Alkaline-resistant molecular marker based on zm00001d047309 gene in-del variation and application thereof

Abstract

The present application relates to a kind of based on Zm00001d047309 Alkaline-tolerant molecular marker of corn gene InDel variation and its application belong to the field of biotechnology. Among them, the alkaline-tolerant corn material carries an insertion fragment at the site, and the alkali-sensitive material does not carry the insertion fragment at the site. The variation is located in the genomic region of chromosome 9 of corn B73 reference genome (RefGen_v4) Zm00001d047309 , which is significantly related to the alkaline-tolerant phenotype of corn. A specific PCR primer set is designed based on the variation site, and the primer set includes the primers shown as SEQ ID NO. 2 and SEQ ID NO. 3. The primers are used to amplify the corn genomic DNA to be tested, and the amplification results are detected by electrophoresis or sequencing, to determine whether the test material carries an insertion fragment related to alkaline tolerance. The molecular marker can be used for corn alkaline-tolerant germplasm identification, alkaline-tolerant material screening and molecular-assisted breeding.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker for maize alkali tolerance based on the InDel variant of the Zm00001d047309 gene and its application. Background Technology

[0002] Soil salinization is one of the important abiotic stress factors affecting maize (Zea mays L.) production and food security. In particular, under alkaline stress, a high pH environment not only causes ion toxicity and osmotic stress, but also further damages the growth and development of plant roots, inhibits plant growth and development, and ultimately leads to a decline in yield and quality.

[0003] Alkali tolerance in maize is a typical complex quantitative trait, regulated by multiple genes and easily affected by environmental conditions. Traditional field identification methods suffer from problems such as long cycles, significant environmental interference, and low identification efficiency, making it difficult to meet the needs of modern maize molecular breeding and rapid selection. Therefore, developing functional molecular markers that are closely linked to maize alkali tolerance, stable, reliable, and easy to operate is of great significance for the identification of alkali-tolerant maize germplasm resources, screening of superior hybrids, and molecular-assisted breeding.

[0004] Currently, there are still few practical molecular markers for breeding alkali-tolerant maize, especially insertion / deletion markers that can directly distinguish between alkali-tolerant and alkali-sensitive maize inbred lines. Therefore, identifying specific genetic variations significantly associated with alkali tolerance and developing stable and efficient molecular markers based on these variations has significant theoretical and practical value. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker for maize alkali tolerance based on the InDel variation of the Zm00001d047309 gene and its application. This molecular marker can directly distinguish between alkali-tolerant hybrids and alkali-sensitive hybrids, and can significantly improve the efficiency of identification and screening of alkali-tolerant maize germplasm, providing a technical basis for the identification of alkali-tolerant maize germplasm resources, screening of superior hybrids, and molecular-assisted breeding.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] One of the objectives of this invention is to provide an InDel variant associated with alkali tolerance in maize, which is located at 129934302 bp and 129934415 bp on chromosome 9 of the maize B73 reference genome (RefGen_v4), within the genomic region of gene Zm00001d047309.

[0008] The second objective of this invention is to provide a candidate gene, Zm00001d047309, that regulates genetic variation in maize alkali tolerance. GWAS was used to locate a candidate region significantly associated with maize alkali tolerance, with a significantly associated SNP (rs_9_124233250) located near the candidate gene Zm00001d047309. Further sequence comparison analysis of this region revealed insertion variants at 129934302 bp and 129934415 bp, which showed a more direct correlation with the alkali-tolerant phenotype. A PCR molecular marker was developed based on this insertion variant.

[0009] The third objective of this invention is to provide a molecular marker related to alkali tolerance in maize. This molecular marker can be used to detect the presence or absence of the aforementioned inserted fragment in maize materials, thereby distinguishing between alkali-tolerant and alkali-sensitive maize materials. The molecular marker corresponds to the nucleic acid sequence of chromosome 9, 129934232-129934678 bp, of the maize B73 reference genome (RefGen_v4), as shown in SEQ ID NO.1.

