A CAPS molecular marker for identifying 'gui zao hong you gu' and application thereof

Abstract

The application relates to the technical field of molecular marker assisted breeding, and one of the purposes of the application is to provide a CAPS molecular marker for identifying 'Gui Zao Hong You Jie', which is located at the 26,487,151-26,487,152 site of the 6th chromosome of a Hong Kong kumquat genome; 'Gui Zao Hong You Jie' has a 2bp heterozygous deletion at the site, the deletion makes the sequence on both sides of the breakpoint reassemble to form a restriction enzyme Tsp45I cleavage site; the nucleotide sequence of the deletion fragment is shown as SEQ ID NO. 1. The second purpose of the application is to provide a primer pair for detecting the CAPS molecular marker, the nucleotide sequence of the forward primer of the primer pair is shown as SEQ ID NO. 2, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 3. The CAPS molecular marker provided by the application is developed based on the 2bp (TA) heterozygous deletion site specific to 'Gui Zao Hong You Jie', and is verified by blind test of 24 kumquat varieties / strains (covering multiple species and variety types such as Jin Pian, Lu Wan, Lu Fu, Changshou kumquat, Sijiqi orange, Hong Kong kumquat, etc.).

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to a CAPS molecular marker for identifying 'Guizao Hongyouju' and its application. Background Technology

[0002] Kumquat (Fortunella spp.) is an economically important tree species belonging to the Rutaceae family and the Citrus genus. Its peel is sweet and can be eaten whole, with a crisp, tender texture that melts in the mouth, making it valuable for both fresh consumption and processing. Kumquats have a long history of cultivation in my country and hold a significant economic position—in Guangxi Zhuang Autonomous Region alone, the planting area exceeds 400,000 mu (approximately 66,667 hectares); Youxi County in Fujian Province, one of the four major kumquat producing areas in China, had a planting area of ​​25,500 mu (approximately 1,000 hectares) in 2024, with a total output of 36,200 tons and a value exceeding 374 million yuan. The kumquat industry has become a crucial pillar industry driving income growth and prosperity for the local population.

[0003] 'Guizao Hongyouju' is an excellent strain selected from kumquat seedlings. Due to its significantly earlier maturity and superior fruit quality, it has significant promotional value in variety selection and cultivation. However, in the practice of kumquat variety protection and seedling quality control, the morphological characteristics of different kumquat varieties / strains show little difference during the seedling and vegetative growth stages. Traditional identification methods relying on botanical traits (such as the DUS test) are not only time-consuming (usually requiring 2-3 growth cycles) but also easily affected by environmental factors such as ecological environment and cultivation management level, making it difficult to accurately and efficiently identify 'Guizao Hongyouju' during the seedling stage. This seriously restricts the effective implementation of variety rights examination, infringement dispute resolution, and early seedling purity assessment.

[0004] With the development of molecular biology techniques, molecular markers based on DNA sequence variations have become an important means of variety identification. Currently, the molecular markers used in the identification of kumquat germplasm resources mainly include SSR (simple repeat sequence), ISSR (simple sequence repeat region), RAPD (random amplified polymorphic DNA), and AFLP (amplified fragment length polymorphism). For example, some studies have used SSR markers to analyze the phylogenetic relationships of the genus *Citrus* and its closely related genera; others have used ISSR molecular marker technology to identify the 'Jinqiuzao' kumquat variety; and still others have combined ploidy analysis with AFLP markers for genetic identification of new kumquat germplasm.

[0005] However, the aforementioned existing molecular marker technologies still have significant technical limitations in practical applications. While SSR markers exhibit high polymorphism and co-dominance, their loci are not abundant enough, and detection generally relies on polyacrylamide gel electrophoresis or capillary electrophoresis, which is cumbersome and has low stability. ISSR and RAPD markers are mostly dominant markers, unable to distinguish between homozygous and heterozygous genotypes, and have poor reproducibility. AFLP markers have complex procedures, high costs, and stringent experimental requirements. More importantly, these markers are all genome-wide random markers, not specific to any particular variety. In actual identification, multiple primer pairs are often required to distinguish different varieties, resulting in low detection efficiency and difficulty in achieving accurate and rapid identification of target varieties.

