A molecular marker and its use in detecting total nitrogen content in wheat kernels

Abstract

The present application relates to the technical field of plant breeding, and particularly relates to a molecular marker and application thereof in detecting total nitrogen content of wheat kernels. The molecular marker comprises nucleic acid of a nucleotide sequence shown as SEQ ID NO. 1, and a polymorphism exists at the 18th position, and the polymorphism is A / G. The application comprises: (1) predicting or detecting total nitrogen content of wheat kernels; (2) identifying or cultivating wheat varieties with high total nitrogen content of kernels; (3) molecular marker assisted breeding of wheat; (4) improving wheat varieties related to total nitrogen content of kernels; (5) improving germplasm resources of wheat. The molecular marker provided by the present application is based on polymorphism of a specific site, and can be used for genotype detection of total nitrogen content of wheat kernels, and identification and selection of materials with high total nitrogen content, so that time and environmental influence caused by only relying on mature period phenotype determination can be reduced, breeding period and experimental cost can be saved, and the molecular marker has important application value.

Description

Technical Field

[0001] This invention relates to the field of plant breeding technology, and in particular to a molecular marker and its application in detecting the total nitrogen content of wheat grains. Background Technology

[0002] Wheat is a food crop, and the nutritional quality of its grains is one of the goals of variety improvement. The total nitrogen content of wheat grains reflects the accumulation of nitrogenous substances in the grains and is related to their nutritional quality. Wheat quality improvement involves identifying genetic loci that control differences in total nitrogen content in wheat grains and developing molecular markers that are easy to use in breeding.

[0003] Total nitrogen content in wheat grains is a quantitative trait influenced by both genetic factors and environmental conditions. When using phenotypic determination for selection, sampling and testing are usually required after grain maturity, which involves a long testing cycle and is easily affected by factors such as planting environment, sampling time, and testing conditions, thus limiting its application in early generations of breeding, large populations, and high-throughput screening.

[0004] Genome-wide association studies (GWAS) utilize linkage disequilibrium in natural populations to analyze the association between genetic variation and target traits, thereby locating candidate loci associated with complex quantitative traits. Kompetitive allele-specific PCR (KASP) can perform fluorescent typing of SNP loci. Its operation is relatively simple, fast, and low-cost, making it suitable for high-throughput detection. Furthermore, candidate SNPs obtained from association analysis can be converted into molecular markers usable for breeding.

[0005] Currently, the number of KASP markers that can be directly used for early identification and marker-assisted selection of total nitrogen content in wheat grains is limited, and existing markers cannot fully meet the needs of related early identification and marker-assisted selection. Summary of the Invention

[0006] To address the problems of the prior art, the present invention provides a molecular marker and its application in detecting the total nitrogen content of wheat grains.

[0007] In a first aspect, the present invention provides a molecular marker comprising a nucleic acid having a nucleotide sequence as shown in SEQ ID NO.1, wherein the 18th position exhibits a polymorphism of A / G.

[0008] The nucleotide sequence shown in SEQ ID NO.1 is: 5'-AAGGTCTTGGGTTGTCGYTGTCAAAACTGGTCCGTACCAGGCCATCGATTGAGCCACGCCGCAGGCCG-3', where the Y at position 18 represents A or G; this polymorphic site and its upstream and downstream flanking sequences can be used as target regions for primer design and genotype detection.

[0009] Secondly, the present invention provides a primer combination for amplifying the aforementioned molecular marker.

[0010] The primer combination can be designed based on the polymorphic site of the molecular marker and its flanking sequences to amplify the target fragment containing the polymorphic site for subsequent genotype detection.

[0011] Furthermore, the primer combination includes: First upstream primer: GAAGGTGACCAAGTTCATGCTCGAAGGTCTTGGGTTGTCGA; Second upstream primer: GAAGGTCGGAGTCAACGGATTCGAAGGTCTTGGGTTGTCGG; Downstream primer: TCAATCGATGGCCTGGTACG.

