Specific InDel molecular marker for identifying zucchini melon germplasm and application thereof

Abstract

The application discloses a specific InDel molecular marker for identifying small green melon Cucumis melo L. germplasm and application thereof. The InDel primer group for identifying the genotype of the InDel molecular marker is composed of a forward primer and a reverse primer, and nucleotide sequences are shown in SEQ ID NO:1 and SEQ ID NO:2 in sequence. The InDel primer group provided by the application can be used for identifying whether a to-be-tested melon sample is small green melon germplasm or contains small green melon bloodline germplasm, and has important application value for protecting and identifying small green melon germplasm resources in the process of agricultural production and variety breeding. In addition, the InDel primer group can also be used for identifying the purity of a melon hybrid variety containing small green melon bloodline. The InDel primer group provided by the application has the advantages of high throughput, accuracy, low cost, simple operation, saving of manpower and material resources and the like in the identification of germplasm containing small green melon bloodline or the identification of hybrid variety purity.

Description

Technical Field

[0001] This invention belongs to the field of melon germplasm identification, specifically involving a specific InDel molecular marker for identifying small green melon germplasm and its application. Background Technology

[0002] The "Little Green Melon" is characterized by its low individual fruit weight, green skin and flesh, and well-proportioned shape. It also boasts excellent qualities such as good disease resistance, sweet and crisp flesh, and high sugar content. (Image of Little Green Melon growth is shown below.) Figure 1 As shown, using it as a parent, several thin-skinned melon hybrids, such as the "Mini" series and the "Ganlu" series, have been bred. These varieties have performed excellently in cultivation in Northeast China, Inner Mongolia, and Hebei Province, exhibiting characteristics such as tolerance to low temperatures and weak light, high sugar content, and good resistance. In recent years, with the rapid development of the melon industry, more than 2,000 melon varieties have been registered nationwide, and over 95% of them are first-generation hybrids. Hybrid seed purity identification is a crucial indicator for determining the quality of commercial seeds. Traditional field identification methods are time-consuming and costly. Therefore, how to quickly identify the germplasm lineage of "Xiao Lv Gua" and test the purity of its hybrids is of significant industrial importance. However, currently, there is a lack of molecular markers and methods that can specifically identify the germplasm lineage of "Xiao Lv Gua" and rapidly determine the purity of hybrids bred using "Xiao Lv Gua" as a parent.

[0003] With the development of molecular biology techniques, DNA molecular markers have been widely used in commercial breeding and purity testing. Currently, the purity identification of melon hybrids in my country mainly uses the SSR marker method. However, the number of varieties used for SSR primer screening is relatively small, and the detection method is prone to false positives and false negatives, making it difficult to meet the requirements of automated, high-throughput, and large-scale testing. SNPs, as third-generation molecular markers, are widely distributed in the genome, genetically stable, and easy to detect automatically, but they have high requirements for DNA quality and detection equipment. InDel (Insertion / Deletion) markers, as a type of molecular marker based on sequence length polymorphism, have advantages such as simple detection methods, intuitive and stable results, and no need for complex instruments and equipment. Compared with SNP markers, InDel markers can be genotyped by conventional PCR amplification and agarose gel electrophoresis, which is simple to operate and low in cost, making it particularly suitable for promotion and application in grassroots seed quality testing institutions and breeding units.

[0004] Therefore, developing a highly specific, easy-to-operate, and low-cost InDel molecular marker for identifying the germplasm lineage of "Little Green Melon" and the purity of its hybrid varieties has significant industrial application value and market prospects. Summary of the Invention

[0005] To address the shortcomings of existing technologies, one of the objectives of this invention is to provide a specific InDel molecular marker for identifying the germplasm of the small green melon.

[0006] The second objective of this invention is to provide an InDel primer set for identifying the genotype of the aforementioned InDel molecular marker.

[0007] A third objective of this invention is to provide a kit containing the aforementioned primer set.

[0008] The fourth objective of this invention is to provide the use of the above-mentioned primer set and kit.

[0009] The fifth objective of this invention is to provide a method for identifying whether a melon variety to be tested is a small green melon germplasm or a melon germplasm containing small green melon lineage.

[0010] The sixth objective of this invention is to provide a method for identifying the purity of melon hybrids containing the lineage of small green melons.