[0006] CAPS (Cleaved Amplified Polymorphic Sequences) markers are co-dominant molecular marker technologies that combine PCR amplification with restriction endonuclease digestion. They offer advantages such as ease of operation, stable results, high reproducibility, and the elimination of the need for sequencing or expensive equipment. Currently, CAPS markers have been applied in the identification of some Citrus varieties—for example, patented CAPS molecular markers have been developed to differentiate between red-fleshed, white-fleshed, and yellow-fleshed pomelos, used for early identification of seedlings of different bud mutations of the Guanxi pomelo; other researchers have developed CAPS markers for identifying the seedless trait of 'Qingjian Orange' and 'Egan No. 1'. However, these CAPS markers all target specific traits or varietal groups of other Citrus species, and there are currently no reports on variety-specific CAPS molecular markers for the Kumquat genus. As an independent plant species within the Citrus genus, the genomic sequence characteristics of Kumquat differ significantly from those of mandarin oranges, pomelos, and sweet oranges; existing Citrus CAPS markers cannot be directly applied to the identification of Kumquat varieties.

[0007] To address the shortcomings of existing technologies, this invention, for the first time, identified a specific 2bp (TA) heterozygous deletion site at loci 26,487,151 to 26,487,152 on chromosome 6 of 'Guizao Hongyouju' through whole-genome resequencing and sequence alignment analysis of 24 kumquat varieties / lines. This deletion results in the formation of a restriction endonuclease Tsp45Ⅰ restriction site (GTCAC) after reassembly of the sequences on both sides of the deletion. Based on this specific site, this invention developed a CAPS molecular marker and corresponding PCR primer pairs and restriction enzyme digestion detection method for the identification of 'Guizao Hongyouju', enabling rapid and accurate variety identification of 'Guizao Hongyouju' at the seedling stage, providing an effective technical means for the identification of kumquat germplasm resources and the protection of variety rights. Summary of the Invention

[0008] To address the technical problems mentioned in the background art, the present invention provides a CAPS molecular marker for identifying 'Guizao Hongyouju' and its application.

[0009] The present invention is achieved using the following technical solution: One of the objectives of the present invention is to propose a CAPS molecular marker for identifying 'Guizao Hongyouju', wherein the marker is located at positions 26,487,151 to 26,487,152 on chromosome 6 of the Hong Kong kumquat genome; 'Guizao Hongyouju' has a 2bp heterozygous deletion at this site, which causes the sequences on both sides of the break point to be reassembled to form a restriction endonuclease Tsp45Ⅰ cleavage site; the nucleotide sequence of the deleted fragment is shown in SEQ ID NO. 1.

[0010] The second objective of this invention is to provide a primer pair for detecting the CAPS molecular marker, wherein the forward primer nucleotide sequence is shown in SEQ ID NO. 2 and the reverse primer nucleotide sequence is shown in SEQ ID NO. 3.

[0011] The third objective of this invention is to propose the application of the primer pair in the identification of 'Guizao Hongyouju'.

[0012] Furthermore, the identification includes the following steps:

[0013] (1) Using the genomic DNA of the kumquat to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products;

[0014] (2) The amplification product was digested with the restriction endonuclease Tsp45Ⅰ;

[0015] (3) If the enzyme digestion product shows three DNA fragments of 112bp, 336bp and 448bp, the material to be tested is determined to be 'Guizao Hongyouju'; if the enzyme digestion product shows only one DNA fragment of 448bp, the material to be tested is determined to be a variety other than 'Guizao Hongyouju'.

[0016] The fourth objective of this invention is to provide a method for identifying 'Guizao Hongyouju', comprising the following steps:

[0017] (1) Extract genomic DNA from the kumquat tree to be tested;

[0018] (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 2 to obtain the amplification product;

[0019] (3) The amplification product obtained in step (2) was digested with the restriction endonuclease Tsp45Ⅰ;

[0020] (4) Electrophoresis was performed on the enzyme digestion products, and the polymorphism of the enzyme digestion bands was used to determine whether the material to be tested was 'Guizao Hongyouju';

[0021] If the enzyme digestion product shows three DNA fragments of 112bp, 336bp and 448bp, then the material to be tested is determined to be 'Guizao Hongyouju'.

[0022] If the enzyme digestion product only shows a 448bp DNA fragment, the material to be tested is determined to be a variety other than 'Guizao Hongyouju'.