[0012] The aforementioned specific sequences form the KASP primer combination, wherein the 3' ends of the first and second upstream primers correspond to the A and G alleles of the SNP site, respectively, and the 5' ends are connected to the FAM and HEX universal adapter sequences, respectively; the downstream primer works with the two upstream primers to complete the highly specific amplification of the target fragment.

[0013] Thirdly, the present invention provides a detection product comprising the aforementioned primer combination.

[0014] The testing product is a testing reagent, a testing kit, or a testing chip.

[0015] Fourthly, the present invention provides the application of SNP site detection reagents in any of the following: (1) Predict or detect the total nitrogen content of wheat grains, or prepare reagents or kits for predicting or detecting the total nitrogen content of wheat grains; (2) To identify or breed wheat varieties with high total nitrogen content in grains, or to prepare reagents or kits for identifying or breeding wheat varieties with high total nitrogen content in grains; (3) Molecular marker-assisted breeding of wheat; (4) Wheat variety improvement related to total nitrogen content in grains; (5) Improvement of wheat germplasm resources; Based on the genome version Chinese Spring CS-IAAS, the SNP site is located at position 469279913 bp on chromosome 4B.

[0016] The genome version described in this invention, Chinese Spring CS-IAAS, is published in the literature. A telomere-to-telomere genome assembly coupled with multi-omic data provides insights into the evolution of hexaploid bread wheat.

[0017] The prediction or detection includes detecting the genotype of the wheat to be tested at the SNP locus and making a judgment based on the correspondence between different genotypes and total nitrogen content in grains; the molecular marker-assisted breeding, variety improvement and germplasm resource improvement include using the SNP locus to identify the genotype of breeding materials or germplasm materials and screening or selecting materials based on the identification results.

[0018] Fifthly, the present invention provides the use of the aforementioned molecular marker detection reagent or the aforementioned primer combination in any of the following: (1) Predict or detect the total nitrogen content of wheat grains, or prepare reagents or kits for predicting or detecting the total nitrogen content of wheat grains; (2) To identify or breed wheat varieties with high total nitrogen content in grains, or to prepare reagents or kits for identifying or breeding wheat varieties with high total nitrogen content in grains; (3) Molecular marker-assisted breeding of wheat; (4) Wheat variety improvement related to total nitrogen content in grains; (5) Improvement of wheat germplasm resources.

[0019] The detection product can be a nucleic acid reagent capable of amplifying or identifying the SNP site; when preparing reagents or kits for prediction, detection, identification or cultivation, the primer combination and the amplification and typing reagents adapted to it can be configured according to the detection system adopted.

[0020] Sixthly, the present invention provides a method for detecting the total nitrogen content of wheat grains, comprising: The polymorphism of molecular markers as described above was detected in the wheat to be tested, and the total nitrogen content of the wheat grains was determined based on the genotype detection results.

[0021] Furthermore, including: Genomic DNA was extracted from the wheat to be tested, and PCR amplification was performed using the aforementioned primer combination. The genotype of the wheat to be tested was detected, and the total nitrogen content of the wheat grains was determined based on the genotype detection results.

[0022] Furthermore, the determination of the total nitrogen content of the wheat grains based on the genotype detection results includes: wheat with genotype GG has a higher total nitrogen content in its grains compared to wheat with genotype AA.

[0023] The wheat to be tested can be breeding material, variety, or germplasm resource. During testing, genomic DNA can be extracted from the wheat, PCR amplification can be performed using the KASP primer combination, and the genotype of the SNP site can be determined based on the clustering results of FAM and HEX fluorescence signals. Then, the total nitrogen content of the wheat grains can be determined according to the correspondence between the GG and AA genotypes.

[0024] Furthermore, the PCR amplification system includes: DNA 2.5 μL, KASP PCR MIX 2.44 μL and Primer Mix 0.056 μL.