[0011] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of the present invention provides an InDel primer set for identifying the genotype of the InDel molecular marker in the melon genome, wherein the InDel molecular marker is located at position 1581627-1581650 on chromosome 8 of the melon genome, and the InDel molecular marker is characterized by the presence or absence of 24 nucleotides at position 1581627-1581650. The location of the InDel molecular marker on the chromosome was determined based on the alignment of the DHL92 melon reference genome sequence, version number V4.0.

[0012] Furthermore, the 24-nucleotide sequence located at positions 1581627-1581650 on chromosome 8 of the melon genome is shown in SEQ ID NO: 3 (CCACCACTGGTACGAGTGATTTAA). Regarding this nucleotide sequence, there are two possibilities in melon materials: either the melon genome contains a deletion or an insertion (i.e., a 24-nucleotide sequence) at this position. Specifically, the 24-nucleotide sequence is present at positions 1581627-1581650 on chromosome 8 in *Xiao Lv Gua* melon or melons with *Xiao Lv Gua* lineage, while it is missing at this position in other melon varieties unrelated to *Xiao Lv Gua*. Therefore, this sequence can be used as an InDel molecular marker for identifying *Xiao Lv Gua* or melon germplasm with *Xiao Lv Gua* lineage. Of course, this 24-nucleotide sequence can be either as shown in SEQ ID NO: 3 or a sequence obtained by substituting one or more nucleotides in SEQ ID NO: 3.

[0013] The primer set consists of a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO: 1 and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 2.

[0014] In the use of the above primer set, the molar ratio of the forward primer to the reverse primer is 1:1.

[0015] A second aspect of the present invention provides a kit containing the InDel primer set described in the first aspect, which is also within the scope of protection of the present invention.

[0016] In addition to the primer set mentioned above, the kit may also include other reagents for routine PCR, such as DNA polymerase and buffer.

[0017] The preparation method of the kit is also within the scope of protection of this invention. The preparation method of the kit includes the step of individually packaging each primer from any of the primer sets described above.

[0018] A third aspect of the present invention provides the application of the InDel primer set described in the first aspect or the kit described in the second aspect, wherein the application is any one of the following two: (a) Application in identifying whether a melon variety to be tested is a *Xiao Lvgua* melon germplasm or a melon germplasm containing *Xiao Lvgua* lineage; the identification includes determining the melon germplasm to be tested based on the genotype of the InDel molecular marker described in the first aspect above: if the genotype based on the InDel molecular marker is homozygous or heterozygous with at least one of the two allele chains missing 24 nucleotides, then the melon variety to be tested is identified as or suspected to be identified as *Xiao Lvgua* melon germplasm or a melon germplasm containing *Xiao Lvgua* lineage; if the genotype based on the InDel molecular marker is homozygous with neither of the two allele chains missing 24 nucleotides, then the melon variety to be tested is identified as or suspected to be identified as a melon germplasm unrelated to *Xiao Lvgua*. (b) Application in determining the purity of melon hybrids containing the lineage of small green melon.

[0019] The fourth aspect of this invention provides a method for identifying whether a melon variety to be tested is a *Xiao Lvgua* melon germplasm or a melon germplasm containing *Xiao Lvgua* lineage, comprising the following steps: detecting the genotype of the melon variety to be tested based on the InDel molecular marker described in the first aspect above, and then determining the melon germplasm based on the genotype of the InDel molecular marker: if the genotype based on the InDel molecular marker is homozygous or heterozygous with at least one of the two allele chains missing 24 nucleotides, then the melon variety to be tested is identified as or suspected to be identified as *Xiao Lvgua* melon germplasm or a melon germplasm containing *Xiao Lvgua* lineage; if the genotype based on the InDel molecular marker is homozygous with neither of the two allele chains missing 24 nucleotides, then the melon variety to be tested is identified as or suspected to be identified as a melon germplasm unrelated to *Xiao Lvgua*.

[0020] In the application of the third aspect or the method of the fourth aspect of the present invention, specifically, if the genotype based on the InDel molecular marker is a heterozygous type where one of the two allele chains is missing 24 nucleotides and the other chain has 24 nucleotides, then the melon variety to be tested is identified as or suspected to be a melon germplasm containing the Xiaolugua lineage; if the genotype based on the InDel molecular marker is a homozygous type where both of the two allele chains are missing 24 nucleotides, then the melon variety to be tested is identified as or suspected to be a Xiaolugua melon germplasm.

