCST1 was significantly knocked down.

[0055] The inventors used the CCK8 assay to investigate the effect of CRCST1 knockdown on the proliferation of colorectal cancer cells. After downregulating CRCST1 according to the transfection method described above, cells were harvested, plated, and subjected to a CCK8 cell proliferation assay. Figure 7 As shown in B, the test revealed that CRCST1 knockdown significantly inhibited the proliferation of colorectal cancer cells.

[0056] Example 8: The inventors investigated the effect of CRCST1 overexpression on the proliferation ability of colorectal cancer cells.

[0057] To construct CRCST1 overexpressing cells, the full-length CRCST1 gene was amplified from cells using PCR according to the sequence shown in SEQ ID NO.1. After enzyme digestion and ligation, the full-length CRCST1 gene was cloned into the pcDNA3.1 overexpression plasmid, with an empty plasmid serving as a control. Then, cells in the logarithmic growth phase were plated, and when the cell density reached approximately 80%, the constructed plasmid was transfected into colorectal cancer cells using PolyJet transfection reagent. The cells were shaken well, and the culture medium was replaced after 24 hours.

[0058] Following the method described in Example 7, the overexpression efficiency of CRCST1 was detected by qRT-PCR (real-time quantitative reverse transcription PCR). Figure 8 As shown in A, the expression level of CRCST1 in cells of the CRCST1 overexpression group was significantly increased compared with the control group.

[0059] Next, the inventors used the CCK8 assay to investigate the effect of CRCST1 overexpression on the proliferation of colorectal cancer cells. After overexpressing CRCST1 according to the transfection method described above, cells were harvested, plated, and subjected to a CCK8 cell proliferation assay. Figure 8 The B-test results showed that overexpression of CRCST1 significantly promoted the proliferation of colorectal cancer cells.

[0060] Example 9: The inventors investigated the effect of CRCST1 knockdown on the ability of colorectal cancer cells to form tumors subcutaneously in mice.

[0061] To stably knock down CRCST1, a shRNA targeting CRCST1 was cloned into the pLKO.1 vector plasmid. The constructed pLKO.1 plasmid, along with packaging plasmids pCMV-8.91 and VSV-G, was then packaged into lentivirus in HEK-239T cells. The lentivirus-containing culture medium was collected and used to infect colorectal cancer cells for 24 hours. Cells with stable CRCST1 knockdown were then selected using puromycin. The control group consisted of colorectal cancer cells transfected with the control shRNA, while the CRCST1 knockdown group consisted of colorectal cancer cells transfected with the CRCST1-targeting shRNA. The shRNA targeting sequences for each group are as follows: (1) Control group: Sense strand: 5'-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3'; Antonym chain: 5'-AATTCAAAAA CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG-3'; (2) CRCST1 knockdown group: Chain of Justice: 5'-CCGGGGTTCACCATTCCAGAATAAACTCGAGTTTATTCTGGAATGGTGAACCTTTTTG-3'; Antonym chain: 5'-AATTCAAAAAGGTTCACCATTCCAGAATAAACTCGAGTTTATTCTGGAATGGTGAACC-3'.

[0062] To further confirm the function of CRCST1 in inhibiting the growth of colorectal cancer cells, the inventors conducted an in vivo subcutaneous tumorigenesis experiment on nude mice, using 5 × 10⁻⁶ cells / mL. 6 Stable CRCST1 knockdown colorectal cancer cells or control cells were injected subcutaneously into nude mice aged 4-6 weeks. After inoculation, the length and width of the tumor were measured and recorded weekly. The volume of the tumor was calculated according to the formula (tumor volume = 0.5 × length × width × width). At the end of the measurement, the subcutaneous tumor was removed, photographed and weighed. Finally, the growth curve of the tumor was plotted and the weight of the tumor in each group was statistically analyzed.

[0063] like Figure 9 The results of subcutaneous tumor blocks in A showed that the tumorigenicity of colorectal cancer cells in nude mice after CRCST1 knockdown was significantly lower than that in the control group. The tumor volume was calculated ( Figure 9 (B) and weighing the tumor mass ( Figure 9 In C), it was also found that the growth of cells with knocked-down CRCST1 was significantly slowed.

