Analysis of molecular markers for abdominal fat content in chicken and their application

Abstract

The application discloses a molecular marker for analyzing the content of chicken abdominal fat and application thereof, and the molecular marker is located at the position of 23,711,113 bp of chromosome 4, and the polymorphism is C / T; wherein the abdominal fat content of an individual with the CC genotype is less than that of an individual with the TC genotype, and the abdominal fat content of an individual with the TT genotype is less than that of an individual with the TC genotype; and the physical position information of the molecular marker is determined based on sequence alignment of a Beijing oil chicken reference genome GRCg7b sequence.The application has the advantages that, compared with traditional breeding techniques, excellent individuals can be identified and molecular assisted selection can be carried out in an early stage, thereby providing a molecular basis for precise genetic improvement of poultry lipid metabolism traits.The application is helpful to improve excessive deposition of abdominal fat, improve feed utilization efficiency and production performance, shorten a breeding cycle and accelerate a genetic improvement process.

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, specifically to molecular markers for analyzing the level of abdominal fat in chickens and their applications. Background Technology

[0002] Chicken meat is a significant source of animal protein globally. Abdominal fat in broilers, as the primary fat deposition tissue, directly impacts feed conversion efficiency, carcass quality, and reproductive performance, making it a crucial economic trait for evaluating broiler production performance. The Beijing You Chicken, a high-quality local breed in my country, possesses excellent meat quality, unique flavor, and abundant genetic resources, making it of significant breeding value in commercial production and germplasm resource utilization.

[0003] In recent years, with the improvement of intensive farming, the problem of excessive abdominal fat deposition in poultry has become increasingly prominent. Excessive abdominal fat deposition not only reduces feed utilization efficiency but may also affect the body's energy distribution balance, thus adversely impacting growth and reproductive performance, and has become a major bottleneck restricting high-efficiency broiler production. Therefore, precise genetic regulation and improvement of abdominal fat traits have significant industrial implications.

[0004] Currently, traditional chicken breeding methods mainly rely on pedigree recording and phenotypic selection. This involves measuring indicators such as abdominal fat weight or content in individuals or their relatives, combined with genetic evaluation models, for selection and mating. While this method was effective in the early stages of breeding, the accuracy of selection has declined due to factors such as the lag in phenotypic measurement, significant environmental influences, and the gradual slowdown in genetic progress. This makes it difficult to meet the needs of modern broiler breeding for rapid and precise genetic improvement of abdominal fat deposition traits.

[0005] With the development of molecular biology and genomics, marker-assisted selection (MAS) technology, by utilizing molecular markers associated with target traits (such as single nucleotide polymorphisms, SNPs), can predict genetic potential and directly select for superior genotypes in early stages of an individual's development, thereby significantly improving selection efficiency and accelerating genetic progress. Building on this, the development of genome-wide association studies (GWAS) and multi-omics technologies has further advanced the elucidation of the genetic mechanisms of complex quantitative traits.

[0006] Currently, studies using GWAS, transcriptomics, and lipidomics have identified candidate genes and molecular markers associated with abdominal fat deposition in poultry, providing a foundation for genetic improvement of abdominal fat traits. However, existing research largely focuses on macroscopic phenotypic levels such as abdominal fat weight or content. Research on genetic regulatory markers at the lipid molecular level (especially the relative content of specific triglyceride components, such as TG(18:0 / 16:2 / 20:2)) remains relatively insufficient, and a stable, reproducible, and verifiable functional SNP molecular marker system is lacking. Therefore, there is an urgent need to develop SNP molecular markers and their application methods that are significantly correlated with the relative content of specific lipid components TG(18:0 / 16:2 / 20:2) in the abdominal fat of Beijing Youji chickens. This would enable precise genetic regulation and molecular-assisted selection of abdominal fat deposition traits at the lipid molecular level, providing a new molecular basis for efficient genetic improvement of abdominal fat traits in Beijing Youji chickens. Summary of the Invention

[0007] To overcome the shortcomings and disadvantages of the prior art, the present invention provides the application of molecular markers in the analysis of the abdominal fat content of chickens. The molecular markers are located at position 23,711,113 bp on chromosome 4 and have a polymorphism of C / T. Among them, the abdominal fat content of individuals with CC genotype is < that of individuals with TC genotype is < that of individuals with TT genotype. The physical location information of the molecular markers was determined based on sequence alignment of the Beijing Oil Chicken reference genome GRCg7b.