[0025] Furthermore, the PCR amplification procedure includes: Pre-denaturation at 94℃ for 15 min; the first amplification phase is performed for 10 cycles, each cycle consisting of denaturation at 94℃ for 20 s, followed by annealing and extension at an initial temperature of 61℃ for 60 s, with the annealing and extension temperatures decreasing by 0.6℃ per cycle until reaching 55℃; the second amplification phase is performed for 26 cycles, each cycle consisting of denaturation at 94℃ for 20 s, followed by extension at 55℃ for 60 s.

[0026] In a seventh aspect, the present invention provides a method for breeding wheat, comprising: In the process of wheat breeding, individuals with the genotype GG of the aforementioned molecular markers are selected for breeding to obtain wheat varieties with high total nitrogen content in the grains.

[0027] The selection process includes genotyping wheat progeny materials and retaining individuals with the genotype GG for subsequent breeding or selection. The wheat progeny materials can be hybrid offspring, lines in the breeding population, or other candidate materials.

[0028] This invention further compared 20 published common hexaploid wheat genomes selected from the WheatOmics website. These included Zang1817, ZM366, YM33, YM158, XY6, XN6028, Sumai3, NC4, KN9204, JM22, HD6172, Fielder, Chinese Spring2.1, Chinese Spring CS-IAAS, Chinese Spring CNAU, BJ8, AMN, ZM16, Chuanmai104, and AK58, all of which exhibited A / G polymorphism at position 18 of SEQ ID NO.1.

[0029] The present invention has the following beneficial effects: This invention provides a molecular marker based on the A / G polymorphism site at position 18 of the sequence shown in SEQ ID NO.1, and correspondingly provides primer combinations, detection products, and genotype detection methods, thereby forming a method from genomic DNA amplification, molecular marker typing to determination of total nitrogen content in grains. This method can perform batch screening of wheat materials, reducing the time and environmental impacts caused by relying solely on maturity phenotypic determination.

[0030] The molecular markers and their applications provided by this invention offer genetic tools for the identification and selection of wheat materials with high total nitrogen content in grains. These molecular markers have no significant effect on the content of anthocyanins, crude fat, and free amino acids, nor on the number of grains per spikelet, number of spikelets, number of grains per spike, plant height, spike length, and thousand-grain weight. They save breeding years and experimental costs, and accelerate the process of wheat quality breeding. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0032] Figure 1 This is a distribution map of total nitrogen content in 57 colored wheat grains provided in this embodiment of the invention; wherein, A is the distribution of total nitrogen content in grains of materials with genotype A (AA), and B is the distribution of total nitrogen content in grains of materials with genotype B (GG); the horizontal axis represents the total nitrogen content in grains, in %, and the vertical axis represents the number of materials in each content category, in units of.

[0033] Figure 2This is the distribution of resequencing SNP markers from 57 population materials provided in this embodiment of the invention on the 21 chromosomes of wheat; the horizontal axis represents the physical location of the chromosomes in Mb, and the vertical axis represents the 21 chromosomes of wheat from top to bottom; the lower the density of the markers on the chromosomes, the greener the color, and the higher the density, the redder the color.

[0034] Figure 3 This invention presents the genotyping results of the KASP molecular marker KASP-TN-4B in 57 wheat accessions and its single-marker analysis in four nutritional quality traits. A shows the fluorescence genotyping results of KASP-TN-4B, with the X and Y axes representing the fluorescence signals corresponding to allele 1 and allele 2 detected using FAM and HEX dyes, respectively. Red dots represent genotypes without the locus, blue dots represent genotypes carrying the locus, green dots represent heterozygous genotypes, black dots represent negative controls, and black crosses represent deletions. B shows the single-marker analysis results of KASP-TN-4B in four nutritional quality traits, with orange box plots representing materials without the locus and blue box plots representing materials carrying the locus. The ordinate represents anthocyanin, crude fat, free amino acids, and total grain nitrogen content, respectively. The p-value is less than 0.01, and ns represents no significant difference.

[0035] Figure 4 This invention provides a single-marker analysis of the KASP molecular marker KASP-TN-4B in six agronomic traits of 57 wheat accessions. The red box plot represents materials without the locus, and the green box plot represents materials with the locus. The vertical axis represents the number of grains per spikelet, the number of grains per spikelet, the number of grains per spike, the plant height, the spike length, and the thousand-grain weight, respectively. ns represents no significant difference.

