A SNP molecular marker for identifying cold-tolerant upland cotton seedlings and application thereof

Abstract

The present application belongs to the field of molecular marker assisted breeding, and particularly relates to a SNP molecular marker for identifying cold-tolerant type of upland cotton at seedling stage and application thereof. The present application provides a KASP marker related to the cold-tolerant type of upland cotton at seedling stage, wherein the SNP molecular marker of the KASP marker is located at the 32,081,663th base of the Chr.A09 chromosome of the upland cotton genome, and the SNP polymorphism is A or G. The cold-tolerant type of the plant can be quickly and accurately identified at the seedling stage of the upland cotton, and the plant does not need to be subjected to low-temperature stress and normal-temperature recovery and subjected to phenotype observation, so that early screening of the upland cotton variety with the cold-tolerant type at the seedling stage is realized. The KASP marker is used for investigating the cold-tolerant type of large-scale upland cotton germplasm resources, and provides a molecular tool for genetic diversity research and excellent gene mining, improves breeding efficiency, and shortens the breeding period. Based on the KASP marker, a commercial detection kit is developed, which is suitable for the identification requirement of the cold-tolerant type of the upland cotton at the seedling stage of seed companies, breeding units and scientific research institutions, and has a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of marker-assisted breeding, specifically relating to an SNP molecular marker for identifying cold-resistant phenotypes in upland cotton seedlings and its application. Background Technology

[0002] Cold tolerance in upland cotton (Gossypium hirsutum L.) seedlings is an agronomical trait that determines the variety's stress resistance, adaptability, and yield stability. Breeding cold-tolerant seedlings has significant application value in improving seed vigor, survival rate, seedling uniformity, and early yield formation. Currently, screening for cotton cold tolerance mainly relies on phenotypic identification after low-temperature stress and recovery in plant culture chambers and artificial climate chambers, evaluating phenotypes and physiology by measuring survival rate, relative conductivity, and leaf damage area. These methods suffer from low screening throughput and delayed phenotypic identification. Furthermore, upland cotton seedling low-temperature stress phenotypic identification is greatly affected by environmental factors, making large-scale, accurate identification of cold-tolerant phenotypes in field environments difficult. To date, the lack of molecular markers for high-throughput detection of seedling cold tolerance has resulted in slow and lengthy breeding processes for cold-tolerant materials. There is an urgent need to develop an effective SNP molecular marker associated with cold tolerance in upland cotton. Summary of the Invention

[0003] The purpose of this invention is to help solve the problems existing in traditional cold-resistant breeding by providing an SNP molecular marker for identifying cold-resistant phenotypes in upland cotton seedlings and its application. This invention utilizes a competitive allele-specific PCR (KASP, Kompetitive Allele Specific Polymerase Chain Reaction) molecular marker technology based on single nucleotide polymorphisms (SNPs) to achieve early and accurate prediction of cold-resistant phenotypes in cotton seedlings, thereby shortening the breeding cycle and providing technical support for cultivating new cotton varieties that are cold-resistant and suitable for early sowing. It allows for rapid, accurate, and wide-ranging differentiation of cold-resistant phenotypes in upland cotton seedlings.

[0004] To achieve the above objectives, the technical solution of the present invention is as follows:

[0005] This invention provides an SNP molecular marker for identifying cold tolerance in upland cotton seedlings, wherein the SNP molecular marker is located in upland cotton seedlings. At 32,081,663 bases on chromosome Chr.A09 in the physical map of the genome, the polymorphic genotype of the SNP molecular marker is either A or G; the phenotype A corresponds to a cold-sensitive phenotype, and the phenotype G corresponds to a cold-resistant phenotype.

[0006] When the polymorphic genotype of the SNP molecular marker is A / G, it is heterozygous, and its corresponding phenotype is heterozygous intermediate.

[0007] Preferably, the present invention constructs a second-generation hybrid segregating population using C1470 and Junmian 1, and constructs a genetic map using Bulked Segregant Analysis sequencing (BSA-seq) technology.