[0008] Furthermore, the molecular marker is related to the relative content of triglycerides in chicken abdominal fat, that is, the relative content of triglycerides in abdominal fat of CC genotype individuals > TC genotype individuals > TT genotype individuals; the relative content of triglycerides is negatively correlated with the content of chicken abdominal fat, and the triglycerides are TG (18:0 / 16:2 / 20:2), which are triglyceride molecules containing three fatty acid residues of 18:0, 16:2 and 20:2.

[0009] Furthermore, the present invention also discloses the nucleotide sequences of the molecular marker as shown in SEQ ID NO.1-SEQ ID NO.2.

[0010] Furthermore, the present invention also provides detection primers for analyzing the level of abdominal fat in chickens, the detection primers being used to detect the molecular marker, and their nucleotide sequences being shown in SEQ ID NO. 3-4.

[0011] Furthermore, the present invention also provides a molecular probe combination for analyzing the level of abdominal fat in chickens, the molecular probe combination being used to detect the molecular marker.

[0012] Furthermore, the present invention also provides a molecular chip for analyzing the level of abdominal fat in chickens, the molecular chip comprising the above-mentioned primers and / or the above-mentioned molecular probe combination.

[0013] Furthermore, the present invention also provides KASP for analyzing the level of abdominal fat in chickens, used to detect the molecular marker.

[0014] Furthermore, the present invention also provides a kit for analyzing the level of abdominal fat in chickens, including the above-mentioned primers, and / or the above-mentioned molecular probe combination, and / or the above-mentioned molecular chip, and / or the above-mentioned KASP.

[0015] This invention also provides a method for analyzing the abdominal fat content of chickens. The method uses the above-mentioned primer and / or molecular probe combination and / or molecular chip and / or KASP and / or kit to detect the genotype at the 23,711,113bp position on chromosome 4. If the genotype is CC, the individual is determined to have low abdominal fat content.

[0016] This invention further provides applications of the above-mentioned molecular markers, primers, probe combinations, molecular chips, KASP, and reagent kits, in the following applications (A1)-A7): A1) Used as an auxiliary identification of the relative content of triglycerides and / or the level of abdominal fat in chicken abdominal fat; A2) Used for early screening of individuals with dominant relative triglyceride content and / or abdominal fat content in chicken abdominal fat; A3) Molecular marker-assisted selection for individuals with a dominant relative content of triglycerides in abdominal fat and / or abdominal fat content in chicken breeding populations; A4) Used for the identification and screening of superior germplasm of relative triglyceride content and / or abdominal fat content in chicken abdominal fat in chicken breed resources; A5) Used to develop new strains / breeds of chickens with superior triglyceride content and / or abdominal fat content in abdominal fat; A6) Used for genotyping and detection of relative triglyceride content and / or abdominal fat content in chicken abdominal fat; A7) is used to construct a molecular breeding screening system for the relative content of triglycerides in high abdominal fat and / or low abdominal fat in chickens.