[0036] Figure 5 This is a distribution map of total nitrogen content in 48 colored wheat grains provided in this embodiment of the invention; wherein, A is the distribution of total nitrogen content in grains of materials with genotype A (AA), and B is the distribution of total nitrogen content in grains of materials with genotype B (GG); the horizontal axis represents the total nitrogen content in grains, in %, and the vertical axis represents the number of materials in each content category, in units of.

[0037] Figure 6This invention presents the genotyping results of the KASP molecular marker KASP-TN-4B in 48 wheat accessions and its single-marker analysis in four nutritional quality traits. A shows the fluorescence genotyping results of KASP-TN-4B, with the X and Y axes representing the fluorescence signals corresponding to allele 1 and allele 2 detected using FAM and HEX dyes, respectively. Red dots represent genotypes without the locus, blue dots represent genotypes carrying the locus, green dots represent heterozygous genotypes, black dots represent negative controls, and black crosses represent deletions. B shows the single-marker analysis results of KASP-TN-4B in four nutritional quality traits, with orange box plots representing materials without the locus and blue box plots representing materials carrying the locus. The ordinate represents anthocyanin, crude fat, free amino acids, and total grain nitrogen content, respectively. The p-value is less than 0.0001, and ns represents no significant difference.

[0038] Figure 7 This invention provides a single-marker analysis of the KASP molecular marker KASP-TN-4B in six agronomic traits of 48 wheat accessions. The red box plot represents materials without the locus, and the green box plot represents materials with the locus. The vertical axis represents the number of grains per spikelet, the number of grains per spikelet, the number of grains per spike, the plant height, the spike length, and the thousand-grain weight, respectively. ns represents no significant difference. Detailed Implementation

[0039] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0040] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0041] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0042] Example 1 1. Phenotypic analysis of total nitrogen content in wheat grains The 57 colored wheat varieties used in this example were planted in Jinan, Shandong Province, during the 2025 planting season. Each variety was sown at a rate of 3 g per row, with a row length of 1.5 meters and a row spacing of 25 cm. All varieties underwent standard field production management before harvest.

[0043] After maturity, seeds were harvested, and the total nitrogen content of the grains was determined using the Dumas combustion method. A suitable sample was weighed and burned at high temperature using a Dumas nitrogen analyzer. The nitrogen element was converted to molecular nitrogen, which was then quantitatively detected by a thermal conductivity detector. The total nitrogen content of the grains was directly read by the instrument. The obtained phenotypic data were statistically analyzed using Excel, and the results are shown below. Figure 1 And Table 4.

[0044] 2. Genotype data analysis Fifty-seven colored wheat accessions were resequencing using the DNBSEQ sequencing platform, with an average sequencing depth of 5×. SNPs with a deletion rate greater than 20% and a minimum allele frequency less than 5% were filtered out using PLINK-1.9 software to obtain high-quality genotype data. These SNPs are distributed across the 21 wheat chromosomes. Results are shown below. Figure 2 .

[0045] 3. Genome-wide association analysis Genome-wide association analysis (GWA) was performed on the phenotypes and filtered SNP data of 57 colored wheat accessions using EMMAX-beta and PLINK-1.9 software. Using both EMMAX and PCA+GLM models, 30 SNPs significantly associated with total nitrogen content in grains were identified at the TN.pkuias.4B.13 locus. This locus is located on chromosome 4B of the Chinese Spring (CS-IAAS) wheat variety, with a physical interval of 468.16–484.27 Mb.

[0046] 4. Development of KASP molecular markers A significant SNP at position 13 of TN.pkuias.4B was developed into a KASP molecular marker, KASP-TN-4B, whose nucleotide sequence is shown in SEQ ID NO.1, and an A / G mutation exists at the 18th base of this sequence.

[0047] SEQ ID NO.1: AAGGTCTTGGGTTGTCGYTGTCAAAACTGGTCCGTACCAGGCCATCGATTGAGCCACGCCGCAGGCCG, where Y is A or G.