[0021] In the above method, the step of detecting the genotype of the melon variety to be tested based on the InDel molecular marker described in the first aspect can be as follows: (1) Using the genomic DNA of the melon variety to be tested as a template, PCR amplification was performed using the primer set described in the first aspect above to obtain PCR amplification products; (2) The fragment length of the PCR amplification product obtained in step (1) is detected by an instrument, and the genotype of the melon variety to be tested based on the InDel molecular marker described in the first aspect is obtained according to the fragment length.

[0022] Furthermore, the determination of the melon germplasm based on the genotype of the InDel molecular marker is as follows: if the PCR amplification product is a single-length fragment or two fragments of different lengths and the fragment length contains 89bp (deleted CCACCACTGGTACGAGTGATTTAA), then the melon variety to be tested is identified or suspected to be identified as a small green melon germplasm or a melon germplasm containing the lineage of small green melon; if the PCR amplification product is a single-length fragment and the fragment length is 113bp, then the melon variety to be tested is identified or suspected to be identified as a melon germplasm unrelated to small green melon.

[0023] Specifically, if the PCR amplification product is a single-length fragment with a length of 89 bp, the melon variety to be tested is identified as or suspected to be a small green melon germplasm; if the PCR amplification product is two fragments of different lengths and the fragment length includes 89 bp, the melon variety to be tested is identified as or suspected to be a melon germplasm containing the small green melon lineage.

[0024] The fifth aspect of this invention provides a method for identifying the purity of a melon hybrid containing the lineage of the small green melon, comprising the following steps: (A) Randomly select N seeds from the hybrid and obtain the genomic DNA of the seeds or the seedlings grown from the seeds; (B) Using the genomic DNA obtained in step (A) as a template, PCR amplification was performed using the InDel primer set described in the first aspect to obtain the corresponding PCR amplification products; (C) Detect the fragment length of each PCR amplification product obtained in step (B), and then calculate the purity of the melon hybrid containing the bloodline of the small green melon. When the PCR amplification product is two fragments of different lengths, it indicates that the seed is a hybrid. When the PCR amplification product is a single-length fragment, it indicates that the seed is a homozygous.

[0025] Furthermore, in step (C), the fragment length of the PCR amplification product is 89 bp and / or 113 bp; Furthermore, the purity is calculated as follows: Purity = Number of hybrids / (Number of seeds without bands in N-PCR amplification products) × 100%; N is preferably greater than 90, and the larger the value of N, the higher the accuracy of identifying the purity of the hybrids.

[0026] The melons containing the bloodline of the small green melon involved in this invention are obtained by hybridizing the small green melon melon with other melon varieties that are not related to the small green melon.

[0027] It should be noted that this invention focuses on ensuring the purity of melon hybrids containing the lineage of the small green melon, specifically referring to first-generation hybrids. The core challenge lies in avoiding parental mixing rather than mechanical mixing, that is, not simply mixing multiple melon hybrids containing the lineage of the small green melon.

[0028] Furthermore, the fragment lengths of each PCR amplification product obtained in step (B) were obtained by agarose gel electrophoresis.

[0029] In any of the methods described above, the reaction procedure for "PCR amplification using the primer set described in the first aspect" can be as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, amplification for 35 cycles; 72℃ extension for 7 min, cooling at 4℃ for 5 min.

[0030] Beneficial effects of this invention: With the development of genomics technology, the melon genome has been published, and whole-genome resequencing of over 1000 melon resources has been completed. This rich dataset of variants provides marker resources for screening population-specific genetic loci in melons. This invention utilizes resequencing data from germplasm resources of *Small Green Melon* and non-*Small Green Melon* (i.e., melons unrelated to *Small Green Melon*) to screen for population-specific genetic loci from the whole genome. This allows for the development of InDel molecular markers or primer sets to identify *Small Green Melon* or melons containing *Small Green Melon* lineage versus non-*Small Green Melon* melons. The InDel primer set provided by this invention can be used to identify whether a tested melon variety is *Small Green Melon*, contains *Small Green Melon* lineage, or is not a *Small Green Melon*, which has significant application value in clarifying the population attributes of melons during agricultural production and variety breeding. Furthermore, this InDel primer set can also be used to determine the purity of melon hybrids containing *Small Green Melon* lineage. The InDel primer set provided by this invention has advantages such as high throughput, accuracy, low cost, simple operation, and saving manpower and resources in both germplasm identification containing the bloodline of small green melon and hybrid purity identification, and has a very broad application prospect. Attached Figure Description

