A molecular marker of a wheat tillering angle major gene site qta.nau-4b, a primer pair thereof and application thereof

Abstract

This invention belongs to the field of crop breeding, specifically relating to a major gene locus for wheat tillering angle. Qta.nau-4B Molecular markers, their primer pairs, and applications. The molecular marker WGRC8324 is associated with the gene locus. Qta.nau-4B Tight linkage. The upstream and downstream primer sequences for amplifying the molecular marker are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. Using this primer pair, the wheat genomic DNA to be tested was amplified, and the genotype was determined by the size of the amplification product: the 227 bp product was the carrier. Qta.nau-4B The 213 bp product does not carry this gene locus. This invention utilizes the aforementioned molecular marker primers to rapidly identify whether a test plant contains [the gene locus]. Qta.nau-4B Gene loci can be efficiently screened for plants carrying target gene loci, which can be used for the genetic improvement of wheat tillering angle, thereby accelerating the breeding process of new wheat varieties with ideal plant type.

Description

Technical Field

[0001] This invention belongs to the field of crop breeding, specifically relating to a molecular marker for the major gene locus Qta.nau-4B of wheat tillering angle, its primer pair, and its application. Background Technology

[0002] Wheat plant architecture is a core agronomic trait determining canopy light utilization efficiency and yield potential. Tiller angle, the angle between the lateral tillers and the perpendicular bisector of the plant, reflects the spatial spread of the above-ground parts. As a key component of plant architecture, the tiller angle directly affects canopy distribution, ventilation and light penetration, and planting density. An excessively large tiller angle can lead to canopy shading and increased basal humidity, thus exacerbating soil-borne diseases such as sheath blight and stem rot. Conversely, an excessively small tiller angle restricts light interception area and reduces canopy biomass accumulation. A suitable tiller angle improves canopy light conditions, helps increase planting density, and increases the number of effective ears per unit area. Therefore, breeding wheat varieties with a moderate tiller angle is of great significance for achieving synergistic improvement in high yield, disease resistance, and efficient resource utilization.

[0003] Tillering angle is a typical quantitative trait, controlled by multiple genes and easily influenced by the environment. Traditional phenotypic selection is not only time-consuming and inefficient, but also makes it difficult to accurately determine the genetic composition of individual plants in early generations. With the development of molecular biology and genomics, marker-assisted selection (MAS) has become an important means to improve the efficiency of quantitative trait breeding. By locating the major quantitative trait loci (QTLs) controlling the target trait and developing molecular markers closely linked to them, genotypic screening of a large number of breeding materials can be performed at the seedling stage or early generations, thereby significantly shortening the breeding cycle and improving selection accuracy.

[0004] Researchers both domestically and internationally have conducted QTL mapping studies on tillering angle or related plant architecture traits in various crops. In rice, major genes such as TAC1 (Tiller Angle Control 1) and LAZY1 have been cloned, and corresponding functional markers have been developed for molecular breeding of ideal plant architecture. In wheat, due to its large genome (approximately 17 Gb), high proportion of repetitive sequences, and complex allohexaploid genetic background, the fine mapping of tillering angle-related QTLs and the development of functional markers have lagged behind. Previous studies have detected QTL loci related to tillering angle on different wheat chromosomes, but most loci have low explanatory phenotypic variation rates, insufficient genetic stability, or lack practical molecular markers that are tightly linked to target genes and applicable to conventional PCR platforms, limiting the direct application of these QTL loci in breeding practice.

[0005] More importantly, most reported wheat tillering angle QTLs are based on temporary mapping population localization, with a relatively large genetic distance between the marker and the target gene (often greater than 5 cM). This results in a high recombination frequency in the breeding population, leading to a significant risk of false positives or false negatives in marker-assisted selection. Currently, there is a lack of practical molecular markers that co-segregate or are closely linked to the reported major tillering angle QTL loci on chromosome 4B and can be stably used for routine PCR detection. Therefore, identifying major tillering angle QTL loci in wheat, developing closely linked molecular markers, and establishing an efficient and low-cost MAS (Magnetic Acoustic Marker System) technology are of significant theoretical and practical value for promoting molecular design breeding of ideal wheat plant types. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the purpose of this invention is to provide a molecular marker for the major gene locus Qta.nau-4B in wheat tillering angle and its application.

[0007] Another object of the present invention is to provide primer pairs for the molecular marker and their applications.

[0008] Another object of the present invention is to provide a kit containing the molecular marker primers and its application.

[0009] The fourth objective of this invention is to provide a molecular marker identification method for the major gene locus Qta.nau-4B of wheat tillering angle and its application.