[0023] Furthermore, the PCR amplification reaction system described in step (2) is 30 μL, including: 15 μL of 2×RapidTaqMasterMix, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 1.5 μL of template DNA, and ddH2O to make up to 30 μL.

[0024] Furthermore, the PCR amplification reaction program in step (2) is as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 20 s, 58℃ annealing for 30 s, 72℃ extension for 20 s, for a total of 34 cycles; 72℃ final extension for 5 min.

[0025] Furthermore, the enzyme digestion reaction system in step (3) is 20 μL, including: 17 μL of PCR amplification product, 2 μL of 10×CutOneColorBuffer, and 1 μL of restriction endonuclease Tsp45Ⅰ; the enzyme digestion conditions are incubation at 65℃ for 45 min.

[0026] Furthermore, the electrophoresis detection in step (4) uses 2% agarose gel and electrophoresis at 100V for 40 minutes.

[0027] The fifth objective of this invention is to provide a kit for identifying 'Guizao Hongyouju', comprising the primer pair and restriction endonuclease Tsp45Ⅰ.

[0028] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0029] High specificity and accuracy: The CAPS molecular marker provided by this invention is developed based on the unique 2bp (TA) heterozygous deletion site of 'Guizao Hongyouju'. After blind testing on 24 kumquat varieties / strains (covering multiple species and varieties such as Jintan, Luowen, Luofu, Changshou Kumquat, Sijiju, and Hong Kong Kumquat), the identification accuracy rate reached 100%, which can accurately distinguish 'Guizao Hongyouju' from other kumquat varieties / strains.

[0030] Simple to operate and low cost: The detection method developed by this invention, which combines CAPS technology, only requires conventional PCR amplification and restriction endonuclease Tsp45Ⅰ digestion to complete the identification. It does not require expensive equipment such as sequencing, fluorescently labeled probes, or capillary electrophoresis. The detection can be completed by ordinary PCR instrument + constant temperature water bath + agarose gel electrophoresis. The single sample detection cost is low and it is suitable for large-scale screening applications.

[0031] Early identification can be carried out during the seedling stage: This invention can extract DNA from leaves during the seedling stage of kumquat (two leaves and one heart stage) for testing. The authenticity of the variety and the purity assessment can be completed before the seedlings are transplanted, which can significantly reduce the trial and error costs in the propagation and large-scale planting of kumquat seedlings and provide a reliable basis for seedling quality control.

[0032] Providing technical support for the protection of kumquat variety rights: This invention provides an objective identification method based on DNA sequence differences for the examination of variety rights and the handling of infringement disputes for 'Guizao Hongyouju'. The test results are not affected by environmental factors and have legal evidentiary value, filling the technical gap of CAPS molecular markers specific to kumquat varieties. Attached Figure Description

[0033] Figure 1 To use IGV software to visually validate the candidate site chr6:26487151-26487152;

[0034] Figure 2 This is a schematic diagram illustrating the detection principle of the CAPS molecular marker of the present invention;

[0035] Figure 3 The image shows a 1% agarose gel electrophoresis result of PCR amplification of genomic DNA from 24 kumquat samples using primers shown in SEQ ID NO.2 and SEQ ID NO.3.

[0036] Figure 4 2% agarose gel electrophoresis was performed to identify the PCR amplification products of CAPS molecular marker primer pairs from 24 kumquat materials by restriction endonuclease Tsp45Ⅰ. Detailed Implementation

[0037] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are only used to help understand the present invention and should not be regarded as limiting the scope of protection of the present invention. Unless otherwise specified, the technical means used in the present invention are all methods known to those skilled in the art; the instruments, materials and reagents used, unless otherwise specified, can be obtained commercially.

[0038] Example 1:

[0039] InDel site screening and CAPS molecular marker development for the identification of 'Guizao Hongyouju'

[0040] In this embodiment, in order to obtain molecular markers that can specifically identify the 'Guizao Youju' variety, it is first necessary to screen for DNA variation sites that are unique to 'Guizao Hongyouju' compared to other kumquat varieties / strains at the whole genome level.