[0017] Compared with the prior art, the present invention has the following advantages and beneficial effects: This invention utilizes a method to detect the bases at the g.23,711,113T>C polymorphism site on chromosome 4 of the chicken reference genome GRCg7b, identifying the SNP genotype of individual Beijing Youji chickens. This allows for graded screening of the relative TG (18:0 / 16:2 / 20:2) content in abdominal fat, thereby obtaining superior individuals with the target lipid phenotype. This invention enables early molecular-level screening of Beijing Youji chickens, overcoming the technical limitations of traditional methods that make it difficult to directly measure abdominal fat lipid traits in vivo, thus improving selection efficiency and reducing breeding costs. Furthermore, this method, based on single nucleotide polymorphism markers, offers advantages such as ease of operation, low detection cost, and scalable automated analysis. It is suitable for large-scale molecular marker-assisted selection breeding systems and shows promising application prospects in the genetic improvement of lipid metabolic traits in Beijing Youji chickens.

[0018] (1) This invention identifies molecular markers significantly associated with the relative content of abdominal fat TG (18:0 / 16:2 / 20:2) on chromosome 4 of Beijing Youji chickens through genome-wide association study (GWAS), and constructs a molecular marker-assisted selection breeding system based on these markers. This method enables early molecular-level evaluation and individual screening of the relative content of abdominal fat TG (18:0 / 16:2 / 20:2) in Beijing Youji chickens, improving selection accuracy and accelerating the genetic improvement process, thereby providing technical support for targeted breeding of lipid metabolism traits in Beijing Youji chickens. Compared with traditional breeding methods based on phenotypic determination, this invention reduces the dependence on in vivo phenotypic determination, lowers the detection cost in the breeding process, and improves selection efficiency, demonstrating good application value in the molecular breeding practice of Beijing Youji chickens.

[0019] (2) This invention provides a primer pair and kit for detecting SNP molecular markers located on chromosome 4 of Beijing Youji chickens that are related to the relative content of abdominal fat TG (18:0 / 16:2 / 20:2). Using the primer pair and kit, an efficient and accurate marker-assisted selection system can be constructed, enabling early molecular detection and individual screening of lipid metabolism-related traits in abdominal fat of Beijing Youji chickens. This method can be used for the genetic improvement of Beijing Youji chicken breeding populations. By genotyping the target SNP loci, superior genotype individuals can be screened and utilized, thereby improving breeding selection efficiency and accelerating genetic progress. Compared with traditional phenotypic-based breeding methods, this invention reduces reliance on in vivo phenotypic testing, improves selection accuracy, and has the advantages of simple operation, high detection efficiency, and applicability to large-scale molecular detection. It has good application value in the field of molecular breeding of Beijing Youji chickens.

[0020] (3) This invention constructs a marker-assisted selection breeding method for Beijing Youji chickens by selecting the dominant allele (C) of the target SNP molecular marker, which can achieve targeted genetic improvement of the relative content of abdominal fat TG (18:0 / 16:2 / 20:2) in Beijing Youji chickens. This method can accelerate the genetic progress of Beijing Youji chickens, improve selection efficiency, and shorten the breeding cycle, thus providing effective technical support for molecular breeding of lipid metabolism traits in Beijing Youji chickens. Attached Figure Description

[0021] Figure 1 A genome-wide association analysis (GWAS) results of the relative TG (18:0 / 16:2 / 20:2) content in the abdominal fat of Beijing You chicken; Figure 2 This is a phenotypic diagram of the relative TG (18:0 / 16:2 / 20:2) content in abdominal fat of different genotypes at the g.23711113C / T locus on chromosome 4 of Beijing Oil Chicken. This indicates that p < 0.05. This indicates that p < 0.01. This indicates that p < 0.001; Figure 3 The image shows the sequencing results of the sequence near the g.23711113C / T polymorphic site on chromosome 4 of the reference genome GRCg7b of individual Beijing You chickens with TT, TC, and CC genotypes. Detailed Implementation

[0022] The present invention will be further illustrated below with reference to a detailed description of specific embodiments. However, these embodiments are merely illustrative and should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and can be referred to the third edition of the original book "Bioinformatics and Functional Genomics" or related books. The bioinformatics software and products used are also commercially available. Various processes and methods not described in detail are conventional methods known in the art. The source of materials used, trade names, and components that need to be listed are indicated upon their first appearance. Unless otherwise specified, the same reagents used thereafter are considered the same as those initially indicated.