[0010] The fifth objective of this invention is to provide a method for screening wheat with an ideal tillering angle.

[0011] To address the aforementioned technical problems, this invention provides a primer pair for the molecular marker of the major wheat tillering angle gene locus Qta.nau-4B. The primer pair includes an upstream primer WGRC8324-F and a downstream primer WGRC8324-R. The nucleotide sequence of the upstream primer WGRC8324-F is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer WGRC8324-R is shown in SEQ ID NO.2.

[0012] This invention provides a molecular marker WGRC8324 for the major tillering horn gene locus Qta.nau-4B in wheat. Using the primers described above, the genomic DNA of the wheat sample is amplified, and the amplification products are separated by electrophoresis. A 227 bp band or a 213 bp band indicates the molecular marker WGRC8324 for the major tillering horn gene locus Qta.nau-4B. This molecular marker is co-dominant and tightly linked to Qta.nau-4B. A 227 bp band indicates the presence of Qta.nau-4B in the wheat sample; a 213 bp band indicates the absence of Qta.nau-4B. Wheat materials containing the major tillering horn gene Qta.nau-4B have smaller tillering horns than wheat materials without this gene.

[0013] This invention provides a reagent or kit for detecting the major gene locus Qta.nau-4B in wheat tillering angle, wherein the reagent or kit contains the primer pair described above or the molecular marker WGRC8324 described above.

[0014] This invention provides a molecular marker detection method for the major gene locus Qta.nau-4B in wheat tillering angle, comprising the following steps: using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using the upstream primer WGRC8324-F and the downstream primer WGRC8324-R of the molecular marker WGRC8324 shown in SEQ ID NO.1 and SEQ ID NO.2, and then the amplification products are separated by electrophoresis. If the electrophoresis result shows a 227 bp band, the wheat to be tested contains Qta.nau-4B; if the electrophoresis result shows a 213 bp band, the wheat to be tested does not contain Qta.nau-4B; if the electrophoresis result shows two bands of 227 bp and 213 bp, it indicates that the wheat material to be tested is in a heterozygous state at this locus.

[0015] On the other hand, the present invention provides the application of primer pairs containing the above-mentioned primers or molecular marker WGRC8324 or reagents or kits containing the above-mentioned reagents or kits in identifying the major tillering angle gene locus Qta.nau-4B in wheat germplasm resources.

[0016] On the other hand, the present invention provides the application of the above-mentioned primer pair or the above-mentioned molecular marker WGRC8324 or the above-mentioned reagent or kit in the selection of wheat products with the major tillering angle gene locus Qta.nau-4B.

[0017] On the other hand, the present invention provides the application of the above-mentioned primer pair or the above-mentioned molecular marker WGRC8324 or the above-mentioned reagent or kit in screening ideal tillering wheat. Wheat material containing wheat tillering horn major effect Qta.nau-4B has a smaller tillering horn than wheat material without wheat tillering horn major effect Qta.nau-4B.

[0018] Furthermore, the present invention provides that when wheat genomic DNA is amplified using the above-mentioned primer pair and electrophoresed, only a 227 bp band is obtained, which indicates that the wheat to be tested is wheat with a major tillering angle Qta.nau-4B.

[0019] On the other hand, the present invention provides the application of the above-mentioned primer pair or the above-mentioned molecular marker WGRC8324 or the above-mentioned reagent or kit in cloning the major gene locus Qta.nau-4B in tiller horn.

[0020] On the other hand, the present invention provides the application of the above-mentioned primer pair or the above-mentioned molecular marker WGRC8324 or the above-mentioned reagent or kit in the breeding of ideal wheat plant type. Wheat materials containing wheat tillering angle major effect Qta.nau-4B have a smaller tillering angle than wheat materials without wheat tillering angle major effect Qta.nau-4B.

[0021] Beneficial effects

[0022] This invention utilizes a recombinant inbred line population of Huaimai 33 / Yangmai 17 to conduct three-year field trials in 2024, 2025, and 2026, identifying quantitative trait loci (QTLs) related to tillering angle at the seedling and mature stages of wheat. Through whole-genome scanning, the major-effect QTL Qta.nau-4B controlling wheat tillering angle was discovered on chromosome 4B. This QTL exhibits good reproducibility, was detected in all three environments, explains 17.5% of the phenotypic variation, and has a strong genetic effect on tillering angle at both the seedling and mature stages, demonstrating significant breeding value. This invention also discloses practical molecular markers for Qta.nau-4B, their primer pairs, and their applications, which will help promote the rapid application of Qta.nau-4B in breeding, achieving genetic improvement of wheat plant architecture and yield potential. Compared to existing technologies, this invention has the following significant advantages:

[0023] 1. Strong genetic effect and high breeding value. The Qta.nau-4B locus of this invention can explain 17.5% of the phenotypic variation and can play a significant role in genetic improvement in wheat breeding.