[0031] Figure 1 To study the field plant growth and fruit appearance of the small green melon germplasm resources; Figure 2 To screen for InDel chromosomes longer than 20 bp based on melon variant data; Figure 3 The changes in the whole-genome InDel genotype frequency ratios between the small green melon and other types of melon; Figure 4 This is a 24bp InDel site sequence specific to the small green melon (Swiss melon) located on chromosome 8; Figure 5 The results of using primer Ind08 to identify the tested melon hybrids are shown in part, with the middle column being the marker. Detailed Implementation

[0032] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0034] Example 1: Obtaining the InDel variant site used to identify the tested melon variety as the small green melon. I. Discovery of the 24bp InDel site specific to the small green melon This invention is based on resequencing data from the small green melon and 1184 publicly available melon germplasm resources (https: / / www.ncbi.nlm.nih.gov / bioproject / ?term=PRJNA565104). Perfect InDel loci were selected based on sequencing depth greater than 5X, no other variations within 50 bp on either side of the InDel, InDel length greater than 20 bp and less than 100 bp, and genome alignment specificity. A total of 36,989 InDel loci were ultimately obtained. These 1184 melon resources represent a wide range of melon genetic diversity. The chromosome distribution of the 36,989 selected InDel loci is shown in [link to chromosome analysis]. Figure 2 .

[0035] Specifically, the screening criteria for the *Xiao Lv Gua* melon-specific InDel loci are as follows: First, among the 36,989 InDel loci obtained above, InDel loci with heterozygosity less than 0.1 and deletion rate less than 0.1 were selected, resulting in 6,327 melon-specific *perfectInDel* loci; then, the ratio of the *Xiao Lv Gua* melon's InDel genotype to that of all melon germplasm was calculated, revealing a significant point on chromosome 8 in the *Xiao Lv Gua* melon. (See [link to relevant documentation]). Figure 3 Further sequencing of this InDel site revealed that the InDel genotype of the small green melon is different from that of other melons, meaning that the small green melon has a 24bp sequence deletion, while the sequence length of other melons is consistent with the reference genome. Figure 4 The basic information about this InDel site is detailed in Table 1. The location of the InDel site on the chromosome was determined based on the alignment of the DHL92 melon reference genome sequence, version V4.0 (downloadable from: http: / / cucurbitgenomics.org / v2 / ftp / genome / melon / DHL92 / v4.0 / ).

[0036] Table 1. Basic information on the InDel-specific sites in the small green melon. II. Obtaining InDel primers for identifying the test melon variety as Xiaolvgua melon or melons containing Xiaolvgua lineage. Based on the IndDel site discovered in step one, the inventors of this invention designed and synthesized a pair of InDel primers, Ind08, ​​consisting of two primer sequences, for amplifying this InDel site and determining its genotype. The nucleotide sequence of the Ind08 primer is shown in column 3 of Table 2.

[0037] Table 2. InDel combinations used to identify the tested melon variety as the small green melon. Example 2: Validation of the InDel primers developed in Example 1 Basic information on the 166 tested melon varieties in this embodiment is shown in columns 1 to 8 of Table 3. All 166 tested melon varieties are common market varieties. Based on phenotype, one tested melon variety is a small green melon, two tested melons are hybrids bred from the small green melon, and 163 tested melon varieties are not small green melons.

[0038] Table 3. Basic information of 166 tested melon varieties The results in columns 4 and 8 of Table 3 indicate the true genetic background of whether this variety has the bloodline of the small green melon.

[0039] 1. Obtaining genomic DNA from the tested melon varieties Genomic DNA was extracted from leaves of 166 tested melon varieties using the SDS method. The quality and concentration of the genomic DNA from the tested melon varieties had to meet PCR requirements, with the following criteria: agarose gel electrophoresis showed a single DNA band without significant diffusion; UV spectrophotometer Nanodrop 2000 (Thermo) showed an A260 / A280 ratio of approximately 1.8 and an A260 / A230 ratio greater than 1.8; and the concentration of the genomic DNA from the tested melon varieties was between 10 and 30 ng / μL.

[0040] 2. Using genomic DNA from 166 tested melon varieties as templates, PCR amplification was performed using primers Ind08 (see Table 2 in Example 1) to obtain PCR amplification products. The concentration ratio of the forward primer to the reverse primer in the PCR reaction system was 1:1.