[0023] The features and advantages described in the molecular marker section above also apply to molecular probe assemblies, gene chips, kits, and their applications based on molecular markers, and will not be repeated here.

[0024] The SNP referred to in this invention is Single Nucleotide Polymorphism, which mainly refers to DNA sequence polymorphism caused by a single nucleotide variation at the genomic level. The single nucleotide variation includes variations caused by a single base conversion, transversion, insertion, or deletion.

[0025] It should be noted that the molecular markers referred to in this invention are all heritable and detectable DNA sequences or proteins, including but not limited to molecular markers based on molecular hybridization, such as RFLP and Minisatellite DNA; molecular markers based on PCR technology, such as RAPD, STS, SSR, and SCAR; DNA markers based on restriction enzyme digestion and PCR technology; molecular markers based on DNA microarray technology, such as SNP; and analytical marker technologies developed based on EST databases. The molecular markers provided by this invention can be used for genome mapping, gene localization studies, map-based gene cloning, species phylogenetics, and systematic classification.

[0026] Example 1: Obtaining Molecular Markers I. Sample Collection, Phenotypic Determination, and Association Analysis Experimental group: The Beijing Oil Chicken breed was selected from the Changping Base of the Institute of Animal Science, Chinese Academy of Agricultural Sciences, and all individuals were bred under standardized feeding conditions.

[0027] Sample collection: 291 female Beijing Youji chickens and 317 male Beijing Youji chickens, totaling 608 individuals, were sampled from the wing veins. 2 mL of whole blood was collected from each chicken, aliquoted into EDTA anticoagulant tubes, and stored at -20℃ for later use.

[0028] Phenotypic determination: After slaughter, each Beijing You chicken was dissected and its abdominal fat weight and eviscerated weight were measured, and relevant phenotypic data were recorded. At the same time, abdominal fat tissue samples were collected in 1.5ml cryovials and stored at -80℃ for later use. The relative content levels of TG (18:0 / 16:2 / 20:2) were determined using a broad-target lipidomics method and used for subsequent statistical analysis. After removing missing values ​​from the phenotypic data, data from 595 Beijing Oil Chickens of the same age were retained from 608 individuals. Broad-target lipidomics was used for detection, and peak areas of 903 lipid metabolites were obtained through peak extraction and quality control correction. Pearson correlation analysis was performed on each metabolite and abdominal fat traits using the paired complete observation method. The results showed that TG (18:0 / 16:2 / 20:2) was significantly negatively correlated with both abdominal fat weight and abdominal fat content (r = -0.313, p<0.001; r = -0.332, p<0.001), suggesting that an increase in this relative content is accompanied by a decrease in abdominal fat deposition.

[0029] II. Whole Genome Sequencing and Variation Detection Genomic DNA was extracted from whole blood of Beijing Oil chickens. Blood was collected from the wing vein of each chicken at 120 days of age. Agarose gel electrophoresis was then used to analyze the degree of DNA degradation and the presence of RNA, protein, and other contaminants. The DNA concentration was precisely quantified using Qubit 2.0. Resequencing libraries were constructed from the quality-controlled DNA using the GenoBaits® DNA Library Prep Kit. After library construction, the library concentration was initially quantified using Qubit 2.0, and then the effective concentration was precisely quantified using qPCR to ensure library quality. The quality-controlled libraries were sequenced using the BGI DNBSEQ-T7 sequencing platform in PE150 mode. Raw reads were filtered using the FastP software (version: 0.20.0, parameters: -n10 -q 20 -u 40). The filtered data were compared with the 7th edition of the domestic chicken genome (Genomeassembly bGalGal1.mat.broiler.GRCg7b). The quality-controlled sequencing sequences were aligned to the chicken reference genome using BWA software (version: 0.7.17-r1188). The alignment results were then sorted using the Sort module in Sentieon software (version: sentieon-genomics-202503), and the LocusCollector and Dedup modules were used to identify and remove PCR repetitive sequences to obtain high-quality alignment results. Based on this, variant detection was performed to obtain SNP loci. Finally, SNP information was annotated according to their location within the genome using ANNOVAR software (version: 2013Jul28). The SNP data were quality-controlled using plink software (version: v1.9.0-b.8, 64-bit, parameters: --geno 0.1 --mind 0.1 --maf 0.05 --hwe1e-6), ultimately yielding 5,570,873 SNPs.

