Primer pair, probe and kit for detecting grapevine trunk pathogen botryosphaeria dothidea by lfd-rpa technology and application thereof

Abstract

The application belongs to the technical field of biology, and particularly relates to a primer pair, a probe, a kit for rapidly detecting Coniella vitis by using recombinant enzyme polymerase amplification lateral flow technology (LFD-RPA) and application thereof. The application designs specific primer pairs and probes for the pathogenic bacteria Coniella vitis of grapevine blight, and combines the LFD technology, so that the RPA detection of the Coniella vitis is convenient, highly specific and highly sensitive, and the sensitivity can reach 10 ‑5 ng / μL, and has high application value in early diagnosis, field diagnosis and auxiliary identification of the Coniella vitis.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to primer pairs, probes, kits, and their applications for the rapid detection of grape white rot pathogens using recombinase polymerase amplification lateral flow layer technology (LFD-RPA). Background Technology

[0002] Grape white rot is a major disease affecting grapes worldwide, causing 30%-50% economic losses annually and severely impacting the healthy development of the grape industry. Coniella vitis is the main pathogen causing grape white rot in China, leading to browning, softening, and shriveling of the berries, resulting in stunted fruit with numerous small gray spots on the surface.

[0003] Traditional disease detection methods are slow and require sophisticated instruments such as PCR machines, primarily suitable for laboratory testing and unable to meet the demands of rapid detection, thus limiting their application. Recombinase polymerase amplification (RPA) is a technique utilizing recombinase polymerase isothermal amplification. This technique not only eliminates the need for high-precision instruments but also offers a short reaction time. By combining RPA with fluorescent labeling, it can be integrated with lateral flow dipsticks (LFD) for visualized detection of amplified products. This eliminates the need for complex instruments, making it suitable for rapid on-site detection. It enables highly specific and sensitive visualized rapid detection of pathogens and has extremely broad application prospects. Currently, there are no reports on the application of LFD-RPA technology for detecting grape white rot pathogens. Summary of the Invention

[0004] The technical problem this invention aims to solve is how to conveniently, rapidly, and sensitively detect grape white rot pathogens, eliminating the dependence on specialized instruments and technicians required by traditional molecular detection methods, and achieving rapid detection of grape white rot pathogens to overcome the shortcomings of existing technologies. The key to establishing a sensitive and efficient optimal LFD-RPA system is to design primers and probes with high amplification efficiency and strong specificity.

[0005] To solve the above problems, the present invention adopts the following technical solution.

[0006] A primer pair and probe for detecting grape white rot pathogen using LFD-RPA technology, wherein the primers are designed based on the CAL gene sequence of grape white rot pathogen;

[0007] The upstream primer CV-F sequence of the primer pair is shown in SEQ ID No:1, CCACGTCTTAGCATTTTCGATTATCCTGTT (SEQ ID No:1)

[0008] The downstream primer CV-R sequence of the primer pair is shown in SEQ ID No:2, CAGGACAAGGATGGCGATGGTAAGCACCTA (SEQ ID No:2).

[0009] The CV-Probe sequence is shown in SEQ ID No:3, CTCGCCCCTTCCATGTGGCCTGTCTCGATATGGCAATGCGCGTAGGTTGG (SEQ ID No:3).

[0010] In one embodiment, the primer pair and probe used to detect grape white rot fungus using LFD-RPA technology have a biotinylated 5' end of the downstream primer CV-R.

[0011] In one embodiment, the primer pair and probe used to detect grape white rot fungus using LFD-RPA technology are described, wherein the 5' end of the probe CV-Probe is labeled with the FAM group, THF is labeled at positions 33 and 34 from the 5' end, and the 3' end is labeled with the PHO group.

[0012] In one aspect, the present invention discloses a kit containing the primer pairs and probes described above.

[0013] As a preferred embodiment, the aforementioned kit of the present invention also includes an LFD test strip.

[0014] In one aspect, the present invention discloses the application of the primer pairs and probes in the detection of grape white rot pathogens.

[0015] In one aspect, the present invention discloses the use of the aforementioned primers and probes in the preparation of products for detecting grape white rot fungus.

[0016] In one aspect, the present invention discloses the application of the aforementioned kit in the detection of grape white rot pathogens.

[0017] In one aspect, the present invention discloses the application of the aforementioned kit in the detection of grape white rot pathogens, and the method of application includes the following steps:

[0018] The LFD-RPA assay was performed using the grinding solution of the sample to be tested; the presence of grape white rot fungus in the sample was determined based on the bands on the LFD test strip.

[0019] The application of the above-described kit in the detection of grape white rot fungus involves determining whether the sample contains grape white rot fungus based on the bands on the LFD test strip as follows: if the LFD test strip shows one red band in the control area and one red band in the detection area, the result is positive, indicating that the sample contains grape white rot fungus; if the LFD test strip shows only one red band in the control area, the result is negative, indicating that the sample does not contain grape white rot fungus.