[0041] The PCR amplification reaction system consisted of: 5 µl template DNA, 10 µl 2×Mix, 1 µl forward primer and 1 µl reverse primer (20 µmol / L), and 3 µl ultrapure water.

[0042] The reaction procedure was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, amplification for 35 cycles; 72℃ extension for 7 min, cooling at 4℃ for 5 min.

[0043] 3. After completing step 2, perform agarose gel electrophoresis on the PCR amplification products, and take pictures and read the results using a gel imaging system. Determine the genotype of the 166 tested melon varieties at the Ind08 locus based on the banding patterns. The specific determination principles are as follows: If a tested melon variety shows a single 89bp band or an 89 / 113bp heterozygous band at a specific Ind08 locus, then the tested melon variety is a small green melon or a melon containing small green melon lineage; if a tested melon variety shows a single 113bp band at the Ind08 locus, then the tested melon variety does not contain small green melon lineage.

[0044] 4. Efficiency evaluation of using primer Ind08 to identify 166 tested melon varieties as small green melons. The genotypes of 166 tested melon varieties based on the Ind08 locus were statistically analyzed, as shown in Table 3.

[0045] The results showed that one tested melon variety with a genotype of 89 bp based on the Ind08 locus was homozygous, and two tested melon varieties with a genotype of 89 / 113 bp were heterozygous. These were identified as either small green melons or melons with small green melon lineage, and their genetic consistency with the true genetic background of the tested materials was 100%. 163 tested melon varieties with a genotype of 113 bp based on the Ind08 locus were identified as not having small green melon lineage. The phenotype or true genetic background of these 163 melons were all melons unrelated to small green melons, and the identification method of this invention was 100% consistent with the true genetic background.

[0046] Therefore, it can be seen that the Ind08 primer developed in Example 1 can identify whether the melon variety to be tested is a small green melon or a melon with small green melon lineage.

[0047] Example 3: Using the InDel primers developed in Example 1, the purity of the melon hybrid Ganlu 4 containing the lineage of the small green melon was identified. 1. The purity of the hybrid melon Ganlu 4, developed in Example 1, was determined using the InDel primers. The male parent was HC08, and the female parent was 162, which contains the bloodline of the small green melon. The specific steps are as follows: (1) 120 seeds of the Ganlu No. 4 melon variety were germinated; leaves or roots of 96 melon seedlings were taken and genomic DNA was extracted by SDS method to obtain the genomic DNA of the melon plants to be tested.

[0048] (2) Using the genomic DNA of 96 melon plants as templates, PCR amplification was performed using primers Ind08 from Table 2 of Example 1 to obtain PCR amplification products. In each PCR reaction system, the concentration ratio of forward primer to reverse primer was 1:1.

[0049] The PCR amplification reaction system consisted of: 5 µl template DNA, 10 µl 2×Mix, 1 µl forward primer and 1 µl reverse primer (20 µmol / L), and 3 µl ultrapure water.

[0050] The reaction procedure was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, amplification for 35 cycles; 72℃ extension for 7 min, cooling at 4℃ for 5 min.

[0051] (3) After completing step (2), perform agarose gel electrophoresis on the PCR amplification products, and take pictures and read the results using a gel imaging system. Calculate the heterozygous genotype ratio of the 96 DNA samples.

[0052] Purity = Number of strains with heterozygous sites shown in primer set / (96 - Number of strains with no band in primer set) × 100%.

[0053] The results showed that primer Ind08 showed 95 heterozygous bands and 1 homozygous band, with a purity of 95 / 96×100%=98.9%.

[0054] The partial InDel typing results for primer Ind08 are shown below. Figure 5 .

[0055] The purity of the hybrid obtained by field identification of 200 Ganlu No. 4 hybrid plants was 98.5%, which shows that the identification method of the present invention has high accuracy.

[0056] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. InDel primer set, used to identify the genotype of the InDel molecular marker in the melon genome, among which, The InDel molecular marker is located at positions 1581627-1581650 on chromosome 8 of the melon genome, and the InDel molecular marker is the presence or absence of 24 nucleotides at positions 1581627-1581650; The location of the InDel molecular marker on the chromosome was determined based on the alignment of the DHL92 melon reference genome sequence, version number V4.

0.