[0010] The nucleotide sequence of SEQ ID NO.1 is as follows:

[0011] SEQ ID NO.1:

[0012] 129934232(bp)-GAGAACCATACTTATGCACTATTGTGGTGGATTGAACCTTAATATTGTGTGGTACTTTTAATATTGTGTGGATAGGGATGTCGATTAGATGTGGTTTGATATATTCTGCGACATGGATTGAAAATATATTTGTGATTGACGGTCATCATGTCGTTGATATATATGTGCATGTAGTCAACGTGTTAGTTTTATTTACAGGTTTTGGAAACCTTACCGTGCAG GGGAGGTGTTGTCGAAGAACATTGCCTTATTGTGTATATCACGTAACAATGTCCTAGAAGGGATAGAGTCATTGAATGACTTTTTAGTGAATAACAGTGCCTTCTTGTGTATATCACATAACAATCTCTCATATAGTAGATAGTGTATCTCATAGAAGAGAAATGTTGTTCACCAAAAATGAGAATTTTCTTGAAGGAATTAATCCATGAAGAGTTACAGATCGAT-129934678 (bp)

[0013] The fourth objective of this invention is to provide primers for amplifying the aforementioned molecular markers. The primers are preferably designed based on conserved sequences flanking the insert fragment, and the nucleotide sequences of the left and right primers are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0014] Left primer F (SEQ ID NO.2): GAGAACCATACTTATGCACTA;

[0015] Right primer R (SEQ ID NO.3): ATCGATCTGTAACTCTTCATGGAT.

[0016] The fifth objective of this invention is to provide a method for identifying the alkali tolerance of maize. This method uses maize genomic DNA as a template and primers containing the nucleotide sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 for PCR amplification, yielding amplification products. The amplification product of maize material without the insert fragment is approximately 447 bp in length; the amplification product of maize material carrying the insert fragments shown in SEQ ID NO. 4 and SEQ ID NO. 5 is approximately 469 bp in length. The two types can be clearly distinguished by 2% agarose gel electrophoresis. The amplified products were analyzed by electrophoresis or sequencing. If the identification results showed that insert fragment 1 (SEQ ID NO. 4) and insert fragment 2 (SEQ ID NO. 5) were present at 129934302 bp and 129934415 bp on chromosome 9 of the maize B73 reference genome (RefGen_v4), respectively, the maize material was alkali-resistant. Conversely, if the identification results showed that the maize material did not contain insert fragment 1 (SEQ ID NO. 4) and insert fragment 2 (SEQ ID NO. 5), the maize material was alkali-sensitive. The nucleotide sequences of insert fragment 1 (SEQ ID NO. 4) and insert fragment 2 (SEQ ID NO. 5) are as follows:

[0017] Insert fragment 1 (SEQ ID NO.4):

[0018] TACTTTTAATATTGTGTGG

[0019] Insert fragment 2 (SEQ ID NO.5):

[0020] GTT

[0021] The sixth objective of this invention is to provide a PCR amplification system and amplification procedure for the primers SEQ ID NO.2 and SEQ ID NO.3 of the above-mentioned molecular markers.

[0022] The PCR amplification system consisted of 25 μL and the following components: 12.5 μL of 2 × Phanta Max Buffer, 0.5 μL of dNTP Mix (10 mM each), 0.5 μL of Phanta Max Super-Fidelity DNA Polymerase, 3 μL of DNA template, 0.5 μL of left primer F (10 μmol / L), 0.5 μL of right primer R (10 μmol / L), and 7.5 μL of ddH2O.

[0023] The PCR amplification program is as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 sec, annealing at 50℃ for 30 sec, extension at 72℃ for 30 sec, for a total of 36 cycles; final extension at 72℃ for 10 min; storage at 4℃.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0025] This invention provides an insertional genetic variation and its molecular marker that is significantly associated with alkali tolerance in maize. This marker can stably distinguish between alkali-tolerant and alkali-sensitive maize materials, providing clear detection results, simple operation, and good reproducibility. It can significantly improve the efficiency of alkali-tolerant maize germplasm identification and screening, providing an effective tool for molecular-assisted breeding of alkali-tolerant maize, and has significant application value and promising prospects for wider application. Attached Figure Description

[0026] Figure 1 The figure shows the results of genome-wide association analysis (GWAS) of alkali tolerance-related traits in maize seedlings in Example 1 of this invention. It shows that the significant associated SNP site rs_124233250 located at 124233250 bp on chromosome 9 of the maize B73 reference genome (RefGen_v4) is significantly associated with alkali tolerance in maize seedlings.

[0027] Figure 2 This is a comparison diagram of the alkali tolerance phenotypes of the Zm00001d047309 gene EMS mutant and wild-type materials under alkaline stress in Example 2 of the present invention, used to illustrate the effect of the functional change of the Zm00001d047309 gene on the alkali tolerance of maize seedlings; among them, the relative survival rate of the EMS mutant under alkaline stress is significantly higher than that of the wild type, indicating that this gene is involved in the regulation of alkali tolerance in maize.