[0030] III. Genome-wide association analysis Phenotypic data of abdominal fat TG (18:0 / 16:2 / 20:2) relative content and genotyping data were combined and performed after Log2 transformation. The results were then inversely transformed for phenotypic analysis. A mixed linear model (MLM) in EMMAX software was used to analyze the association between SNPs and metabolite phenotypes, considering the influence of population structure and phylogenetic relationships. Bonferroni correction was used to determine the genome-wide significance threshold for the association between SNPs and metabolites as 1.8 × 10⁻⁶. -9 The GWAS analysis results are as follows: Figure 1 As shown. From Figure 1 It was found that there are SNP loci on chromosome 4 of Beijing Oil Chicken that are significantly correlated with the relative content of abdominal fat TG (18:0 / 16:2 / 20:2), and the molecular marker SNP locus g.23711113T / C is significantly correlated with the relative content of abdominal fat TG (18:0 / 16:2 / 20:2). Significant phenotypic differences exist among different genotypes in the population, such as... Figure 2 As shown, this study included 580 valid individuals. This sample was derived from the initial 608 individuals, after excluding 17 individuals with missing phenotypic data and 11 individuals with missing genotypes at the target locus, and was used for subsequent statistical analysis. The relative content of TG (18:0 / 16:2 / 20:2) in the abdominal fat of Beijing You chickens was significantly higher in CC homozygous individuals than in TT homozygous individuals. The relative content of TG (18:0 / 16:2 / 20:2) in the abdominal fat of Beijing You chickens in heterozygous TC individuals was between that of the two homozygous individuals, showing a certain dose-response trend. These results indicate that this molecular marker is significantly associated with the relative content of TG (18:0 / 16:2 / 20:2) in the abdominal fat of Beijing You chickens, and can be used for marker-assisted selection breeding to improve this trait.

[0031] The nucleotide sequence of the SNP: CTACAAGAGACACGAAAGAGGAATCTTCTGTCTGTCACCTTGTTGAGGATTATAGGGATGTGTCATGAAAGACAGAGATCTCTTCCTGAACTCGTAGTGGTTTGAGGTAGCTTTATGAGATTTTGCTA(T / C)TT CTGAGCATGTCTGATTTTTGCCTGGACAATTCTACTCTATTCTTGAAGGAAAGAACTTTTTGCCTGAGCTATCAACCAACCTGAAAGAGTTTGGAAATGAAAGAAGCATAGCAACAGGCATTGCTGGTGTTTATTGTTTGAGTG(SEQ ID NO.1 or SEQ ID NO.2).

[0032] Compared to existing conventional molecular marker mining methods, this invention does not obviously obtain a single associated SNP locus based on the association between phenotype and gene. Instead, it uses large-scale population whole-genome variation detection to initially screen 5,570,873 SNP variant loci. Then, combined with phenotypic data, and through multiple quality control and association analysis, it uniquely identifies the g.23711113T / C major SNP locus, which is highly significantly associated with the relative content of abdominal fat TG (18:0 / 16:2 / 20:2), from a massive number of genomic variant loci. This process requires comparing, verifying associations, and screening millions of variant loci one by one. It cannot be easily obtained through conventional simple experiments in this field. It involves a great deal of creative labor in screening, evaluation, and data analysis, which cannot be obviously obtained by existing technologies.