[0064] Example 10: The inventors performed immunohistochemical analysis on the expression of Ki67, a cell proliferation marker, in subcutaneous tumors of mice.

[0065] Immunohistochemical experiments on Ki67 showed that the proportion of Ki67 in tumors of the CRCST1 knockdown group was significantly lower than that in the control group (e.g., Figure 10 Based on the results of Examples 9 and 10, the inventors further demonstrated in vivo experiments that knocking down CRCST1 can inhibit the growth of colorectal cancer cells, indicating that CRCST1 inhibitors can be used for the treatment of colorectal cancer.

[0066] Example 11: The inventors investigated the effect of CRCST1 knockdown on the migration and invasion ability of colorectal cancer cells.

[0067] Following the siRNA transfection method described in Example 7, the expression level of CRCST1 in colorectal cancer cells was knocked down. After 48 hours, the transfected cells were digested with trypsin, resuspended in a culture medium containing 1% fetal bovine serum, and then counted by counting chamber.

[0068] Cell migration assay: 200 μl of cell suspension (5 × 10⁻⁶ cells / mL) was added to the upper layer of a Transwell chamber (8 μm, 3422, Corning). 4 Cells were cultured in a Transwell chamber at 37°C with 700 μl of culture medium containing 10% fetal bovine serum. After an appropriate time, the Transwell chamber was removed, the culture medium was aspirated, and the cells were fixed with 4% paraformaldehyde for 30 minutes. Then, the paraformaldehyde was aspirated, and the cells were stained with crystal violet solution for 15 minutes. Finally, excess staining solution was washed off with PBS (phosphate-buffered saline), and the cells in the upper layer of the Transwell chamber were gently wiped away with a cotton swab. Cells that had migrated to the submural layer of the chamber were observed under a microscope, photographed, and the cell count was recorded. The results are as follows: Figure 11 As shown in A, the migration ability of cells in the CRCST1 knockdown group was significantly weaker than that of the control group. Figure 11 B in the figure represents the statistical results of the number of cells that migrated in each group.

[0069] Cell invasion assay: Add 50 μl of matrix gel diluted 10-fold with serum-free medium to the upper layer of a Transwell chamber, then incubate for 2 hours for the invasion assay. Resuspend the transfected cells and add 200 μl of cell suspension (5 × 10⁻⁶ cells / mL) to the upper chamber of the Transwell chamber. 4(100 cells), add 700 μl of culture medium containing 10% serum to the lower chamber and incubate at 37°C. Subsequent steps are the same as for cell migration experiments: after an appropriate time, remove the Transwell chamber, fix with 4% paraformaldehyde, stain with crystal violet solution, wash away excess staining with PBS (phosphate-buffered saline), gently wipe away the cells in the upper layer of the Transwell chamber with a cotton swab, observe the cells that have migrated to the lower layer of the chamber membrane under a microscope, photograph and count the number of cells. Results are as follows: Figure 11 As shown in C, the invasive ability of cells in the CRCST1 knockdown group was significantly lower than that of the control group. Figure 11 D in the figure represents the statistical result of the number of invasive cells in each group.

[0070] Example 12: The inventors investigated the effect of CRCST1 overexpression on the migration and invasion ability of colorectal cancer cells.

[0071] Following the method described in Example 8, the CRCST1 overexpression plasmid was transfected into colorectal cancer cells. After 48 hours, the transfected cells were digested with trypsin and then resuspended in a culture medium containing 1% fetal bovine serum. The cells were then counted using a counting chamber.

[0072] Cell migration and invasion experiments were performed according to the method described in Example 11. The results of the cell migration experiments are as follows: Figure 12 As shown in A, the migration ability of cells in the CRCST1 overexpression group was significantly higher than that of control group cells. Figure 12 In the figure, B represents the statistical result of the number of cells migrating in each group. The results of the cell invasion experiment are as follows: Figure 12 As shown in C, compared with the control group, the cells overexpressing CRCST1 showed significantly enhanced invasive ability. Figure 12 D in the figure represents the statistical result of the number of invasive cells in each group.