[0041] It should be noted that the 24 kumquat leaf materials used in this embodiment were all collected from the resource nursery of the Guilin Special Crops Research Institute in Guangxi. Specific material information is shown in Table 1, including 24 varieties / strains: 'Guizao Kumquat', 'Jintan', 'Seedless Crispy-skinned Kumquat', 'Crispy Honey Kumquat 1', 'Crispy Honey Kumquat 2', 'Crispy-skinned Kumquat', 'Rongan Jintan', 'Smooth-skinned Kumquat', 'Luowen', 'Daguo Luofu', 'Guijingan No. 2', 'Guijingan No. 1', 'Ningbo Luowen', 'Fuyuan Kumquat', 'Jintan (Liuyang)', 'Changshou Kumquat', 'Jintan (Ningbo)', 'Wenguangju', 'Jintan (Lanshan)', 'Sijiju', 'Guitian Kumquat', 'Jintan (Wenzhou)', 'Luofu (Ningbo)', and 'Wild Kumquat'.

[0042] 1 Guizao Kumquat Golden Bullet (Citrus crassifolia) Meiwa Kumquat 2 Golden Bullet Golden Bullet (Citrus crassifolia) Meiwa Kumquat 3 Seedless Crispy Kumquat Golden Bullet (Citrus crassifolia) Meiwa Kumquat 4 Crispy Honey Kumquat 1 Golden Bullet (Citrus crassifolia) Meiwa Kumquat 5 Crispy Honey Kumquat 2 Golden Bullet (Citrus crassifolia) Meiwa Kumquat 6 Crispy Kumquat Golden Bullet (Citrus crassifolia) Meiwa Kumquat 7 Rong'an Gold Bullet Golden Bullet (Citrus crassifolia) Meiwa Kumquat 8 Smooth skin kumquat Golden Bullet (Citrus crassifolia) Meiwa Kumquat 9 Ribbed Ribbed (Citrus japonica) Marumi Kumquat 10 Big Fruit Luofu Citrus margarita Nagami Kumquat 11 Gui Jingan No. 2 Golden Bullet (Citrus crassifolia) Meiwa Kumquat 12 Gui Jingan No. 1 Golden Bullet (Citrus crassifolia) Meiwa Kumquat 13 Ningbo Ribbed Ribbed (Citrus japonica) Marumi Kumquat 14 Fu Yuan Kumquat Golden Bullet (Citrus crassifolia) Meiwa Kumquat 15 Golden Bullet (Liuyang) Golden Bullet (Citrus crassifolia) Meiwa Kumquat 16 Longevity Kumquat Longevity Kumquat (Citrus obovata) Changshou Kumquat 17 Golden Bullet (Ningbo) Golden Bullet (Citrus crassifolia) Meiwa Kumquat 18 Wen Guangju Longevity Kumquat (Citrus obovata) Changshou Kumquat 19 Golden Bullet (Lanshan) Golden Bullet (Citrus crassifolia) Meiwa Kumquat 20 Four Seasons Orange Citrus microcarpa Calamondin 21 Cinnamon kumquat Golden Bullet (Citrus crassifolia) Meiwa Kumquat 22 Golden Bullet (Wenzhou) Golden Bullet (Citrus crassifolia) Meiwa Kumquat 23 Luofu (Ningbo) Golden Bullet (Citrus crassifolia) Meiwa Kumquat 24 wild kumquat Hong Kong Kumquat (Citrus hindsil) Hongkong Kumquat

[0043] In this embodiment, genomic DNA was extracted from the 24 kumquat samples and whole-genome resequencing was performed. The raw sequencing data was filtered to obtain Clean Reads. Further, the filtered Clean Reads were aligned to the Hong Kong kumquat reference genome (Mini_citrus.chromosome.fa, ​​https: / / zenodo.org / record / 5748662) using BWA-MEM2 (v2.2.1) software. GATK (v4.6) was used for variant detection and hard filtering to preliminarily obtain variant site information for each sample relative to the reference genome.

[0044] It is worth mentioning that, due to the massive number of variant sites generated by whole-genome resequencing, efficiently screening out variant sites unique to 'Guizao Hongyouju' from among numerous variants is one of the technical challenges in CAPS marker development. To address this, this invention further uses a Python script to specifically screen the aforementioned variant detection results, identifying specific variant sites that exist only in 'Guizao Hongyouju' and are not present in the other 23 kumquat materials. After obtaining candidate sites, the comparison results of the candidate sites are further visualized and verified using IGV software to confirm the authenticity and reliability of the candidate sites.