[0020] In one embodiment, the reaction system for the LFD-RPA detection is as follows: 29.4 mL AD buffer, 12.5 μL ultrapure water, 2 μL 10 μM primer CV-F, 2 μL 10 μM primer CV-R, 0.6 μL 10 μM probe CV-Probe, 1 μL DNA template, and 2.5 μL B buffer are added to the dry powder tube.

[0021] In one embodiment, the method for detecting grape white rot fungus is to amplify at 42°C for 20 min in the LFD-RPA detection system, dilute the amplification product 20 times, place the lateral flow chromatography test strip in the dilution solution, and observe after standing at room temperature for 1 min. Beneficial effects

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0023] Based on the CAL gene sequence of *Cyclocarya paliurus*, this invention designs specific amplification primers CV-F and CV-R, and a probe CV-Probe, establishing a detection method for *Cyclocarya paliurus* based on LFD-RPA. This method achieves a detection sensitivity of up to 10 for the pathogen's DNA. -5 The concentration of ng / μL is high, and the method is highly specific, showing no cross-reactivity with other closely related species and genera of pathogens. This indicates that the detection method provided by this invention is simple, rapid, sensitive, and specific, and can specifically detect the tested grape white rot pathogen from different plant pathogens.

[0024] The primers and probes of this invention are used for LFD-RPA detection, which has a short amplification time, high efficiency, and low equipment requirements. It can get rid of the limitations of traditional molecular detection, which requires expensive instruments and strict reaction conditions. It can quickly and efficiently identify grape white rot fungus, and the detection results can be observed with the naked eye. It is suitable for rapid detection in simple laboratories at the grassroots level and has high application value in the early diagnosis, field diagnosis and auxiliary identification of grape white rot fungus. Attached Figure Description

[0025] Figure 1For specific test results; from left to right: sterile double-distilled water (negative control); Coniothyrium vitis; Coniella granati; Colletotrichum gloeosporioides; Botryosphaeria dothidea; Alternaria alternata; Botrytis cinerea; Fusarium oxysporum; Diaportheeres; Lasiodiplodia theobromae; Bipolaris sorokiniana; Epicoccum sorghinum; Pestalotiopsis theae; Nigrospora oryzae; Curvularia lunata.

[0026] Figure 2 These are the sensitivity test results; from left to right, the DNA template concentrations are 10 ng / μL, 1 ng / μL, and 10 ng / μL, respectively. -1 ng / μL, 10 -2 ng / μL, 10 -3 ng / μL, 10 -4 ng / μL, 10 -5 ng / μL, 10 -6 ng / μL, sterile double-distilled water (negative control).

[0027] Figure 3 The results of LFD-RPA testing are shown below; from left to right, the samples are: sterile double-distilled water (negative control); Coniothyrium vitis DNA (positive control); and sterile water homogenate of grape samples. Detailed Implementation

[0028] The present invention will be further described below with reference to specific embodiments.

[0029] Example 1: LFD-RPA Detection Method

[0030] 1.1 Primer and probe design

[0031] Based on the CAL gene (calmodulin) sequence of the grape white rot pathogen (as shown in SEQ ID No. 4), specific amplification primers CV-F, CV-R, and probe CV-Probe were designed. The nucleotide sequence of primer CV-F is shown in SEQ ID No. 1, the nucleotide sequence of primer CV-R is shown in SEQ ID No. 2, and the nucleotide sequence of probe CV-Probe is shown in SEQ ID No. 3. Specific sequences are shown in Table 1. The LFD-RPA primer has the same sequence as the ordinary RPA primer, except that the reverse primer of LFD-RPA has a biotin label at the 5' end, the probe CV-Probe has a FAM group at the 5' end, THF at positions 33 and 34 from the 5' end, and a PHO group at the 3' end.

[0032] Table 1 Primer and probe sequence information used for LFD-RPA amplification

[0033]

[0034] 1.2 LFD-RPA Detection System and Method

[0035] Using genomic DNA of *Vitis vinifera* as a template, 29.4 mL of AD buffer, 12.5 μL of ultrapure water, 2 μL of 10 μM primer CV-F, 2 μL of 10 μM primer CV-R, 0.6 μL of 10 μM probe CV-Probe, 1 μL of DNA template, and 2.5 μL of B buffer were added to a dry powder tube. Amplification was performed at 42℃ for 20 min. The amplified product was then diluted 20-fold, and the lateral flow chromatography (LFD) test strip was placed in the dilution buffer and incubated at room temperature for 1 min before observation. The presence of *Vitis vinifera* in the sample was determined based on the bands on the LFD test strip. If one red band appeared in the control area and another red band appeared in the detection area, the result was positive, indicating the presence of *Vitis vinifera* in the sample. If only one red band appeared in the control area, the result was negative, indicating the absence of *Vitis vinifera* in the sample.

