Primers and probes for distinguishing between leaf and sugar beets and use thereof

Abstract

The application provides a primer and a probe for distinguishing leaf sugar beet and sugar beet and application thereof, and belongs to the technical field of molecular biology. The primer is 60k-F and 60k-R. The nucleotide sequence of the probe is [5'FAM]-ACAAACAATAGATTCATGAATTCTATTCCA(THF)TGTATAGAATTCATG-[3'C3spacer]. The primer and the probe are used for distinguishing or identifying leaf sugar beet and sugar beet. The application can be applied to RPA and other molecular biology methods to detect leaf tissue of leaf sugar beet and sugar beet, and molecular identification can be realized through whether a fluorescent signal exists or not, so that leaf sugar beet and sugar beet can be reliably and effectively distinguished.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to primers and probes for distinguishing between leaf beets and sugar beets and their applications. Background Technology

[0002] Molecular markers for leaf beets and sugar beets are urgently needed: although they share the same origin (Beta vulgaris subsp. vulgaris), their economic goals are drastically different—leaf beets aim for maximum biomass, while sugar beets focus on sucrose accumulation. Due to their highly similar seedling morphology and genetic similarity, production faces challenges such as seed mixing, misplanting and misharvesting (leaf beet seedlings mixed into sugar fields leading to decreased sugar content), and conflicts in disease management (leaf beets are susceptible to root rot strains, while sugar beets are highly resistant, and mixing accelerates pathogen evolution). By developing specific molecular markers targeting specific sequences, combined with RPA isothermal rapid detection technology, precise seedling sorting can be achieved (avoiding misplanting), ensuring seed purity, and targeted agronomic regulation. This fundamentally prevents significant economic losses in the industry chain caused by variety confusion. The technology is highly mature and has significant patent protection value.

[0003] Molecular identification technology is a technique for identifying biological genome differences at the molecular level. Compared with the subjectivity and complexity of traditional morphological identification, molecular identification technology can make the differences between species observable and simplified in the form of sequence data, so as to obtain more reliable identification results more efficiently.

[0004] Chloroplast genome (cpDNA) molecular markers are of great significance in plant science, particularly in phylogeny, evolutionary biology, species identification, population genetics, ecology, and conservation biology. The chloroplast genome is typically a single circular molecule, ranging in size from 120 to 160 kb, containing a series of genes encoding photosynthesis, electron transport, and other biosynthetic pathways. It exhibits high genetic stability, low recombination rate, and maternally inherited characteristics. These characteristics make the chloroplast genome a highly efficient and reliable molecular marker, providing high-resolution information, especially suitable for analyzing distantly related plants and assessing population structure, gene flow, and historical dynamics. By comparing the chloroplast genomes of different species or populations, researchers can gain a deeper understanding of how plants adapt to various ecological environments and the underlying evolutionary mechanisms, thus providing a scientific basis for biodiversity conservation and sustainable utilization. Summary of the Invention

[0005] To address the aforementioned issues, this invention analyzes chloroplast genome sequencing data of leaf beets and sugar beets, screens for specific molecular markers, and designs DNA molecular probes that can be used to distinguish between leaf beets and sugar beets. This provides primers and probes for distinguishing between leaf beets and sugar beets, as well as their applications.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A primer and probe for distinguishing between leaf beet and sugar beet, wherein the primers are 60k-F and 60k-R; The nucleotide sequence of the primer 60k-F is shown in SEQ ID NO: 1; The nucleotide sequence of primer 60k-R is shown in SEQ ID NO: 2; The nucleotide sequence of the probe is [5'FAM]-ACAAACAATAGATTCATGAATTCTATTCCA(THF)TGTATAGAATTCATG-[3'C3spacer].

[0007] An application of the above-mentioned primers and probes, wherein the primers and probes are used to distinguish or identify leaf beets and sugar beets.

[0008] A kit for distinguishing between leaf beets and sugar beets, the kit comprising the aforementioned primers and probes.

[0009] Furthermore, the kit includes primer 60k-F, primer 60k-R, the probe, reacting buffer, E mix, and P mix.

[0010] Furthermore, the kit also includes nucleic acid test strips.

[0011] A method for distinguishing between leaf beet and sugar beet, wherein the method utilizes the aforementioned primers and probes to amplify the DNA of the sample to be tested in order to distinguish or identify leaf beet and sugar beet; Alternatively, the method involves using the aforementioned kit to amplify the DNA of the sample to be tested in order to distinguish or identify leaf beets and sugar beets.

[0012] Furthermore, the method includes the following specific steps: DNA is extracted from the sample to be tested to obtain template DNA; The template DNA was amplified using the primers and probes described above to obtain the amplification product. The amplification product was tested using a nucleic acid test strip to determine whether the sample was leaf beet or sugar beet. When both the control line (C) and the test line (T) show bands, the sample to be tested is sugar beet; When only the control line (C) shows a band but the test line (T) shows no band, the sample to be tested is leaf beet.