[0028] Figure 3This figure shows the comparison of the relative survival rate (RSR%) of the Zm00001d047309 gene EMS mutant (Zm00001d047309 aa) and wild-type (Zm00001d047309 WT) materials under alkaline stress in Example 2 of this invention. Under alkaline stress, the relative survival rate of the mutant was significantly higher than that of the wild type, indicating that impaired function of the Zm00001d047309 gene increases alkali tolerance in maize seedlings, suggesting that this gene is involved in the regulation of maize alkali tolerance. In the figure, "**" indicates extremely significant differences.

[0029] Figure 4 The image shows the agarose gel electrophoresis results of PCR amplification of different maize varieties using primers SEQ ID NO.2 and SEQ ID NO.3 in Example 4 of this invention. The left side shows the 2000 DNA Marker, with 1-10 corresponding to maize varieties A619, CML115, GEMS62, DAN3130, CIMBL147, CIMBL111, D863F, CIMBL6, DH373, and JI63, respectively. Larger bands represent those carrying the insert fragment, while smaller bands represent those not carrying the insert fragment.

[0030] Figure 5 This document describes the sequence alignment differences and alkali resistance performance of A619, CML115, GEMS62, DAN3130, CIMBL147, CIMBL111, D863F, CIMBL6, DH373, and JI63 in Example 4 of this invention. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments; it should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the scope of protection of the invention.

[0032] Example 1: GWAS localization of candidate regions associated with alkali tolerance in maize seedlings

[0033] This embodiment illustrates a method for obtaining candidate regions related to alkali tolerance in maize seedlings.

[0034] 1) Test materials

[0035] Two hundred maize inbred lines widely planted in the Huang-Huai-Hai region were selected as the population material for association analysis.

[0036] 2) Alkali stress treatment

[0037] Select plump, uniformly sized corn seeds, sterilize them with 70% anhydrous ethanol for 30 seconds, then place them in a 10% bleach solution and shake well for 30 minutes. Wash them 8 to 10 times with distilled water. Sow the treated seeds in a substrate with a 1:1 volume ratio of nutrient soil to vermiculite for cultivation.

[0038] Each material was divided into a control group (CK) and an alkali treatment group (AT), with three biological replicates per treatment. Culture conditions were: 18 h light / 6 h dark, light temperature 27°C, dark temperature 22°C, and relative humidity 60%. At sowing, the control group was watered normally, while the alkali treatment group was directly irrigated daily with a 75 mmol / L alkali solution (NaHCO3 to Na2CO3 molar ratio 5:1, pH 9.0) for 14 consecutive days.

[0039] 3) Phenotypic determination

[0040] After treatment, the relative survival rate (RSR%) of each material under alkali stress was measured. The relative survival rate (RSR%) is the number of surviving plants under alkali stress divided by the number of surviving plants under normal conditions. The relative survival rate is used as the resistance index (RI) to evaluate the alkali tolerance of maize germplasm. In this invention, the alkali tolerance index RI is calculated as follows: RI = RSR = number of surviving plants under alkali stress / number of surviving plants under normal control conditions. Maize germplasm is alkali-tolerant based on the RI: RI ≥ 0.80 is considered alkali-tolerant, and RI < 0.80 is considered alkali-intolerant.

[0041] 4) Genotype data and GWAS analysis

[0042] Genome-wide genotyping was performed using a Maize 48K Bead Chip microarray, yielding 490,548 high-quality SNP markers after quality control. Genome-wide association analysis was conducted using the GAPIT program in R software, employing a multi-site mixture linear model (MLMM) to analyze the original traits and alkali tolerance index under alkali stress, with a p-value ≤ 2.04 × 10⁻⁶. -6 As a threshold for significant association.

[0043] like Figure 1 As shown, the GWAS results revealed a cluster of SNP sites significantly associated with alkali tolerance in maize seedlings. Among them, the SNP site rs_9_124233250 located at 124233250 bp on chromosome 9 of the maize B73 reference genome (RefGen_v4) showed a significant association with the relative survival rate-related trait, making it an important candidate site for further exploration of alkali tolerance-related functional variations.