[0048] 5. Development of primer pairs and amplification methods Primers were designed based on the SNP information of the TN.pkuias.4B.13 site obtained from the above screening. The specific steps are as follows: (1) Obtain SNP site information. The base sequences of the two parents at the SNP position are different, and there are no other SNPs 20 bp upstream and 40 bp downstream of the SNP.

[0049] (2) Extract parental DNA and dilute it to 5-50 ng / μL for later use.

[0050] (3) Primer design: 1) Starting from the base of the SNP, count 20 bp upstream as the left primer f, and the base of the SNP is the 20th base of the left primer, so there are left primers f1 and f2; 2) Use primer design software or the primer design website Polymarker (https: / / www.polymarker.info / ) to fix the left primer f, and obtain the right primer R by BLAST. The product size must be less than 60 bp. 3) Add the adapter FAM and HEX sequences to the left primers f1 and f2 respectively to form F1 and F2; 4) Synthesize sequences F1, F2, and R, and purify them using ULTRPAGE.

[0051] (4) Dissolve the primer powder, F1 and F2 have a concentration of 36 μM and R has a concentration of 90 μM. Then mix the three primers in a volume ratio of 1:1:1 to form a primer mix.

[0052] (5) Screening of KASP primer pairs: Each primer was used to run at least two wells for each parent and F1 cell. The PCR amplification system is shown in Table 1, and the PCR amplification program is shown in Table 2.

[0053] Table 1 PCR amplification system

[0054] Table 2 PCR amplification program

[0055] (6) After amplification, use a real-time PCR reading plate: The plate reading procedure is as follows: Maintain 25℃ for 5 seconds + plate reading. After reading, select the fluorescence type (FAM, HEX, or ROX) and choose Allelic Discrimination for analysis.

[0056] (7) Select primers with obvious clustering as candidate primer pairs and use them in the population. If the clustering effect is obvious, they can be used as KASP primer pairs.

[0057] (8) Screening results: The information of the KASP primer pairs with the most significant clustering effect is shown in Table 3.

[0058] Table 3. Sequences of KASP primer pairs

[0059] (9) Population typing and single-marker analysis: The selected KASP primer pairs were used to perform PCR amplification and fluorescence typing on 57 colored wheat materials. Single-label analysis was then performed on anthocyanin, crude fat, free amino acids, and total nitrogen content in the grains. The results are shown in [Figure number missing]. Figure 3 .

[0060] Simultaneously, single-marker analysis was performed on the spikelet grain number, spikelet number, spikelet grain number, plant height, spike length, and thousand-grain weight of 57 colored wheat materials. The results are shown below. Figure 4 This indicates that the KASP primer pair can accurately identify the aforementioned molecular markers.

[0061] Table 4. Phenotypes and genotypes of 57 colored wheat samples

[0062] in, a NA indicates missing data. b H represents heterozygous genotype, A represents AA, and B represents GG.

[0063] Example 2: Validation of KASP primer pairs This invention also used 48 new colored wheat materials and employed the same method as in Example 1 to detect the total nitrogen content of wheat grains and the polymorphism of the KASP-TN-4B molecular marker. Before statistical analysis, samples that failed to genotype were removed. Of the 48 materials that ultimately yielded valid genotypes, 7 materials carried the KASP-TN-4B marker, and 38 materials did not. One heterozygous sample and two missing samples were excluded from subsequent t-test analysis. The specific steps are as follows: Forty-eight colored wheat varieties were planted in Weifang, Shandong Province, during the 2025 planting season. Each variety was planted at a rate of 3 g per row, with a row length of 1.5 meters and a row spacing of 25 cm. All varieties underwent standard field production management prior to harvest.

[0064] After maturity, seeds were harvested. Three plants were randomly selected from each sample, and four nutritional quality traits, namely anthocyanin, crude fat, free amino acids and total nitrogen content in grains, and six agronomic traits, namely number of grains per spikelet, number of grains per spike, plant height, spike length, number of spikelets and weight of 1000 grains, were measured. The arithmetic mean of three replicates was used for statistical analysis.