[0024] 2. Accurate detection and convenient operation. WGRC8324 is a codominant marker, which can accurately distinguish between homozygous and heterozygous genotypes. The two characteristic bands (227 bp and 213 bp) differ by 14 bp, which is easily distinguishable in conventional polyacrylamide gel electrophoresis. It has the advantages of stable amplification, clear band patterns, and simple result interpretation.

[0025] 3. Saves breeding costs and shortens the breeding cycle. Traditional tiller antler phenotypic identification is time-consuming, labor-intensive, and highly susceptible to environmental influences. This invention can identify the target genotype through DNA testing at the seedling stage, eliminating non-target plants early, significantly reducing the workload of field phenotypic identification, significantly improving selection efficiency, reducing breeding costs, and accelerating the breeding process.

[0026] 4. Reduce linkage baggage. Using molecular marker-assisted selection can accurately track the gene locus Qta.nau-4B, avoiding the introduction of undesirable agronomic traits due to linkage baggage in traditional breeding, and improving selection accuracy.

[0027] 5. Laying the foundation for gene cloning. WGRC8324 is closely linked to Qta.nau-4B and can be used for recombinant identification and fine mapping, providing a key tool for map-based cloning of this gene. Attached Figure Description

[0028] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments will be briefly introduced below.

[0029] Figure 1 Genetic linkage map of WGRC8324 and the major tillering horn gene locus Qta.nau-4B in wheat. The left side shows the molecular markers of the genetic linkage map, the right side shows the genetic distance between markers, and the vertical boxes indicate the confidence intervals of the major tillering horn gene locus Qta.nau-4B.

[0030] Figure 2 Amplification band pattern of WGRC8324. M: Standard molecular weight band of pUC19 / MspI, the value on the left is the standard band size; 1: Huaimai 33, a parental wheat variety containing Qta.nau-4B; 2: Yangmai 17, a parental wheat variety not containing Qta.nau-4B; 3: Nanda 2419, a parental wheat variety containing Qta.nau-4B; 4: Chuanmai 42, a parental wheat variety not containing Qta.nau-4B; 5: NIL, a near-isogenic line constructed by transferring Qta.nau-4B carried by Nanda 2419 into Chuanmai 42. The arrows indicate specific amplified bands.

[0031] Figure 3 Tillering angle of Chuanmai 42 and its near-isogenic line NIL, Qta.nau-4B. **** indicates P < 0.0001. Detailed Implementation

[0032] The technical solution of the present invention will now be described in detail with reference to the accompanying drawings and embodiments. The following embodiments are only used to more clearly illustrate the technical solution of the present invention and are therefore merely examples, not intended to limit the scope of protection of the present invention. Unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. As a professional agricultural research institution, the applicant has long preserved relevant germplasm materials, and the relevant wheat varieties are all publicly available from the market or existing germplasm banks.

[0033] Example 1: Obtaining the molecular marker WGRC8324 of the major gene locus Qta.nau-4B for wheat tillering angle

[0034] (I) Creating a genetic segregating population of the recombinant inbred line Huaimai 33 / Yangmai 17

[0035] Huaimai 33, a compact wheat variety with a small tillering angle, was crossed with Yangmai 17, a loose wheat variety with a large tillering angle. After continuous self-pollination, the F7 recombinant inbred line population, consisting of 231 lines, was obtained through single-seed propagation.

[0036] (II) Constructing a high-density genetic map of the Huaimai 33 / Yangmai 17 recombinant inbred line population

[0037] Genotypic analysis of this population was performed using the wheat 5K liquid phase breeding chip developed in the previous study, yielding 1095 high-quality SNPs (Single nucleotide polymorphisms). Linkage analysis was conducted using QTL IciMapping Version 4.2 software to construct a high-density genetic map of this population, covering 2990.1 cM of the wheat genome.

[0038] (III) Phenotypic Investigation of Tillering Angle in Recombinant Inbred Lines Huaimai 33 / Yangmai 17

[0039] The recombinant inbred line population of Huaimai 33 / Yangmai 17 was planted at the Liuhe Base of Jiangsu Academy of Agricultural Sciences and the Chuzhou Science and Education Innovation Park of Nanjing Agricultural University in 2024, 2025 and 2026. The tillering angle of each line at the seedling stage (late tillering stage) and the mature plant stage (mid-grain filling stage) was investigated using an angle meter. Ten tillers were measured for each line.