[0008] Furthermore, the sequence of the A genotype is shown in SEQ ID NO: 1, the sequence of the G genotype is shown in SEQ ID NO: 2, and the SNP molecular marker is located at position 101 of the sequence.

[0009] Furthermore, if the base at position 32,081,663 of chromosome 32,081 in upland cotton is A, its corresponding phenotype is cold-sensitive; if the base at position 32,081,663 in chromosome 32,081 in upland cotton is G, its corresponding phenotype is cold-resistant; and if the base at position 32,081,663 in chromosome 32,081 in upland cotton is A / G heterozygous, its corresponding phenotype is intermediate.

[0010] The present invention also provides a primer set for detecting the SNP molecular marker, the primer set comprising two forward primers and one reverse primer, wherein the nucleotide sequences of the forward primers are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 5.

[0011] This invention also provides an application for identifying SNP molecular markers in upland cotton seedlings, applying the detection of SNP molecular markers to screen upland cotton seedlings for cold-sensitive or cold-resistant types.

[0012] The present invention also provides a method for detecting cold-sensitive or cold-resistant types of upland cotton seedlings, the method comprising the following steps:

[0013] (1) Extract genomic DNA from the upland cotton to be tested;

[0014] (2) Competitive allele-specific PCR was performed on the genomic DNA of upland cotton using the primer set for detecting the SNP molecular markers;

[0015] (3) Analyze the fluorescence signal color in the PCR amplification results. If the fluorescence signal color is consistent with the fluorescence color of the forward primer shown in SEQ ID NO: 3, then the tested upland cotton is homozygous genotype A and the phenotype is cold sensitive.

[0016] If the fluorescence signal color is consistent with the fluorescence color of the forward primer shown in SEQ ID NO:4, then the upland cotton to be tested is homozygous genotype G and has a cold-resistant phenotype.

[0017] If two fluorescent signals are detected simultaneously, the genotype is determined to be heterozygous A / G.

[0018] Preferably, the reaction system for the competitive allele-specific PCR is as follows: KASP V4.0 2× MasterMix 2.5 μL, template DNA (25-50 ng / μL) 2 μL, primer F1 0.02 μL, primer F2 0.02 μL, primer R 0.06 μL, and the total reaction volume is increased by... Bring the total volume to 5 μL.

[0019] Preferably, the reaction program for the competitive allele-specific PCR is as follows: pre-denaturation: 95 ℃ for 10 min, 1 cycle; landing PCR: 95 ℃ for 15 s, 65 ℃ to 55 ℃ (decreasing by 1 ℃ per cycle) for 60 s, 10 cycles; amplification: 95 ℃ for 15 s, 57 ℃ for 60 s, 28 cycles; plate reading: 37 ℃ for 60 s, 1 cycle.

[0020] The present invention also provides a kit for detecting cold-sensitive or cold-resistant upland cotton seedlings, the kit comprising the primer set as described in SEQ ID NO: 3-SEQ ID NO: 5, and PCR amplification reagents.

[0021] Preferably, the PCR amplification reagent contains KASP V4.0 2×Master Mix from the KASP genotyping kit.

[0022] This invention also provides the application of the above-described kit in identifying cold-sensitive or cold-resistant types of upland cotton seedlings, which plays a positive role in molecular-assisted breeding for different cold-resistant types of upland cotton.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0024] This invention provides a KASP marker associated with cold tolerance in upland cotton seedlings. The SNP molecular marker of the KASP marker is located at 32,081,663 bases on chromosome 32,081,663 of the upland cotton genome (Chr.A09), with an SNP polymorphism of A or G. This allows for rapid and accurate identification of cold tolerance in upland cotton seedlings without the need for low-temperature stress and recovery at room temperature followed by phenotypic observation, enabling early screening of cold-tolerant upland cotton varieties at the seedling stage. It can be used for large-scale surveys of cold tolerance in upland cotton germplasm resources, providing a molecular tool for genetic diversity research and the discovery of superior genes, improving breeding efficiency, and shortening the breeding cycle. Based on this KASP marker, a commercial detection kit has been developed, suitable for the needs of seed companies, breeding units, and research institutions for identifying cold tolerance in upland cotton seedlings, and has promising application prospects. Attached Figure Description