[0033] According to the present invention, based on the SNP molecular markers that are closely related to the relative content of TG (18:0 / 16:2 / 20:2) in the abdominal fat of Beijing You chickens obtained through screening, and with the matching specific detection primers and kits, the provided SNP molecular markers can be used as genetic screening markers for lipid deposition-related metabolic phenotypes in the abdominal fat of Beijing You chickens. Since the content of abdominal fat is negatively correlated with the relative content of triglycerides in the abdominal fat, the polymorphism at position 23,711,113 bp on chromosome 4 was detected as C / T. Among them, the relative content of triglycerides in the abdominal fat of individuals with the CC genotype is > that of individuals with the TC genotype is > that of individuals with the TT genotype. This can be used to determine the level of abdominal fat content in the sample to be tested, that is, the abdominal fat content of individuals with the CC genotype is < that of individuals with the TC genotype is < that of individuals with the TT genotype. This technology can then be used for early identification of superior individuals and molecular-assisted selection, thereby providing a molecular basis for the precise genetic improvement of lipid metabolism traits in poultry. It helps to improve the problem of excessive abdominal fat deposition, improve feed utilization efficiency and production performance, shorten the breeding cycle and accelerate the genetic improvement process, significantly reduce breeding input and improve the economic benefits of breeding. It has high practical application value in the screening of Beijing Oil Chicken germplasm and the development of new strains.

[0034] Example 2: Application of the SNP obtained by this invention (1) Based on the resequencing data of 608 Beijing You chickens, three Beijing You chickens with different genotypes TT, TC and CC at the g.23711113T / C site on chromosome 4 were selected, and their blood cell genomic DNA was extracted for SNP verification.

[0035] 2) Primer design and synthesis: Based on the chicken reference genome GRCg7b sequence, the following primers were designed and synthesized. U (upstream primer): 5' CTACAAGAGACACGAAAGAGGAATC 3' (SEQ ID No. 3); D (downstream primer): 5' CACTCAAACAATAAACACCAGCAAT 3' (SEQ ID No. 4).

[0036] (3) PCR amplification: Using the genomic DNA of the three Beijing Oil Chickens obtained in step (1) as templates, PCR amplification was performed with U and D as primers to obtain PCR amplification products, which were named products 1, 2 and 3 respectively.

[0037] PCR amplification system: 100ng genomic DNA, 25µL Green Taq Mix, 200nm each of forward and reverse primers, and ddH2O to make up to 50µL.

[0038] PCR amplification program: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 62℃ annealing for 15 seconds, 72℃ extension for 60 seconds, for a total of 35 cycles; final extension at 72℃ for 5 minutes.

[0039] (4) Sequencing and sequence analysis: Products 1, 2, and 3 were sequenced, yielding their sequences. The three product sequences differed by only one base, located at position 129 from the 5' end of each sequence. This position contained an M(T / C) mutation. Figure 3 As shown in the sequencing results below: CTACAAGAGACACGAAAGAGGAATCTTCTGTCTGTCACCTTGTTGAGGATTATAGGGATGTGTCATGAAAGACAGAGATCTCTTCCTGAACTCGTAGTGGTTTGAGGTAGCTTTATGAGATTTTGCTA(T / C)TTCTGAG CATGTCTGATTTTTGCCTGGACAATTCTACTCTATTCTTGAAGGAAAGAACTTTTTGCCTGAGCTATCAACCAACCTGAAAGAGTTTGGAAATGAAAGAAGCATAGCAACAGGCATTGCTGGTGTTTATTGTTTGAGTG.