2. The InDel primer set according to claim 1, characterized in that: The sequence of the 24 nucleotides is shown in SEQ ID NO:

3.

3. The InDel primer set according to claim 1, characterized in that: The primer set consists of one forward primer and one reverse primer, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO: 1 and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:

2.

4. A reagent kit, characterized in that: The kit comprises the InDel primer set as described in any one of claims 1-3.

5. The use of the InDel primer set according to any one of claims 1-3 or the kit according to claim 4 in the following (a) or (b): (a) Application in identifying whether a melon variety to be tested is a *Xiao Lvgua* melon germplasm or a melon germplasm containing *Xiao Lvgua* lineage; the identification includes determining the melon germplasm to be tested based on the genotype of the InDel molecular marker described in claim 1: if the genotype based on the InDel molecular marker is homozygous or heterozygous with at least one of the two allele chains missing 24 nucleotides, then the melon variety to be tested is identified as or suspected to be identified as *Xiao Lvgua* melon germplasm or a melon germplasm containing *Xiao Lvgua* lineage; if the genotype based on the InDel molecular marker is homozygous with neither of the two allele chains missing 24 nucleotides, then the melon variety to be tested is identified as or suspected to be identified as a melon germplasm unrelated to *Xiao Lvgua*. (b) Application in determining the purity of melon hybrids containing the lineage of small green melon.

6. A method for identifying whether a melon variety to be tested is a *Xiao Lvgua* melon germplasm or a melon germplasm containing *Xiao Lvgua* lineage, comprising the following steps: detecting the genotype of the melon variety to be tested based on the InDel molecular marker described in claim 1, and then determining the melon germplasm based on the genotype of the InDel molecular marker: if the genotype based on the InDel molecular marker is homozygous or heterozygous with at least one of the two allele chains missing 24 nucleotides, then the melon variety to be tested is identified as or suspected to be identified as *Xiao Lvgua* melon germplasm or a melon germplasm containing *Xiao Lvgua* lineage; if the genotype based on the InDel molecular marker is homozygous with neither of the two allele chains missing 24 nucleotides, then the melon variety to be tested is identified as or suspected to be identified as a melon germplasm unrelated to *Xiao Lvgua*.

7. The method according to claim 6, characterized in that, The steps for detecting the genotype of the melon variety to be tested based on the InDel molecular marker described in claim 1 are as follows: (1) Using the genomic DNA of the melon variety to be tested as a template, PCR amplification was performed using the InDel primer set described in claim 3 to obtain the PCR amplification product; (2) The fragment length of the PCR amplification product obtained in step (1) is detected by an instrument, and the genotype of the melon variety to be tested based on the InDel molecular marker described in claim 1 is obtained according to the fragment length.

8. The method according to claim 7, characterized in that, The determination of the melon germplasm based on the genotype of the InDel molecular marker is as follows: if the PCR amplification product is a single-length fragment or two fragments of different lengths and the fragment length contains 89 bp, then the melon variety to be tested is identified as or suspected to be a small green melon germplasm or a melon germplasm containing the lineage of small green melon; if the PCR amplification product is a single-length fragment and the fragment length is 113 bp, then the melon variety to be tested is identified as or suspected to be a melon germplasm unrelated to small green melon.

9. A method for identifying the purity of a muskmelon hybrid containing the lineage of the small green melon, characterized in that, Includes the following steps: (A) Randomly select N seeds from the hybrid and obtain the genomic DNA of the seeds or the seedlings grown from the seeds; (B) Using the genomic DNA obtained in step (A) as a template, PCR amplification was performed using the InDel primer set described in any one of claims 1-3 to obtain the corresponding PCR amplification products; (C) Detect the fragment length of each PCR amplification product obtained in step (B), and then calculate the purity of the melon hybrid containing the bloodline of the small green melon. When the PCR amplification product is two fragments of different lengths, it indicates that the seed is a hybrid. When the PCR amplification product is a single-length fragment, it indicates that the seed is a homozygous.

10. The method according to claim 9, characterized in that, In step (C), the fragment length of the PCR amplification product is 89 bp and / or 113 bp; And / or, the purity is calculated as follows: Purity = Number of hybrids / (Number of seeds with no band in N-PCR amplification product) × 100%; And / or, the melon hybrid containing the lineage of the small green melon is obtained by crossing the small green melon material with other melon varieties that are not related to the small green melon.

Images