[0025] Figure 1 These are plant morphology diagrams of Si1470 and Junmian No. 1 before and after cold treatment in Example 1;

[0026] Figure 2 These are plant morphology diagrams of Si 1470 and Junmian 1 during their recovery period after cold treatment in Example 1;

[0027] Figure 3 It is based on BSA mixed pool. Value analysis and location map;

[0028] Figure 4 This is a schematic diagram of QTL localization results based on SNP tags;

[0029] Figure 5 The fluorescence scatter plot is obtained by KASP typing of multiple upland cotton materials based on the SNP marker at position 32,081,663 of chromosome Chr.A09. Detailed Implementation

[0030] Unless otherwise specified, the methods used in the following examples are conventional methods. All materials and reagents used are commercially available unless otherwise specified.

[0031] Example 1: Acquisition of SNP molecular marker sites highly associated with cold tolerance in upland cotton seedlings

[0032] (1) Construction of second-generation segregating populations of cold-sensitive and cold-resistant hybrids in upland cotton seedlings

[0033] C1470 (Si 1470) and Junmian 1 were subjected to cold treatment at 4 ℃ for 48 h at the three-leaf-one-heart stage, followed by recovery at 28 ℃ for 48 h. The cold resistance of the parents was identified based on the damage to the second leaf from the top. Figure 1 These are plant morphological images of Sisi 1470 and Junmian No. 1 before and after cold treatment. Figure 2 These are plant morphological images of Si 1470 and Junmian 1 during their recovery period after cold treatment, showing the second leaf from the top; by Figure 1 , 2 It is evident that parent C1470 is cold-sensitive and is a cold-tolerant type; while parent Junmian 1 is cold-tolerant and is a cold-tolerant type. Using the seedling-cold-sensitive C1470 as the male parent and the seedling-cold-tolerant Junmian 1 as the female parent, hybridization was carried out to obtain the first generation of hybrids. The first generation of hybrids was further self-pollinated to construct the second generation of upland cotton seedling-cold-sensitive and cold-tolerant segregating populations.

[0034] (2) QTL (Quantitative Trait Locus) mapping and molecular marker development

[0035] The hybrid second-generation population obtained in step (1) was subjected to cold treatment at 4 ℃ for 48 h at the three-leaf-one-heart stage, followed by recovery at 28 ℃ for 48 h. The cold tolerance trait was identified based on the damage to the second leaf from the bottom. After identification, extreme and extreme individual plants were screened out. High-quality DNA was extracted from cotton young leaves using the CTAB method (hexadecyltrimethylammonium bromide method). Two extreme pools were constructed and libraries were built and sequenced to construct a genetic map.

[0036] use Value analysis is used to locate QTL loci associated with the target trait and analyze the location results. Figure 3 It is based on BSA mixed pool. Value analysis and location map; Figure 4 This is a schematic diagram of QTL localization results based on SNP markers. Figure 3 , Figure 4 It is evident that cold tolerance in seedlings is a quantitative trait controlled by multiple loci, including the QTL_A09 locus (located in the range of Chr.A09 chromosome 26,767,659 to 43,517,658). The values ​​exceeded the screening threshold of 10 and had the largest peak. The allele frequencies at positions 32, 081, and 663 on chromosome Chr.A09 were the most significant within the interval, and were therefore used as QTL-related SNP molecular markers.

[0037] After fine localization and annotation of the significant signal region on chromosome A09 using KASP markers, the gene GH_A09G0576 was found to be within the localized region and could be considered as a candidate gene.

[0038] Example 2: Validation of target SNP genotyping based on KASP competitive allele-specific PCR technology

[0039] (1) Extraction The genomic physical map of chromosome Chr.A09 shows 200 bp upstream and downstream of loci 32,081,663, serving as SNP markers for identifying cold-tolerant and cold-sensitive varieties of upland cotton seedlings. The SNP marker polymorphism is either A or G, with genotype A indicating cold sensitivity and genotype G indicating cold tolerance. The base in cold-sensitive upland cotton is A, and the base in cold-tolerant upland cotton is G. The sequence of the cold-tolerant upland cotton is shown in SEQ ID NO: 1.