[0013] Furthermore, the method includes the following specific steps: DNA is extracted from the sample to be tested to obtain template DNA; The template DNA was amplified using the kit described above to obtain the amplification product. The amplification product was tested using a nucleic acid test strip to determine whether the sample was leaf beet or sugar beet. When both the control line (C) and the test line (T) show bands, the sample to be tested is sugar beet; When only the control line (C) shows a band but the test line (T) shows no band, the sample to be tested is leaf beet.

[0014] Furthermore, the amplification system includes: primer 60k-F, primer 60k-R, probe, DNA of the sample to be tested, reacting buffer, E mix, P mix, and water.

[0015] Furthermore, the amplification temperature was 40℃ and the time was 30 min.

[0016] The beneficial effects of the primers and probes of the present invention for distinguishing between leaf beets and sugar beets, and their applications, are as follows: Based on the alignment results of the chloroplast genomes of sugar beets and leaf beets, we discovered a differential site in a 60kbp region. This site can be used to distinguish between sugar beets and leaf beets, making it an ideal site for molecular markers. We extracted approximately 200bp of sequences upstream and downstream of the differential site as references and designed primers based on these homologous sequences. Using DNA from both sugar beets and leaf beets as templates, PCR amplification was performed. Both amplified a single, bright band of the expected size, proving that the differential site fragment obtained from the chloroplast genome sequence analysis exists and can be amplified and subsequently identified. The PCR amplification products were subjected to Sanger sequencing, and the sequencing results were compared. The comparison results showed that there was a 7bp differential site in sugar beet that could distinguish sugar beet from leaf beet. Based on this site, an oligonucleotide fluorescent probe was designed, which can be used to detect sugar beet and leaf beet leaf tissues by molecular biology methods such as RPA (Recombinase Polymerase Amplification). The presence or absence of fluorescent signal can be used to identify them molecularly, thus reliably and effectively distinguishing sugar beet from leaf beet. This invention develops primers and probes for distinguishing between leaf beets and sugar beets. Using these primers and probes, leaf beets and sugar beets can be accurately and efficiently distinguished, greatly improving the identification and management efficiency of sugar beets, effectively controlling the damage caused by leaf beets, and having extremely high economic value. Attached Figure Description

[0017] Figure 1This is the comparison result of chloroplasts of leaf beet and sugar beet in Example 1 of the present invention; where yesiancai is leaf beet and kws7748 is sugar beet, and the gene sequence difference site between the two is the position marked at 60kbp in the figure; Figure 2 These are the electrophoretic bands of chloroplast genome molecular marker PCR amplification of leaf beet and sugar beet in Example 1 of the present invention; wherein, from left to right, the electrophoretic bands are Marker, sugar beet (i.e., band A), and leaf beet (i.e., band B), and the band size is approximately 400bp; Figure 3 This is a comparison of the sequencing results of the differential sites (60K) between leaf beet and sugar beet in Example 1 of the present invention (KWS7748 is sugar beet, and yesiancai is leaf beet). Figure 4 The results are the detection results of the single nucleic acid test strip in Example 2 of this invention on the DNA amplification products of leaf beet and sugar beet; wherein, KWS7748 is the detection result of sugar beet and yesiancai is the detection result of leaf beet. Detailed Implementation

[0018] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar extensions without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below. The present invention will be further described in detail below with reference to specific embodiments to enable those skilled in the art to understand it.

[0019] Experimental apparatus: High-speed refrigerated centrifuge: ThermoFisher, Micro 21R; Constant temperature water bath: Jinghong, DK-S24; Ultra-micro spectrophotometer: ThermoFisher, NanoDrop2000; PCR instrument: ThermoFisher, Applied Biosystems VeritiPro; Gel electrophoresis system: Liuyi, DYY-8C; Gel imaging system: VILBER, FUSION FX7; Experimental reagents: Plant genomic DNA extraction kit: Tiangen, DP305; 2 × Phanta Max Master Mix (DyePlus): Novizan, P525; D2000 molecular weight standard: Tiangen, MD114.

[0020] Example 1: Design of a molecular marker probe for distinguishing between leaf beets and sugar beets 1) Sample grinding: Leafy beet plant leaf tissue and sugar beet plant leaf tissue were ground into uniform powder using liquid nitrogen.

[0021] 2) DNA extraction: Following the instructions of the plant genomic DNA extraction kit, DNA was extracted from the leaf tissues of leaf beet and sugar beet plants respectively, and used as template DNA. The concentration of the corresponding DNA was then detected.