[0044] 5) Determining the candidate interval

[0045] Based on the linkage disequilibrium decay analysis results of the test population, with r 2 When the threshold is 0.1, the corresponding LD decay distance is approximately 30 kb. Therefore, candidate regions of 30 kb upstream and downstream of the significant SNP rs_9_124233250 were extracted for candidate gene analysis. The results showed that this candidate region contained three annotated genes, among which Zm00001d047309 was located near the significant site, making it one of the important candidate genes for further exploring InDel variants related to maize alkali tolerance and developing molecular markers.

[0046] This embodiment illustrates that by combining maize inbred line association populations with seedling alkali tolerance phenotypes and genome-wide association analysis, candidate genetic regions related to maize alkali tolerance can be effectively identified, providing a foundation for subsequent molecular marker development.

[0047] Example 2: Verification of the alkali tolerance phenotype of the EMS mutant of the Zm00001d047309 gene

[0048] To further verify the correlation between the candidate gene Zm00001d047309 and maize alkali tolerance, EMS mutant materials of this gene and wild-type background materials were selected for seedling alkali tolerance phenotype analysis.

[0049] 1) Experimental materials

[0050] One copy of the EMS mutant of the maize Zm00001d047309 gene was selected, with its wild-type background material used as a control. The EMS mutant was provided by Qilu Normal University. Target site PCR amplification and sequencing verification were performed on the mutant. The results showed that the EMS mutant contained a single-base substitution mutation in the Zm00001d047309 gene, leading to a change in its coding sequence and premature termination.

[0051] 2) Alkali stress treatment

[0052] Plump and uniform seeds were selected, disinfected, soaked, and sown, and then cultured under the same conditions as in Example 1. A control group and an alkali treatment group were set up at the time of sowing. The control group was watered normally, while the alkali treatment group was watered daily with a 75 mmol / L alkali solution. The alkali solution had a NaHCO3 to Na2CO3 molar ratio of 5:1 and a pH of 9.0. Treatment was continued for 14 days, with three biological replicates per treatment.

[0053] 3) Phenotypic determination

[0054] After treatment, the relative survival rates of EMS mutants and wild-type materials under alkaline stress were determined, and the results were statistically analyzed.

[0055] 5) Results Analysis

[0056] like Figure 2 and 3 As shown, the results indicate that under normal conditions, there is no significant difference in growth between the EMS mutant and the wild-type material; however, under alkaline stress, the EMS mutant exhibits an alkali-tolerant phenotype that is significantly different from that of the wild-type, with significantly higher plant height and relative survival rate.

[0057] The above results indicate that functional changes in the Zm00001d047309 gene affect maize seedling alkali tolerance, suggesting that this gene is involved in the regulation of maize alkali tolerance. This further supports the correlation between the genetic variations near Zm00001d047309 located in this invention and maize alkali tolerance, demonstrating the significant application value of this InDel locus. Molecular markers developed based on this locus can be used for the identification of alkali-tolerant maize germplasm resources, screening of alkali-tolerant materials, and molecular-assisted breeding.

[0058] Example 3: Discovery of InDel variants within candidate regions and development of molecular markers

[0059] This embodiment illustrates the discovery of InDel variants related to maize alkali tolerance and the development of their molecular markers.

[0060] 1) Comparative analysis of candidate segment sequences

[0061] Based on the significant associated site rs_9_124233250 obtained from GWAS localization in Example 1, further sequence polymorphism analysis was performed on its candidate region. Maize materials exhibiting significant phenotypic differences under alkaline stress during the seedling stage were selected. PCR amplification, product purification, and sequencing were performed on the candidate genomic region near Zm00001d047309, and the sequences of different materials were compared and analyzed.

[0062] Sequence alignment results showed stable insertion / deletion variants (InDel) at 129934302 bp and 129934415 bp on chromosome 9 of the maize B73 reference genome (RefGen_v4). These variants are located within the candidate region of Zm00001d047309 and correspond to differences in alkali-tolerant phenotypes during the seedling stage of the tested materials.

[0063] 2) Determination of molecular marker regions

[0064] Centered on the InDel site, conserved sequences flanking it were selected as primer design regions to obtain molecular marker regions for detecting the insertion / deletion variant. These molecular markers correspond to the nucleic acid sequence of chromosome 9, 129934232-129934678 bp, of the maize B73 reference genome (RefGen_v4), as shown in SEQ ID NO.1.