[0045] Through the above screening and verification, the inventors of this invention discovered a 2bp (TA) heterozygous deletion in 'Guizao Hongyouju' at positions 26,487,151 to 26,487,152 on chromosome 6 of the Hong Kong kumquat reference genome. This deletion is located in the CDS region of the AAR3 (Fh6g26870.1) gene, leading to premature termination of protein translation. The nucleotide sequence of the deleted fragment is shown in SEQ ID NO.1, specifically: TTATATATAGGAAAGTCTTCTTCCCCGATCAACTTGGAGATAGGAACGAGTTGAGAATAGCCCTGCAAAGCCCTTTGATAGGCAACCTTCAACAGCACAAGGAGACTTTGCCGAGCCTAATGGACTATTGTGTCACTATTTCCATACAATCATCACCAGAACTCCCGGGGGGATTTTCTTCCTGGTTTACCGGTCTAGCAACTTGTCTGCTTCTCTTGGATATGTGATTGT.

[0046] Furthermore, to determine whether this specific InDel site is suitable for development as a CAPS molecular marker, the inventors of this invention used TBtools software to extract 500bp (1000bp total) of genomic sequence upstream and downstream of the InDel site and imported it into SnapGene software for sequence annotation and restriction enzyme site analysis. The analysis results showed that the deletion of this 2bp (TA) in 'Guizao Hongyouju' resulted in the formation of the restriction endonuclease Tsp45Ⅰ restriction site (GTCAC) after reassembly of the sequences on both sides of the deletion; other kumquat varieties without this deletion did not possess this restriction site. The detection principle of this CAPS molecular marker is as follows: Figure 1 As shown.

[0047] Based on the above sequence analysis results, the inventors of this invention further used the Primer3 Plus online tool (https: / / www.primer3plus.com / ) to design specific PCR amplification primers on both sides of the InDel site. The final obtained forward primer nucleotide sequence is shown in SEQ ID NO.2 (CTTCCCCGATCAACTTGGAGA), and the reverse primer nucleotide sequence is shown in SEQ ID NO.3 (TCCACAAGATTGGGATTCTGAA). The expected size of the amplification product is 448 bp.

[0048] Based on the 2bp (TA) heterozygous deletion at loci 26,487,151 to 26,487,152 on chromosome 6 of the 'Guizao Hongyouju' variety, this invention develops a specific CAPS molecular marker for identifying 'Guizao Hongyouju'. The core of this marker is that 'Guizao Hongyouju' has a Tsp45Ⅰ restriction site due to this heterozygous deletion, allowing PCR amplification products to be recognized and cleaved by Tsp45Ⅰ; while non-'Guizao Hongyouju' varieties, lacking this deletion, cannot have their PCR amplification products cleaved by Tsp45Ⅰ. Therefore, accurate identification of 'Guizao Hongyouju' can be achieved through the electrophoretic band polymorphism of the restriction products.

[0049] Example 2:

[0050] PCR amplification of CAPS molecular markers for identification of 'Guizao Hongyouju'

[0051] In this embodiment, the primer pair shown in SEQ ID NO.2 and SEQ ID NO.3 designed in Example 1 was used to perform PCR amplification on 24 kumquat materials to verify the specificity and amplification efficiency of the primer pair.

[0052] It should be noted that the genomic DNA of the 24 kumquat samples in this embodiment was extracted and used for later use. This invention does not impose any particular limitation on this, as long as the genomic DNA that meets the requirements for PCR amplification can be obtained.

[0053] In this embodiment, the PCR amplification reaction system is 30 μL, and the specific preparation is as follows: 15 μL of 2×Rapid Taq MasterMix, 1 μL of 10 μM forward primer (SEQ ID NO.2), 1 μL of 10 μM reverse primer (SEQ ID NO.3), 1.5 μL of template DNA, and ddH2O to make up to 30 μL.

[0054] The PCR reaction volume is 30 μL:

[0055] DNA 1.5 upstream primer 1 Downstream primer 1 2×Rapid Taq Master Mix 15 <![CDATA[ddH2O]]> Add to 30

[0056] In this embodiment, the PCR amplification reaction program is as follows: pre-denaturation at 95°C for 2 min; then 34 cycles of reaction are performed, each cycle including denaturation at 95°C for 20 s, annealing at 58°C for 30 s, and extension at 72°C for 20 s; after the cycle, final extension at 72°C for 5 min; and finally stored at 4°C.