[0022] 3) Chloroplast Genome Acquisition: Based on existing data in public databases and samples preserved in our laboratory, we performed whole-genome sequencing of chloroplasts. After removing low-quality data, we assembled the clean reads to obtain relatively complete chloroplast genome data. We also sequenced the chloroplast genomes of leaf beets and sugar beets to obtain specific sequences.

[0023] 4) Sequence Alignment: The chloroplast genomes of leaf beet and sugar beet were aligned using MAFFT software. After aligning the chloroplast genome sequences of leaf beet and sugar beet, differentially expressed sites could be identified. Figure 1 As shown.

[0024] 5) PCR primer design: Based on the alignment results of the chloroplast genomes of leaf beet and sugar beet, differential sites that can distinguish between leaf beet and sugar beet were selected. The differential sites and their upstream and downstream sequences of about 200 bp were extracted to design primers (wherein, the differential sites of leaf beet and their upstream and downstream sequences of about 200 bp are shown in SEQ ID NO: 3, and the differential sites of sugar beet and their upstream and downstream sequences of about 200 bp are shown in SEQ ID NO: 4). PCR primers 60k-F (gtgactctgccgtgtattca, as shown in SEQ ID NO: 1) and 60k-R (tcagattgtttagtattccaccaattagt, as shown in SEQ ID NO: 2) were obtained and synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0025] 6) PCR amplification verification: Configure the PCR reaction system according to Table 1, set the PCR program according to Table 2, and perform PCR amplification on the template DNA of leaf beet and sugar beet to obtain the corresponding PCR products.

[0026] Table 1 PCR system

[0027] Table 2 PCR Procedure

[0028] 7) Gel electrophoresis: The band size of each PCR product was detected using 1.5% agarose gel electrophoresis. The results are as follows: Figure 2 As shown, the results indicate that PCR amplification of approximately 200 bp upstream and downstream of the differential site was performed, and the agarose gel electrophoresis results were as expected, indicating that the target fragment was amplified in both leaf beet and sugar beet.

[0029] 8) Sequencing and Sequence Alignment: PCR products with electrophoretic band sizes matching the expected results were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. DNAMAN was used to align differentially expressed sites in the chloroplast genomes of leaf beet and sugar beet. After amplifying fragments from leaf beet and sugar beet and sending them to Youkang Biotechnology for sequencing, DNAMAN was used to analyze the sequencing results, allowing for the screening of differentially expressed sites such as… Figure 3 As shown.

[0030] 9) Probe design: Following the probe design principle, an oligonucleotide probe of 45-50nt in length was designed at the specific site of the chloroplast genome of leaf beet. A FAM fluorescent group was labeled at the 5' end, and a C3-spacer was modified at the 3' end. A d-spacer (THF tetrahydrofuran) was inserted in the middle of the probe at a distance of more than 35nt from the 5' end.

[0031] Based on the sequence at the 60kbp differential site, fluorescent molecularly labeled oligonucleotide probes were designed, and the results are shown in Table 3.

[0032] Table 3. Fluorescent probe sequences based on specific sites

[0033] Example 2: Establishment of the detection kit and verification experiment for detecting leaf beet and sugar beet. 1) Kit: The kit for distinguishing between leaf beets and sugar beets includes: primers 60k-F / 60k-R, probe (TC-60K Based Probe), reacting buffer, E mix, P mix, water, and single nucleic acid test strip (AMP Future, WLFS8206). The nucleotide sequence of the probe (TC-60K Based Probe) is [5'FAM]-ACAAACAATAGATTCATGAATTCTATTCCA(THF)TGTATAGAATTCATG-[3'C3spacer].

[0034] Specifically, a FAM fluorescent group is labeled at the 5' end of the probe, and a C3-spacer is used to modify the 3' end. A d-spacer (THF tetrahydrofuran) is inserted at a distance of 35 nt from the 5' end in the middle of the probe. The single nucleic acid test strip has a control line (C line) in the quality control area and a test line (T line) in the detection area; one end of the nucleic acid test strip is equipped with a sample application pad.

[0035] 2) Verification Experiment 21) DNA extraction: Following the instructions of the plant genomic DNA extraction kit, DNA was extracted from the leaf tissues of leaf beet and sugar beet plants respectively, and used as template DNA. The concentration of the corresponding DNA was then detected.

[0036] 22) DNA Amplification: Using a kit including primers 60k-F / 60k-R and a probe (TC-60K Based Probe), prepare the amplification system according to the system in Table 4, using sterile water instead of DNA template as a negative control. After preparing the amplification system, add 2 μL of Starter, incubate in a 40℃ water bath for 30 min, and obtain the amplification product for later use.

[0037] Table 4. Sample DNA isothermal amplification system

[0038] 23) Single nucleic acid test strip detection: Take 10 μL of amplification product, dilute it 10-fold with Diluent buffer, and add it to the single nucleic acid test strip. After 5 minutes of chromatography reaction, check the test line (T) and control line (C). The results are as follows: Figure 4 As shown.