[0065] The nucleotide sequence of SEQ ID NO.1 is as follows:

[0066] GAGAACCATACTTATGCACTATTGTGGTGGATTGAACCTTAATATTGTGTGGTACTTTTAATATTGTGTGGATAGGGATGTCGATTAGATGTGGTTTGATATATTCTGCGACATGGATTGAAAATATATTTGTGATTGACGGTCATCATGTCGTTGATATATATGTGCATGTAGTCAACGTGTTAGTTTTATTTACAGGTTTTGGAAACCTTACCGTGCAGGG GAGGTGTTGTCGAAGAACATTGCCTTATTGTGTATATCACGTAACAATGTCCTAGAAGGGATAGAGTCATTGAATGACTTTTTAGTGAATAACAGTGCCTTCTTGTGTATATCACATAACAATCTCTCATATAGTAGATAGTGTATCTCATAGAAGAGAAATGTTGTTCACCAAAAATGAGAATTTTCTTGAAGGAATTAATCCATGAAGAGTTACAGATCGAT

[0067] Primer design

[0068] PCR amplification primers were designed based on the conserved sequences flanking the InDel site for the aforementioned molecular marker region. The primer sequences are as follows:

[0069] Left primer F (SEQ ID NO.2):

[0070] GAGAACCATACTTATGCACTA;

[0071] Right primer R (SEQ ID NO.3):

[0072] ATCGATCTGTAACTCTTCATGGAT.

[0073] InDel mutation type

[0074] When using the above primers to amplify different materials:

[0075] When the test material does not carry the insert fragment, the amplification product length is approximately 447 bp;

[0076] When the test material carries the insert fragment, the amplification product length is approximately 469 bp.

[0077] The inserted fragment sequence is shown in SEQ ID NO.4 and SEQ ID NO.5:

[0078] Insert fragment 1 (SEQ ID NO.4):

[0079] TACTTTTAATATTGTGTGG

[0080] Insert fragment 2 (SEQ ID NO.5):

[0081] GTT

[0082] This embodiment illustrates that by performing fine sequence comparison analysis on GWAS candidate regions, InDel variants related to alkali tolerance in maize seedlings can be further discovered, and PCR molecular markers that are easy to detect can be developed accordingly.

[0083] Example 4: Validation of InDel molecular markers associated with maize alkali tolerance

[0084] This embodiment is used to illustrate the correspondence between the molecular markers described in this invention and the alkali-tolerant phenotypes in maize seedlings, and the feasibility of their application.

[0085] 1) Verification materials

[0086] The following 10 corn samples were selected as the verification subjects:

[0087] A619, CML115, GEMS62, DAN3130, CIMBL147, CIMBL111, D863F, CIMBL6, DH373 and JI63.

[0088] 2) Genomic DNA extraction

[0089] The novel plant genomic DNA extraction kit (centrifuge column type) from Tiangen Company was used. After DNA concentration was measured, it was diluted to 15µg / mL.

[0090] Take 0.1 g of fresh plant tissue, grind thoroughly with liquid nitrogen, add 400 µL of LP1-RNaseA mixture, shake for 1 min, and incubate at room temperature for 10 min. Add 130 µL of LP2, shake for 1 min, centrifuge at 12000 rpm for 5 min, transfer the supernatant to a 96-well filter plate (placed on a deep-well plate), centrifuge at 3550 rpm for 10 min and collect the filtrate. Add 1.5 times the volume of LP3 to the filtrate and immediately shake to mix for 15 s. Transfer all liquid to a 96-well adsorption plate CB3, centrifuge at 3550 rpm for 5 min, and discard the waste liquid. Add 550 µL of PW, centrifuge at 3550 rpm for 5 min, and discard the waste liquid; repeat this washing step once. Centrifuge at 3550 rpm for 5 min, and air dry the adsorption plate at room temperature for several minutes (to remove residual ethanol). Transfer the adsorption plate to a clean deep-well plate, add 50-200 µL TE (pH 7.0-8.5), incubate at room temperature for 2-5 min, and then elute by centrifugation at 3550 rpm for 8 min. The obtained DNA, after concentration and purity testing, is used for subsequent PCR amplification.

[0091] 3) PCR amplification and electrophoresis detection

[0092] Using genomic DNA from each material as a template, PCR amplification was performed using primers shown in SEQ ID NO.2 and SEQ ID NO.3.

[0093] The 25 µL reaction system is shown in Table 1.

[0094] Table 1 Reaction System

[0095]

[0096] The PCR amplification procedure is shown in Table 2.