[0057] After PCR amplification, take an appropriate amount of amplification product and perform electrophoresis using a 1% agarose gel. Observe and record the electrophoresis results under a gel imaging system.

[0058] Electrophoresis results as follows Figure 2 As shown. By Figure 2 As can be seen, when PCR amplification of genomic DNA from 24 kumquat materials was performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3, all tested materials obtained a single specific amplification band of approximately 448 bp in size. This indicates that the primer pairs designed in this invention have good amplification specificity and stability in different kumquat varieties / strains, and no non-specific amplification products were generated.

[0059] Example 3:

[0060] Enzyme digestion and result interpretation of CAPS molecular markers used for identification of 'Guizao Hongyouju'

[0061] In this embodiment, the PCR amplification products of 24 kumquat materials obtained in Example 2 were subjected to restriction endonuclease digestion to verify the identification effect of the CAPS marker on 'Guizao Hongyouju'.

[0062] It should be noted that, since 'Guizao Hongyouju' is in a heterozygous deletion state at the target site (i.e., one chromosome carries the TA base and the other chromosome lacks the TA base), only a portion of the DNA molecules in its PCR amplification product have the Tsp45Ⅰ restriction site (GTCAC). Therefore, after restriction enzyme digestion, there should be both cleaved and uncleaved fragments present, showing three bands.

[0063] In this embodiment, the enzyme digestion reaction system was 20 μL, and the specific preparation was as follows: Take 17 μL of the PCR amplification product obtained in Example 2, add 2 μL of 10×Cut One Color Buffer, 1 μL of restriction endonuclease Tsp45Ⅰ (recognition sequence 5'-GTCAC-3'), and add water to a total volume of 20 μL. The enzyme digestion reaction conditions were: incubation at 65℃ for 45 min.

[0064] After the enzyme digestion reaction was completed, an appropriate amount of the digestion product was taken and detected by electrophoresis on a 2% agarose gel at 100V for 40 minutes. The digestion bands were then observed and recorded using a gel imaging system. The digestion results are as follows: Figure 3 As shown.

[0065] It is worth mentioning that, based on the polymorphism of the electrophoretic bands of the enzyme digestion products, the results can be judged according to the following criteria:

[0066] (1) If the enzyme digestion product shows three DNA fragments of 112bp, 336bp and 448bp, it indicates that the test material is heterozygous at the InDel site, and the test material is determined to be 'Guizao Hongyouju'.

[0067] (2) If the enzyme digestion product only presents a 448bp DNA fragment, it indicates that the test material is homozygous and not deleted at the InDel site, and the test material is determined to be a non-'Guizao Hongyouju' variety.

[0068] Furthermore, from Figure 3 The electrophoresis results show that the 'Guizao Hongyouju' sample (numbered according to 'Guizao Jinju' in Table 1, i.e. 'Guizao Hongyouju') stably showed three characteristic bands of 112bp, 336bp and 448bp after enzyme digestion; while the remaining 23 samples of kumquat varieties / strains that were not 'Guizao Hongyouju' only showed one band of 448bp after enzyme digestion, indicating that their amplification products could not be cleaved by Tsp45Ⅰ at all.

[0069] Furthermore, to verify the accuracy and reliability of the CAPS molecular marker and identification method described in this invention, a blind test was performed on 24 kumquat samples in Table 1 using the above method. The verification results are as follows: Figure 4 As shown. From Figure 4 It can be seen that the 'Guizao Hongyouju' sample (which corresponds to 'Guizao Jinju' in Table 1, i.e. 'Guizao Hongyouju') stably showed three characteristic bands of 112bp, 336bp and 448bp after enzyme digestion; while the other 23 samples of kumquat varieties / strains that were not 'Guizao Hongyouju' only showed one band of 448bp after enzyme digestion, indicating that their amplification products could not be cleaved by Tsp45Ⅰ at all.

[0070] The above identification results are completely consistent with the known varietal source information of each material, indicating that the CAPS molecular marker and identification method provided by this invention has an accuracy of 100% in the 24 tested kumquat materials, and has good specificity, stability and reliability.