[0040] Using the phenotypic determination method of Example 1, the relative content of TG (18:0 / 16:2 / 20:2) in the abdominal fat of Beijing Youji chickens was 12,024,467 in TT-type individuals, 13,093,342 in TC-type individuals, and 13,952,443 in CC-type individuals. This demonstrates that the SNP obtained in this invention is significantly correlated with the relative content of TG (18:0 / 16:2 / 20:2) in the abdominal fat of Beijing Youji chickens. Furthermore, the relative content of TG (18:0 / 16:2 / 20:2) in homozygous CC-type individuals is higher than that in homozygous TT-type individuals, while the relative content in heterozygous TC-type individuals falls between the two groups. Using the SNP loci of this invention, the level of TG content in the abdominal fat of Beijing Youji chickens can be quickly determined. Since the TG content in abdominal fat is negatively correlated with the total abdominal fat content, the level of abdominal fat content can be quickly determined, allowing for the screening of dominant individuals.

[0041] Example 3: Industrial Application of the SNP of the Invention Based on the SNP sites associated with the relative content of TG (18:0 / 16:2 / 20:2) in the abdominal fat of Beijing oil chickens screened in Example 1 of this invention, and the specific amplification primers designed in Example 2, molecular probes, SNP gene chips, KASP genotyping reagents, and detection kits for identifying the trait associated with the relative content of TG (18:0 / 16:2 / 20:2) in the abdominal fat of Beijing oil chickens can be industrially prepared using existing conventional and mature technologies in the field. Specifically, based on the upstream and downstream specific sequences of the SNP sites, site-specific fluorescent probes are synthesized according to conventional probe synthesis processes; the SNP probes are immobilized on a solid-phase carrier, and an SNP detection chip is prepared using existing chip fabrication processes; based on the allelic differences of the SNP sites, specific KASP primer combinations are designed and assembled into KASP genotyping reagents according to conventional processes; then, the specific amplification primers, reaction buffer, polymerase, dNTPs, and chromogenic reagents are packaged according to conventional proportions to obtain the matching detection kit.

[0042] The above-mentioned molecular probes, chips, KASP reagents or kits were used to detect the genotypes related to the relative content of abdominal fat TG (18:0 / 16:2 / 20:2) in Beijing Oil chickens. The steps included: (1) collecting blood or tissue samples from the chickens to be tested and extracting genomic DNA as template DNA; (2) using the specific primers of this invention to perform PCR amplification on the template DNA to obtain PCR amplification products (amplification procedure as in Example 2); (3) performing sequencing, chip hybridization or KASP fluorescence typing detection on the PCR amplification products; (4) determining the genotype of the individual to be tested at the SNP site based on the sequencing results, chip hybridization signals or fluorescence typing results. Based on the genotype, the genotype can be evaluated. Since the relative content of TG (18:0 / 16:2 / 20:2) is significantly negatively correlated with the abdominal fat phenotype, individuals with high relative content of abdominal fat TG (18:0 / 16:2 / 20:2) in Beijing Oil chickens can be screened and used as markers to screen individuals with low abdominal fat content.

[0043] Therefore, the SNPs, detection primers, probes, and chips of this invention can be used for the auxiliary identification of the relative content of abdominal fat TG (18:0 / 16:2 / 20:2) and / or abdominal fat content in Beijing You chickens; early screening of individuals with high or low relative abdominal fat TG (18:0 / 16:2 / 20:2) content in Beijing You chickens; molecular marker-assisted breeding of individuals with high or low relative abdominal fat TG (18:0 / 16:2 / 20:2) content in chicken breeding populations; identification and screening of germplasm with high or low relative abdominal fat TG (18:0 / 16:2 / 20:2) content in chicken breed resources; breeding new strains / breeds of chickens with high or low relative abdominal fat TG (18:0 / 16:2 / 20:2) content and / or low abdominal fat content; and the identification and screening of chickens with high or low relative abdominal fat TG (18:0 / 16:2 / 20:2) content in chickens. This system enables genotyping and classification of relative TG (18:0 / 16:2 / 20:2) content and / or abdominal fat content in chickens, as well as the construction of a molecular breeding screening system for high relative TG content (18:0 / 16:2 / 20:2) and low abdominal fat content. It covers all aspects of chicken breeding, from identification, detection, and screening of relative TG (18:0 / 16:2 / 20:2) content and / or abdominal fat content traits, to assisted breeding, germplasm evaluation, variety development, and molecular breeding applications.