[0097] Table 2 PCR amplification program

[0098]

[0099] Electrophoresis: 2% agarose gel; 1×TBE buffer; electrophoresis at 70 V and 150 mA for 70 minutes.

[0100] The test results showed that different materials could be divided into two types of amplification:

[0101] The amplified band size was approximately 469 bp.

[0102] The amplified band size was approximately 447 bp.

[0103] Further sequencing analysis of the PCR amplification products yielded the following results: Figure 4 As shown, the results indicate that:

[0104] The material that amplified a band of approximately 469 bp carried insert fragment 1 (SEQ ID NO.4) and insert fragment 2 (SEQ ID NO.5) at 129934302 bp and 129934415 bp on chromosome 9 of the maize B73 reference genome (RefGen_v4).

[0105] The material that amplified approximately 447 bp bands did not carry the inserted fragment at the corresponding site.

[0106] 4) Correspondence between markers and phenotypes

[0107] Comparing the molecular marker detection results with the seedling alkali stress phenotype identification results, it was found that the materials carrying the inserted fragment generally showed stronger alkali resistance under the alkali stress identification conditions used in this embodiment, while the materials without the inserted fragment generally showed weaker alkali resistance.

[0108] Among them, such as Figure 5 As shown, A619, CML115, GEMS62, DAN3130, and CIMBL147 amplified to obtain a band of approximately 469 bp, corresponding to insert fragment 1 (SEQ ID NO.4) and insert fragment 2 (SEQ ID NO.5) at positions 129934302 bp and 129934415 bp, respectively; CIMBL111, D863F, CIMBL6, DH373, and JI63 amplified to obtain a band of approximately 447 bp, corresponding to positions where no insert fragment is carried.

[0109] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of molecular markers related to maize alkali tolerance or primers amplifying said molecular markers in the identification of alkali-tolerant maize germplasm resources, screening of alkali-tolerant maize materials, and molecular-assisted breeding of alkali-tolerant maize, characterized in that, The molecular marker corresponds to the nucleic acid sequence of chromosome 9, 129934232-129934678 bp, of the maize B73 reference genome (RefGen_v4), and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The application according to claim 2, characterized in that, The nucleotide sequences of the left and right primers for amplifying the molecular marker are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively: Left primer F (SEQ ID NO.2): GAGAACCATACTTATGCACTA; Right primer R (SEQ ID NO.3): ATCGATCTGTAACTCTTCATGGAT.

3. A method for identifying the alkali tolerance of corn, characterized in that, Genomic DNA was extracted from the maize material to be tested; Using maize genomic DNA as a template, PCR amplification was performed using left primer F and right primer R to obtain amplification products; The amplified products are then detected by electrophoresis or sequenced.

4. The identification method according to claim 3, characterized in that, Agarose gel electrophoresis was used to identify the PCR amplification results: when the molecular marker size was detected to be 447 bp, it indicated that the maize material did not carry the insert fragment and was an alkali-sensitive material; when the molecular marker size was detected to be 469 bp, it indicated that the maize material carried the insert fragment and was an alkali-resistant material.

5. The identification method according to claim 3, characterized in that, Sequencing analysis results: The results showed that the maize material contained insert fragment 1 at 129934302 bp and insert fragment 2 at 129934415 bp on chromosome 9 of the maize B73 reference genome (RefGen_v4), indicating that the maize material is alkali-resistant. Conversely, if the results showed that the maize material did not contain insert fragment 1 and insert fragment 2, it indicated that the maize material was alkali-sensitive.

6. The identification method according to claim 5, characterized in that, The nucleotide sequences of insert fragment 1 and insert fragment 2 are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

7. The identification method according to claim 3, characterized in that, The PCR amplification system consisted of 25 μL and the following components: 12.5 μL of 2× Phanta Max Buffer, 0.5 μL of dNTP Mix (10 mM each), 0.5 μL of Phanta Max Super-Fidelity DNA Polymerase, 3 μL of DNA template, 0.5 μL of left primer F (10 μmol / L), 0.5 μL of right primer R (10 μmol / L), and 7.5 μL of ddH2O.

8. The identification method according to claim 3, characterized in that, The PCR amplification program is as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 sec, annealing at 50℃ for 30 sec, extension at 72℃ for 30 sec, for a total of 36 cycles; final extension at 72℃ for 10 min; storage at 4℃.

Images