[0065] Simultaneously, the KASP primer pairs screened in step "5. Development of primer pairs and amplification methods" of Example 1 were used to perform PCR amplification on these 48 materials to detect the genotype of each material. The PCR amplification procedure and system were the same as those in Tables 1 and 2. After the data met the preconditions for the t-test according to the Shapiro-Wilk normality test and the Levene homogeneity of variance test, an independent samples two-tailed t-test was used to verify the association between the markers and total nitrogen content and agronomic traits.

[0066] The results are as follows Figures 5-7 As shown in Table 5, there was a highly significant correlation between the KASP-TN-4B marker and total grain nitrogen content (P < 0.0001). Materials carrying this marker had significantly higher total grain nitrogen content than those without. There were no significant differences between the two groups in anthocyanin, crude fat, and free amino acid content. Regarding agronomic traits, there were no significant differences between the two groups in spikelet number of grains, number of spikelets, number of grains per spike, plant height, spike length, and thousand-grain weight.

[0067] Table 5. Phenotypes and genotypes of 48 wheat samples

[0068] in, a NA indicates missing data; H indicates heterozygous genotype; A indicates AA; and B indicates GG.

[0069] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular marker, characterized in that, Nucleic acids including those with the nucleotide sequence shown in SEQ ID NO.1, exhibiting polymorphism at position 18, with a polymorphism of A / G.

2. A primer combination, characterized in that, The primer combination is used to amplify the molecular marker of claim 1, and the primer combination comprises: First upstream primer: GAAGGTGACCAAGTTCATGCTCGAAGGTCTTGGGTTGTCGA; Second upstream primer: GAAGGTCGGAGTCAACGGATTCGAAGGTCTTGGGTTGTCGG; Downstream primer: TCAATCGATGGCCTGGTACG.

3. A testing product, characterized in that, It includes the primer combination described in claim 2; the detection product is a detection reagent, detection kit, or detection chip.

4. The use of a SNP site detection reagent, or a molecular marker detection reagent as described in claim 1, or a primer combination as described in claim 2, in any of the following: (1) Predict or detect the total nitrogen content of wheat grains, or prepare reagents or kits for predicting or detecting the total nitrogen content of wheat grains; (2) To identify or breed wheat varieties with high total nitrogen content in grains, or to prepare reagents or kits for identifying or breeding wheat varieties with high total nitrogen content in grains; (3) Molecular marker-assisted breeding of wheat; (4) Wheat variety improvement related to total nitrogen content in grains; (5) Improvement of wheat germplasm resources; Based on the genome version Chinese Spring CS-IAAS, the SNP site is located at position 469279913 bp on chromosome 4B.

5. A method for detecting the total nitrogen content in wheat grains, characterized in that, include: The polymorphism of the molecular marker as described in claim 1 is detected in the wheat to be tested, and the total nitrogen content of the wheat grains is determined based on the genotype detection results.

6. The method according to claim 5, characterized in that, include: Genomic DNA was extracted from the wheat to be tested, and PCR amplification was performed using primer combinations to detect the genotype of the wheat to be tested. The total nitrogen content of the wheat grains was determined based on the genotype detection results. The primer combination includes: a first upstream primer: GAAGGTGACCAAGTTCATGCTCGAAGGTCTTGGGTTGTCGA; Second upstream primer: GAAGGTCGGAGTCAACGGATTCGAAGGTCTTGGGTTGTCGG; Downstream primer: TCAATCGATGGCCTGGTACG.

7. The method according to claim 5 or 6, characterized in that, The determination of the total nitrogen content of the wheat grains based on the genotype detection results includes: wheat with genotype GG has a higher total nitrogen content than wheat with genotype AA.

8. A method for breeding wheat, characterized in that, include: In the process of wheat breeding, individuals with the genotype GG of the molecular marker as described in claim 1 are selected for breeding to obtain wheat varieties with high total nitrogen content in grains.

Images