[0040] (iv) Mining of tillering angle-related gene loci in the Huaimai 33 / Yangmai 17 recombinant inbred line population

[0041] Based on the high-density genetic map and three-year field phenotypes of the Huaimai 33 / Yangmai 17 recombinant inbred line population, genetic linkage analysis of quantitative trait loci (QTLs) was conducted using MapQTLV6 software. Through whole-genome scanning, the tillering angle QTL Qta.nau-4B was identified on chromosome 4B. This QTL was reproducibly detectable in all three environments, with a LOD of over 9, explaining 17.5% of the phenotypic variation. It also showed strong genetic effects on tillering angle at both the seedling and mature stages, indicating high breeding value.

[0042] (V) Obtaining the Qta.nau-4B linked molecular marker WGRC8324

[0043] DNA was extracted from the parents Huaimai 33 and Yangmai 17 and their recombinant inbred line populations using the SDS method. Sequence variation analysis was performed on the Qta.nau-4B region using the wheat reference genome sequence. Based on the obtained sequence variations, molecular markers were developed using PrimerServer2 software. The genotypes of Huaimai 33 and Yangmai 17 were detected using the obtained molecular markers. For markers that showed polymorphism between the parents, they were further used to detect the genotypes of the recombinant inbred line population.

[0044] The labeling was performed using a PCR amplification method as follows: The PCR reaction system consisted of 12.5 μL of 10× buffer (1.25 μL), 25 mM MgCl2 (0.75 μL), 2.5 mM dNTPs (1 μL), forward and reverse primers (0.2 μM each), Taq polymerase (5 U / μL) (0.1 μL), template DNA (50 ng), and sterile water to a final volume of 12.5 μL. The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 40 s, 56℃ annealing for 40 s, and 72℃ extension for 1 min, repeated 36 times; and a final extension at 72℃ for 10 min. Amplification was performed using an AppliedBiosystems PCR instrument. The amplified products were separated by electrophoresis on an 8% non-denaturing polyacrylamide gel, and then photographed using a UV transilluminator to record the results.

[0045] Finally, the molecular marker WGRC8324 was developed in the Qta.nau-4B region. Genotyping of the Huaimai 33 / Yangmai 17 recombinant inbred line population was conducted using this marker, and linkage analysis of the 4B chromosome molecular marker was performed using QTL IciMapping Version 4.2 software. A genetic map of this chromosome was constructed, clearly showing a genetic distance of 4.5 cM between WGRC8324 and the left SNP locus 4B30022405, and a genetic distance of 2.6 cM between WGRC8324 and the right SNP locus 4B79406064. QTL genetic mapping indicated that WGRC8324 had a LOD of 9.6 and was tightly linked to the tillering horn phenotype. Figure 1 ).

[0046] Example 2: Application of the molecular marker WGRC8324 at the major gene locus Qta.nau-4B in wheat tillering angle

[0047] The molecular marker WGRC8324, representing the major tillering angle gene locus Qta.nau-4B in wheat, was used to detect the genotype of the wheat backbone parent Nanda 2419. The genotype showed a 227 bp band, consistent with that of Huaimai 33, indicating that it carries Qta.nau-4B (…). Figure 2 Using Nanda 2419 as the donor and the loosely cultivated variety Chuanmai 42 as the recurrent parent, hybridization and backcrossing were conducted. Starting from the BC1F1 generation, foreground selection was performed using the molecular marker WGRC8324 to obtain target single plants carrying Qta.nau-4B. These were then backcrossed five times, followed by further self-pollination. Homozygous lines carrying Qta.nau-4B were obtained using the molecular marker WGRC8324 and used as near-isogenic lines (NILs). During this process, rapid generation was performed using an artificial climate chamber. The molecular marker detection method was the same as in Example 1.

[0048] During the 2025-2026 growing season, Chuanmai 42 and its near-isogenic line NIL (Qta.nau-4B) were planted in the field at the Chuzhou Science and Education Innovation Park of Nanjing Agricultural University. Tillering angle surveys showed that the tillering angle of Chuanmai 42 was 35.6°, while that of its near-isogenic line NIL (Qta.nau-4B) was 24.4°. Compared with the recurrent parent Chuanmai 42, the tillering angle decreased by 31.3%, a significant reduction. Figure 3 This demonstrates that the molecular marker WGRC8324 provided by this invention can accurately screen for materials containing Qta.nau-4B, effectively improving the tillering angle of wheat varieties, thereby greatly improving breeding selection efficiency.