[0040] CTTTTGTAAAAATCATGGCAGTTGCGGAAGCTTAATTTAAAAACAATTGCGGTTACATGATGTTTTGAACAACATTAGTTGCTTTGGAAAACCGTGTTCTAATATTAGCAATTATAAGAACAATAAAAAAAATTCCAAATTTGAAATCCAGAAAATTGCAACTACAACCCACATAAAACATTTAAAAGTAATAATCAAAATT.

[0041] The genotype sequence of the cold-sensitive upland cotton is shown in SEQ ID NO: 2:

[0042] CTTTTGTAAAAATCATGGCAGTTGCGGAAGCTTAATTTAAAAACAATTGCGGTTACATGATGTTTTGAACAACATTAGTTGCTTTGGAAAACCGTGTTCTAGTATTAGCAATTATAAGAACAATAAAAAAAATTCCAAATTTGAAATCCAGAAAATTGCAACTACAACCCACATAAAACATTTAAAAGTAATAATCAAAATT.

[0043] Using the Primer3Plus online website (https: / / www.primer3plus.com / ), design SNP marker genotyping primers: two forward primers F1 and F2, and one reverse universal primer R. The forward primers... The ends are A / G at positions 32,081,663 on chromosome Chr.A09. The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO: 3 (GAAGGTGACCAAGTTCATGCTGCTTTGGAAAACCGTGTTCTAA), the nucleotide sequence of the forward primer F2 is shown in SEQ ID NO: 4 (GAAGGTCGGAGTCAACGGATTGCTTTGGAAAACCGTGTTCTAG), and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO: 5 (TGTGGGTTGTAGTTGCAATT).

[0044] (2) The KASP genotyping kit (KASP V4.0 2×Master Mix) obtained in step (1) was used to verify the cotton samples by following the instructions of the Guangzhou Good Biotech Co., Ltd. The cotton samples included 8 Junmian No. 1 (cold-resistant pure line plants), 8 C1470 (cold-sensitive pure line plants), and 42 hybrid second generation (C1470×Junmian No. 1) cotton samples, totaling 58 samples. The reaction system is shown in Table 1 and the reaction process is shown in Table 2.

[0045]

[0046] ;

[0047] In this embodiment, designed SNP marker genotyping primers were used to perform competitive allele-specific polymerase chain reaction (PCR) on DNA samples from 42 cotton plants in a population of 8 Junmian 1 (cold-resistant pure lines), 8 C1470 (cold-sensitive pure lines), and a second-generation hybrid (C1470 × Junmian 1). A total of 58 samples were subjected to KASP genotyping. Samples with an A base at position 32,081,663 of chromosome Chr.A09 could bind to and extend with the F1 primer, and HEX green fluorescence was detected at wavelengths of 533–580 nm. Samples with a G base at position 32,081,663 of chromosome Chr.A09 could bind to and extend with the F2 primer, and FAM blue fluorescence was detected at wavelengths of 465–510 nm. When the genotype at position 32,081,663 of chromosome Chr.A09 was A / G heterozygous, both HEX and FAM fluorescence were detected. If only HEX fluorescence is detected, it indicates that the genotype of the sample at position 32,081,663 of chromosome A09 is A. If only FAM fluorescence is detected, it indicates that the genotype of the sample at position 32,081,663 of chromosome A09 is G. If both HEX and FAM fluorescence are detected, it indicates that the genotype of the sample at position 32,081,663 of chromosome A09 is A / G heterozygous. The figure is a fluorescence scatter plot obtained by KASP typing of multiple upland cotton materials based on the SNP marker at position 32,081,663 of chromosome A09. As shown in the figure, the green dots indicate samples with only HEX fluorescence detected, representing samples with base A at chromosome 32,081,663 of chromosome Chr.A09. The blue dots indicate samples with only FAM fluorescence detected, representing samples with base G at chromosome 32,081,663 of chromosome Chr.A09. The red dots indicate samples with both HEX and FAM fluorescence detected, indicating that the genotype of this sample at chromosome 32,081,663 of chromosome Chr.A09 is A / G heterozygous.