[0036] Example 2: LFD-RPA Detection Performance Analysis

[0037] 2.1 Specificity Analysis

[0038] The specificity of the primers was verified using closely related species of the genus *Cyclophorus* and other common pathogens. The specificity was verified by performing an LFD-RPA reaction on the genomic DNA of all the tested strains in Table 2 using the specific primers designed in this invention. The template DNA was replaced with an equal amount of water as a negative control (CK).

[0039] In this invention, the amplification primers designed based on the CAL gene sequence of *Phytophthora infestans* exhibit high specificity and show no cross-reactivity with other closely related species or genera of pathogens. The results are as follows: Figure 1 As shown, the LFD flow chromatography test strip results indicated that only *Phytophthora infestans* (grape white rot pathogen) was positive, while the DNA test results for other pathogens were negative. The test results are visually observable, requiring no instruments, and are simple to operate and rapid in response. The advantages of LFD-RPA are well demonstrated in grassroots inspection and quarantine work.

[0040] Table 2. Strains used for screening primer specificity in this embodiment.

[0041]

[0042] Note: + indicates the presence of a specific test band; - indicates the absence of a test band.

[0043] 2.2 Sensitivity Analysis

[0044] To evaluate the detection efficacy of the primer-probe combination designed in this study, a series of gradient concentrations of 10 ng / μL, 1 ng / μL, and 10 ng / μL were used. -1 ng / μL, 10 -2 ng / μL, 10 -3 ng / μL, 10 -4 ng / μL, 10 -5 ng / μL, 10 -6 Sensitivity analysis of ng / μL of grape white rot pathogen DNA was performed using the LFD-RPA technique. Results are as follows: Figure 2 As shown, this LFD-RPA technology system has high detection sensitivity, 10 -5 The ng / μL still showed bands.

[0045] Example 3: LFD-RPA detection of diseased samples

[0046] Collected grape white rot, anthracnose, and gray mold disease samples, as well as healthy samples, were ground separately in sterile water. Using the ground liquid as a template, LFD-RPA detection was performed using the primer and probe composition designed in this invention, following the system and method described in Example 1. The detection results are as follows: Figure 3 As shown. From Figure 3As can be seen, the detection results of grape disease samples caused by grape white rot fungus were positive, while the detection results of grape anthracnose samples, grape gray mold samples, and sterile water grinding broth from healthy grapes were negative, which is consistent with the conventional disease detection results. This indicates that the LFD-RPA detection technology system established in this invention can be successfully applied to the detection and analysis of grape white rot fungus in grape disease samples, and sterile water grinding broth can be directly used as a detection sample, which greatly simplifies the experimental operation process and is more suitable for field-level detection applications.

[0047] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been provided, it should be understood that further modifications can be made to the invention.

[0048] In summary, based on the principles of this invention, this application is intended to include any modifications, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A primer pair and probe for detecting grape white rot pathogens using LFD-RPA technology, characterized in that: The primer pair is designed based on the CAL gene sequence of Grape white rot pathogen; the upstream primer CV-F sequence is shown in SEQ ID No:1, the downstream primer CV-R sequence is shown in SEQ ID No:2, and the probe CV-Probe sequence is shown in SEQ ID No:

3.

2. The primer pair and probe for detecting grape white rot fungus using LFD-RPA technology according to claim 1, characterized in that: The 5' end of the downstream primer CV-R of the primer pair is labeled with biotin.

3. The primer pair and probe for detecting grape white rot fungus using LFD-RPA technology according to claim 2, characterized in that: The probe is labeled with a carboxyfluorescein (FAM) group at its 5' end, tetrahydrofuran (THF) at positions 33 and 34 starting from its 5' end, and a phosphate group (PHO) at its 3' end.

4. A kit containing the primer pair and probe as described in any one of claims 1-3.

5. The reagent kit according to claim 4, characterized in that: The kit also includes LFD test strips.

6. The application of the primer pair and probe as described in claim 1 in the detection of grape white rot pathogen.

7. The use of the primer pair and probe as described in claim 1 in the preparation of a product for detecting grape white rot fungus.

8. The application of the kit as described in claim 4 in the detection of grape white rot pathogen.

9. The application of the kit according to claim 8 in the detection of grape white rot pathogen, characterized in that: The method of the application includes the following steps: The LFD-RPA assay was performed using the grinding solution of the sample to be tested; the presence of grape white rot fungus in the sample was determined based on the bands on the LFD test strip.

10. The application of the kit according to claim 9 in the detection of grape white rot pathogen, characterized in that: The method for determining whether a sample contains grape white rot fungus based on the bands on the LFD test strip is as follows: If the LFD test strip shows one red band in the control area and one red band in the test area, the result is positive, indicating that the sample contains grape white rot fungus; if the LFD test strip shows only one red band in the control area, the result is negative, indicating that the sample does not contain grape white rot fungus.

Images