[0071] Based on the results of Examples 1 to 3, this invention successfully developed a CAPS molecular marker based on the heterozygous deletion of 2bp (TA) at loci 26,487,151 to 26,487,152 on chromosome 6 of 'Guizao Hongyouju'. This marker can be clearly distinguished from other kumquat varieties / strains by PCR amplification and Tsp45I restriction enzyme digestion at the agarose gel electrophoresis level, thus achieving accurate identification of 'Guizao Hongyouju'.

[0072] All reagents used in the above embodiments (such as 2×Rapid Taq Master Mix, restriction endonuclease Tsp45Ⅰ, 10×Cut One Color Buffer, etc.) can be obtained through conventional commercial channels; the instruments and equipment involved (such as PCR instruments, gel imaging systems, electrophoresis apparatus, etc.) are all routine equipment in molecular biology laboratories. Experimental methods not specified in the embodiments can be performed according to the operating instructions provided by the instrument or reagent manufacturer, or according to conventional experimental manuals known in the art. The 24 kumquat materials used in this invention were all collected from the resource nursery of the Guilin Special Crops Research Institute in Guangxi; the method of obtaining these materials does not constitute a limitation on this invention.

[0073] Those skilled in the art should understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, or improvements made to the above embodiments within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A CAPS molecular marker for identifying 'Guizao Hongyouju', characterized in that, The marker is located at positions 26,487,151 to 26,487,152 on chromosome 6 of the Hong Kong kumquat genome; 'Guizao Hongyouju' has a 2bp heterozygous deletion at this site, which causes the sequences on both sides of the breakpoint to be reassembled to form a restriction endonuclease Tsp45Ⅰ cleavage site; the nucleotide sequence of the deleted fragment is shown in SEQ ID NO.

1.

2. A primer pair for detecting the CAPS molecular marker of claim 1, characterized in that, The forward primer nucleotide sequence of the primer pair is shown in SEQ ID NO. 2, and the reverse primer nucleotide sequence is shown in SEQ ID NO.

3.

3. The application of the primer pair according to claim 2 in the identification of 'Guizao Hongyouju'.

4. The application according to claim 3, characterized in that, The identification process includes the following steps: (1) Using the genomic DNA of the kumquat to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; (2) The amplification product was digested with the restriction endonuclease Tsp45Ⅰ; (3) If the enzyme digestion product shows three DNA fragments of 112bp, 336bp and 448bp, the material to be tested is determined to be 'Guizao Hongyouju'; if the enzyme digestion product shows only one DNA fragment of 448bp, the material to be tested is determined to be a variety other than 'Guizao Hongyouju'.

5. A method for identifying 'Guizao Hongyouju', characterized in that, Includes the following steps: (1) Extract genomic DNA from the kumquat tree to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 2 to obtain the amplification product; (3) The amplification product obtained in step (2) was digested with the restriction endonuclease Tsp45Ⅰ; (4) Electrophoresis was performed on the enzyme digestion products, and the polymorphism of the enzyme digestion bands was used to determine whether the material to be tested was 'Guizao Hongyouju'; If the enzyme digestion product shows three DNA fragments of 112bp, 336bp and 448bp, then the material to be tested is determined to be 'Guizao Hongyouju'. If the enzyme digestion product only shows a 448bp DNA fragment, the material to be tested is determined to be a variety other than 'Guizao Hongyouju'.

6. The method according to claim 5, characterized in that, The PCR amplification reaction system described in step (2) is 30 μL, including: 15 μL of 2×RapidTaqMasterMix, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 1.5 μL of template DNA, and ddH2O to make up to 30 μL.

7. The method according to claim 5 or 6, characterized in that, The PCR amplification reaction program in step (2) is as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 20 s, 58℃ annealing for 30 s, 72℃ extension for 20 s, for a total of 34 cycles; 72℃ final extension for 5 min.

8. The method according to any one of claims 5-7, characterized in that, The enzyme digestion reaction system in step (3) is 20 μL, including: 17 μL of PCR amplification product, 2 μL of 10×CutOneColorBuffer, and 1 μL of restriction endonuclease Tsp45Ⅰ; the enzyme digestion conditions are incubation at 65℃ for 45 min.

9. The method according to any one of claims 5-8, characterized in that, The electrophoresis detection in step (4) uses 2% agarose gel and electrophoresis at 100V for 40 minutes.

10. A reagent kit for identifying 'Guizao Hongyouju', characterized in that, It contains the primer pair as described in claim 2 and the restriction endonuclease Tsp45Ⅰ.

Images