[0039] 24) Experimental results: Figure 4 The results of the single-strand nucleic acid test strips showed that bands appeared at the control line (C), indicating that the detection was effective. In this invention, the oligonucleotide fluorescent probe successfully bound to the DNA of sugar beet leaves, causing the fluorescein modifier to develop color and a band to appear at the detection line (T). However, the DNA of leaf beet leaves did not bind to the probe, resulting in no color development or band at the detection line (T). Based on the detection results, leaf beet and sugar beet can be distinguished using this molecularly labeled probe.

[0040] In practical applications, DNA is directly extracted from the sample to be tested, and DNA amplification is performed according to the above method. The amplified product is then detected using a nucleic acid test strip according to the above method to determine whether the sample is leaf beet or sugar beet.

[0041] 3) Summary: Based on the alignment results of the chloroplast genomes of sugar beets and leaf beets, we identified a differentially expressed site within a 60kbp region. This site is ideal for distinguishing between sugar beets and leaf beets, serving as a molecular marker. Approximately 200bp upstream and downstream of this differentially expressed site were extracted as references, and primers were designed based on these homologous sequences. PCR amplification was performed using DNA from both sugar beets and leaf beets as templates. Both amplified a single, bright band of the expected size, demonstrating the existence of the differentially expressed site fragment identified in the chloroplast genome sequence analysis and its suitability for amplification and subsequent identification.

[0042] Sanger sequencing was performed on the PCR amplification products, and the sequencing results were compared. The comparison results showed that there was a 7bp differential site in sugar beet that could distinguish sugar beet from leaf beet. Based on this site, an oligonucleotide fluorescent probe was designed, which can be used to detect sugar beet and leaf beet leaf tissues by molecular biology methods such as RPA (Recombinase Polymerase Amplification). The presence or absence of fluorescent signal can be used to achieve molecular identification, thus reliably and effectively distinguishing sugar beet from leaf beet.

[0043] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. Those skilled in the art can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer and probe for distinguishing between leaf beets and sugar beets, characterized in that, The primers are 60k-F and 60k-R; The nucleotide sequence of the primer 60k-F is shown in SEQ ID NO: 1; The nucleotide sequence of primer 60k-R is shown in SEQ ID NO: 2; The nucleotide sequence of the probe is [5'FAM]-ACAAACAATAGATTCATGAATTCTATTCCA(THF)TGTATAGAATTCATG-[3'C3spacer].

2. An application of the primer and probe according to claim 1, characterized in that, The primers and probes are used to distinguish or identify leaf beets and sugar beets.

3. A kit for distinguishing between leaf beets and sugar beets, characterized in that, The kit includes the primers and probes as described in claim 1.

4. The reagent kit according to claim 3, characterized in that, The kit includes primer 60k-F, primer 60k-R, the probe, reacting buffer, E mix, and P mix.

5. The kit according to claim 3 or 4, characterized in that, The kit also includes nucleic acid test strips.

6. A method for distinguishing between leaf beets and sugar beets, characterized in that, The method uses the primers and probes described in claim 1 to amplify the DNA of the sample to be tested, in order to distinguish or identify leaf beets and sugar beets. Alternatively, the method involves amplifying the DNA of the sample to be tested using the kit described in any one of claims 3-5 to distinguish or identify leaf beets and sugar beets.

7. The method for distinguishing between leaf beets and sugar beets according to claim 6, characterized in that, The method includes the following specific steps: DNA is extracted from the sample to be tested to obtain template DNA; The template DNA was amplified using the primers and probes described in claim 1 to obtain the amplification product. The amplification product was tested using a nucleic acid test strip to determine whether the sample was leaf beet or sugar beet. When both the control line (C) and the test line (T) show bands, the sample to be tested is sugar beet.

8. The method for distinguishing between leaf beets and sugar beets according to claim 6, characterized in that, The method includes the following specific steps: DNA is extracted from the sample to be tested to obtain template DNA; The template DNA was amplified using the kit described in any one of claims 3-5 to obtain the amplification product; The amplification product was tested using a nucleic acid test strip to determine whether the sample was leaf beet or sugar beet. When both the control line (C) and the test line (T) show bands, the sample to be tested is sugar beet.

9. The method for distinguishing between leaf beets and sugar beets according to any one of claims 6-8, characterized in that, The amplification system includes: primer 60k-F, primer 60k-R, probe, DNA of the sample to be tested, reacting buffer, E mix, P mix, and water.

10. The method for distinguishing between leaf beets and sugar beets according to any one of claims 6-8, characterized in that, The amplification temperature was 40℃ and the time was 30 min.

Images