[0049] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0050] sequence list

[0051] <110> Nanjing Agricultural University

[0052] <120> Molecular marker of Qta.nau-4B, a major gene locus for wheat tillering angularity, its primers and applications

[0053] <160> 2

[0054] <210> 1

[0055] <211> twenty one

[0056] <212> DNA

[0057] <213> Artificial sequence

[0058] <220>

[0059] <223> The upstream primer of WGRC8324 is WGRC8324-F

[0060] <400> 1

[0061] AGGTATAGATGAGGCTTCGCT 21

[0062] <210> 2

[0063] <211> 20

[0064] <212> DNA

[0065] <213> Artificial sequence

[0066] <220>

[0067] <223> Downstream primer WGRC8324-R

[0068] <400> 2

[0069] CCGGATGTGTTTTCCCCCAT 20

Claims

1. A primer pair for the molecular marker WGRC8324, which is tightly linked to the major gene locus Qta.nau-4B in wheat tillering angle, characterized in that, It includes an upstream primer WGRC8324-F and a downstream primer WGRC8324-R; the nucleotide sequence of the upstream primer WGRC8324-F is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer WGRC8324-R is shown in SEQ ID NO.

2.

2. A molecular marker WGRC8324 for the major gene locus Qta.nau-4B in wheat tillering angle, characterized in that, The genomic DNA of the wheat to be tested was amplified using the primer pair described in claim 1. The amplification products were separated by electrophoresis. The amplification products showed a 227 bp band or a 213 bp band, which is the molecular marker WGRC8324 of the major tillering horn gene locus Qta.nau-4B in wheat. The molecular marker is a co-dominant marker and is tightly linked to Qta.nau-4B. If the amplification product is a 227 bp band, it indicates that the wheat to be tested contains Qta.nau-4B. If the amplification product is a 213 bp band, it indicates that the wheat to be tested does not contain Qta.nau-4B. Wheat materials containing the major tillering horn gene Qta.nau-4B have a smaller tillering horn than wheat materials without the major tillering horn gene Qta.nau-4B.

3. A reagent or kit for detecting the major gene locus Qta.nau-4B in wheat tillering angle, characterized in that, Contains the primer pair as described in claim 1.

4. A molecular marker detection method for the major gene locus Qta.nau-4B in wheat tillering angle, characterized in that, Includes the following steps: Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the upstream primer WGRC8324-F and the downstream primer WGRC8324-R of the molecular marker WGRC8324 shown in SEQ ID NO. 1 and SEQ ID NO.

2. The amplification products were then separated by electrophoresis. If the electrophoresis result showed a 227 bp band, the wheat to be tested contained Qta.nau-4B; if the electrophoresis result showed a 213 bp band, the wheat to be tested did not contain Qta.nau-4B; if the electrophoresis result showed two bands, 227 bp and 213 bp, it indicated that the wheat material to be tested was in a heterozygous state at that site.

5. The application of the primer pair of claim 1, the molecular marker WGRC8324 of claim 2, or the reagent or kit of claim 3 in identifying the major tillering angle gene locus Qta.nau-4B in wheat germplasm resources.

6. The application of the primer pair of claim 1, the molecular marker WGRC8324 of claim 2, or the reagent or kit of claim 3 in the selection of wheat products with the major tillering angle gene locus Qta.nau-4B.

7. The application of the primer pair of claim 1, the molecular marker WGRC8324 of claim 2, or the reagent or kit of claim 3 in screening ideal tillering pod wheat, characterized in that, Wheat materials containing the major tillering agent Qta.nau-4B have smaller tillering angles than wheat materials without the major tillering agent Qta.nau-4B.

8. The application according to claim 7, characterized in that, If the wheat genomic DNA is amplified using the primer pair described in claim 1 and only one 227 bp band is obtained after electrophoresis, it indicates that the wheat to be tested is wheat with a major tillering angle Qta.nau-4B.

9. The use of the primer pair of claim 1, the molecular marker WGRC8324 of claim 2, or the reagent or kit of claim 3 in cloning the major gene locus Qta.nau-4B in tiller horn.

10. The application of the primer pair of claim 1, the molecular marker WGRC8324 of claim 2, or the reagent or kit of claim 3 in the breeding of ideal wheat plant type, characterized in that, Wheat materials containing the major tillering agent Qta.nau-4B have smaller tillering angles than wheat materials without the major tillering agent Qta.nau-4B.

Images