[0044] The above description is merely a preferred embodiment to aid in understanding the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and variations. Any alterations or modifications made by those skilled in the art based on this description without departing from the spirit of the present invention should also fall within the scope of the present invention.

Claims

1. The application of molecular markers in analyzing the level of abdominal fat in chickens, characterized in that, The molecular marker is located at position 23,711,113 bp on chromosome 4, and its polymorphism is C / T. Among them, the abdominal fat content of individuals with CC genotype is < that of individuals with TC genotype is < that of individuals with TT genotype. The physical location information of the molecular markers was determined based on sequence alignment of the Beijing Oil Chicken reference genome GRCg7b.

2. The application according to claim 1, characterized in that, The molecular markers were correlated with the relative triglyceride content in the abdominal fat of chickens, specifically, the relative triglyceride content in the abdominal fat of CC genotype individuals was > that of TC genotype individuals > that of TT genotype individuals. The relative content of triglycerides was negatively correlated with the content of abdominal fat in chickens; The triglyceride is TG (18:0 / 16:2 / 20:2).

3. The application according to claim 1 or 2, characterized in that, The nucleotide sequences of the molecular marker are shown in SEQ ID NO.1-SEQ ID NO.

2.

4. Primers for analyzing the level of abdominal fat in chickens, characterized in that, The detection primers are used to detect the molecular marker, and their nucleotide sequences are shown in SEQ ID NO.3-4.

5. A molecular probe combination for analyzing the level of abdominal fat in chickens, characterized in that, The molecular probe array is used to detect the molecular marker.

6. A molecular chip for analyzing the fat content in chicken abdominal cavity, characterized in that, The molecular chip includes the primers as described in claim 4, and / or The molecular probe assembly as described in claim 5.

7. KASP for analyzing the fat content of chicken abdominal tissue, characterized in that, Used to detect the molecular marker.

8. A kit for analyzing the content of abdominal fat in chickens, characterized in that, Including the primers as described in claim 4, and / or The molecular probe assembly of claim 5, and / or The molecular chip according to claim 6, and / or The KASP as described in claim 7.

9. A method for analyzing the fat content in chicken abdominal cavity, characterized in that, Using the primers of claim 4, and / or the molecular probe combination of claim 5, and / or the molecular chip of claim 6, and / or the KASP of claim 7, and / or the kit of claim 8, the sample to be tested is detected to detect the genotype at position 23,711,113 bp on chromosome 4. If the genotype CC is detected, the individual is determined to have low abdominal fat content.

10. The molecular marker of claim 1, the detection primer of claim 4, the molecular probe combination of claim 5, the molecular chip of claim 6, the KASP of claim 7, or the kit of claim 8, in the following A1)-A7): A1) Used as an auxiliary identification of the relative content of triglycerides and / or the level of abdominal fat in chicken abdominal fat; A2) Used for early screening of individuals with dominant relative triglyceride content and / or abdominal fat content in chicken abdominal fat; A3) Molecular marker-assisted selection for individuals with a dominant relative content of triglycerides in abdominal fat and / or abdominal fat content in chicken breeding populations; A4) Used for the identification and screening of superior germplasm of relative triglyceride content and / or abdominal fat content in chicken abdominal fat in chicken breed resources; A5) Used to develop new strains / breeds of chickens with superior triglyceride content and / or abdominal fat content in abdominal fat; A6) Used for genotyping and detection of relative triglyceride content and / or abdominal fat content in chicken abdominal fat; A7) is used to construct a molecular breeding screening system for chickens with high abdominal fat content and / or low abdominal fat content.

Images