[0073] Example 13: The inventors isolated serum exosomes from colorectal cancer patients and healthy individuals and detected the expression level of CRCST1 in them.

[0074] The inventors collected plasma samples from 44 healthy individuals and 53 colorectal cancer patients, and separated exosomes from the plasma using differential centrifugation. Figure 13 In the image, A represents an electron micrograph of exosomes secreted by two patients.

[0075] RNA was extracted from exosomes using an exosome RNA extraction kit, and the expression of CRCST1 was then detected by qRT-PCR (real-time quantitative reverse transcription PCR). The results are as follows: Figure 13 As shown in B, the detection revealed that CRCST1 expression in plasma exosomes of colorectal cancer patients was significantly increased compared with normal individuals, indicating that it can serve as a potential diagnostic marker.

[0076] Example 14: ROC curve of CRCST1 expression level and its fit to a colorectal cancer prediction model.

[0077] To further explore the potential of the colorectal cancer-specific transcript CRCST1 as a colorectal cancer biomarker, the inventors further utilized ROC curves in this embodiment to evaluate the distinguishing effect of CRCST1 expression levels on colorectal cancer patients and normal individuals. ROC curves, using both non-tumor and tumor-related subjects, comprehensively reflect both sensitivity and specificity.

[0078] Figure 14 The ROC curve shown reflects the fit between CRCST1 expression and the colorectal cancer prediction model. The AUC (area under the curve) value is 0.771, indicating that the expression level of CRCST1 in plasma exosomes has good sensitivity and specificity as a model for distinguishing colorectal cancer.

Claims

1. A biomarker for colorectal cancer, characterized in that: The marker is a colorectal cancer-associated transcript named CRCST1, which has the base sequence shown in SEQ ID NO.

1.

2. The use of the colorectal cancer biomarker of claim 1 in the preparation of reagents or drugs for the diagnosis, prognosis or treatment of colorectal cancer.

3. Application of reagents for detecting CRCST1 expression levels in the preparation of products for diagnosing or prognosticating colorectal cancer.

4. Application of CRCST1 inhibitors in the preparation of drugs for treating colorectal cancer.

5. The application according to claim 4, characterized in that: The drug inhibits the growth of colorectal cancer cells and inhibits their migration and invasion.

6. A reagent for diagnosing or prognosing colorectal cancer, comprising one or more of the following: (a) primers or primer sets that specifically amplify the sequence shown in SEQ ID NO.1; (b) probes that specifically recognize the sequence shown in SEQ ID NO.1; and (c) small molecule compounds that specifically recognize the sequence shown in SEQ ID NO.

1.

7. The application of the reagent of claim 6 in the preparation of a colorectal cancer detection kit.

8. A drug for treating colorectal cancer, characterized in that, The drug is a compound, a biological agent or a combination thereof, and its active ingredient includes one or more of the following: (a) siRNA, shRNA or functionally similar interfering small RNA that targets the sequence shown in SEQ ID NO.1; (b) a gene editing tool that knocks out or disrupts the sequence shown in SEQ ID NO.

1.

9. The medicament according to claim 8, characterized in that: It can be any of the following siRNA or shRNA targeting sequences: The siRNA sequence for knocking down CRCST1 is as follows: CRCST1 knockdown group #1: 5'-GGATTCCCAGCCATATGAATT-3'; CRCST1 knockdown group #2: 5'-TCAGACAAACAACCTACAATT-3'; The shRNA sequence for knocking down CRCST1 is as follows: Chain of Justice: 5'-CCGGGGTTCACCATTCCAGAATAAACTCGAGTTTATTCTGGAATGGTGAACCTTTTTG-3'; Antonym chain: 5'-AATTCAAAAAGGTTCACCATTCCAGAATAAACTCGAGTTTATTCTGGAATGGTGAACC-3'.

10. The use of the medicament according to claim 8 or 9 in the preparation of a medicament for treating colorectal cancer.

Images