[0048] As can be seen from the above, the molecular marker Chr.A09 chromosome 32,081,663, which is related to the cold tolerance type of cotton seedlings, proposed in the embodiments of the present invention, has high stability and high reliability. This molecular marker can be used to quickly determine the cold tolerance type of upland cotton seedlings. Therefore, it allows for precise and efficient screening of plant cold tolerance types without the need for low-temperature stress treatment, and can be used to discover upland cotton varieties with cold tolerance at the seedling stage.

[0049] Although embodiments of the present invention have been shown and described above, it is understood that these embodiments are exemplary and should not be construed as limiting the present invention. The scope of protection of the present invention is not limited thereto. Variations, modifications, substitutions, and modifications made to the above embodiments by those skilled in the art within the scope of the present invention should all be covered within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A SNP molecular marker for identifying cold tolerance in upland cotton seedlings, characterized in that, The SNP molecular marker is located in upland cotton. At 32,081,663 bases on chromosome Chr.A09 in the physical map of the genome, the polymorphic genotype of the SNP molecular marker is either A or G; the phenotype A corresponds to a cold-sensitive phenotype, and the phenotype G corresponds to a cold-resistant phenotype.

2. The SNP molecular marker according to claim 1, characterized in that, The sequence of the A genotype is shown in SEQ ID NO: 1, and the sequence of the G genotype is shown in SEQ ID NO:

2. The SNP molecular marker is located at position 101 of the sequence.

3. The SNP molecular marker according to claim 1, characterized in that, If the base at position 32,081,663 of chromosome 32,081 in upland cotton is A, its corresponding phenotype is cold-sensitive; if the base at position 32,081,663 in chromosome 32,081 in upland cotton is G, its corresponding phenotype is cold-resistant; if the base at position 32,081,663 in chromosome 32,081 in upland cotton is A / G heterozygous, its corresponding phenotype is intermediate.

4. A primer set for detecting the SNP molecular marker, characterized in that, The primer set comprises two forward primers and one reverse primer, wherein the nucleotide sequences of the forward primers are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:

5.

5. An application of SNP molecular markers for identifying upland cotton seedlings, characterized in that, The application of the SNP molecular marker described in claim 1 in identifying cold-resistant or cold-sensitive types of upland cotton seedlings.

6. A method for detecting cold-sensitive or cold-resistant varieties of upland cotton seedlings, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the upland cotton to be tested; (2) Competitive allele-specific PCR amplification of the genomic DNA of the target upland cotton was performed using the primer set for detecting the SNP molecular markers; (3) Analyze the fluorescence signal color in the PCR amplification results; If the fluorescence signal color is consistent with the fluorescence color of the forward primer shown in SEQ ID NO:3, then the tested upland cotton is homozygous genotype A and has a cold-sensitive phenotype. If the fluorescence signal color is consistent with the fluorescence color of the forward primer shown in SEQ ID NO:4, then the upland cotton to be tested is homozygous genotype G and has a cold-resistant phenotype. If fluorescence signals of two alleles are detected simultaneously, the upland cotton being tested is a heterozygous genotype.

7. The method according to claim 6, characterized in that, The reaction system for the competitive allele-specific PCR was as follows: KASP V4.0 2× Master Mix 2.5 μL, template DNA 2 μL, primers described in SEQ ID NO: 3 0.02 μL, primers described in SEQ ID NO: 4 0.02 μL, primers described in SEQ ID NO: 5 0.06 μL, and total reaction volume plus... Bring the total volume to 5 μL.

8. A kit for detecting cold-sensitive or cold-resistant varieties of upland cotton seedlings, characterized in that, The kit includes the primer set as described in SEQ ID NO: 3-SEQ ID NO: 5, and PCR amplification reagents.

9. The reagent kit according to claim 8, characterized in that, The PCR amplification reagent contains KASP V4.0 2× Master Mix from the KASP genotyping kit.

10. The application of a kit for detecting cold-sensitive or cold-resistant types of upland cotton seedlings in the identification of cold-sensitive or cold-resistant types of upland cotton seedlings.

Images