Primer and probe combination, kit and method for rapid detection of bamboo rat pestivirus

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a primer and probe combination, a kit and a method for rapidly detecting bamboo rat plague virus. The application provides a RAA primer pair for specifically recognizing a RdRp gene of the bamboo rat plague virus and a probe with FITC / Biotin double labeling. The application also provides a detection method for detecting the bamboo rat plague virus for non-diagnostic purposes. The results of the examples show that the application can complete the detection in 30 minutes under the condition of constant temperature of 39 DEG C by simultaneously detecting the amplification product and the quality control line of the lateral flow chromatographic test strip of the recombination enzyme mediated isothermal amplification system. The detection method provided by the application does not have cross reaction with other common pathogens, can rapidly detect the novel bamboo rat plague virus infection, has high specificity and sensitivity, and is suitable for the bamboo rat plague monitoring, zoo quarantine and wild bamboo rat protection.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to primer and probe combinations, kits, and methods for rapid detection of bamboo rat plague virus. Background Technology

[0002] The plague virus belongs to the Flaviviridae family ( Flaviviridae ) Plague virus genus ( Pestivirus Poisoning virus (PPV) is a type of enveloped, positive-sense, single-stranded RNA virus that can infect various livestock and cause diseases such as fever, hemorrhage, and reproductive disorders, resulting in significant economic losses to livestock production. Because the PPV genome is RNA, it exhibits certain variation characteristics, and some viruses can even form persistent or latent infections within the host, thus increasing the difficulty of virus monitoring and control.

[0003] With the continuous development of molecular epidemiology and wildlife pathogen research, plague viruses or plague virus-like nucleic acid sequences have been detected in various wild animals, indicating that these viruses have a wide host range and a certain risk of cross-species transmission. Animals can play an important role in the maintenance, spread, and cross-species transmission of pathogenic microorganisms. In scenarios such as artificial breeding, conservation, experimental research, and wildlife resource protection, if relevant animals carry plague viruses, it may pose potential risks to animal health, sample safety management, and disease prevention and control.

[0004] bamboo rat ( Bamboo rat Bamboo rats belong to the family Rhizomydae in the order Rodentia and have a certain distribution base in some southern regions of my country. In recent years, with the development of wildlife resource protection, conservation, and scientific breeding work, the monitoring of pathogens related to bamboo rats and biosafety issues have gradually attracted attention. Existing studies have shown that viral hemorrhagic disease sequences can be detected in bamboo rats, indicating that bamboo rats may be one of the potential hosts of hemorrhagic disease viruses. Therefore, establishing a rapid detection method for bamboo rat hemorrhagic disease virus is of great significance for bamboo rat disease monitoring and biosafety control.

[0005] Currently, routine detection methods for infectious diseases mainly include RT-PCR, quantitative real-time PCR, and immunohistochemistry. While these methods can detect the virus, they generally suffer from relatively cumbersome procedures, long testing cycles, high requirements for experimental conditions and equipment, and high testing costs. Therefore, their application in scenarios such as rapid on-site screening is somewhat limited.

[0006] Recombinase-mediated strand displacement nucleic acid amplification technology ( Recombinase-aided Amplification Isothermal amplification (RAA) is a nucleic acid amplification technique that enables rapid amplification of target nucleic acids under isothermal conditions. This technique offers advantages such as ease of operation, rapid detection, high sensitivity, and low instrument dependence.

[0007] Therefore, there is an urgent need to develop primers, reagent kits, and detection methods that are highly specific, sensitive, rapid, and easy to use for bamboo rat plague virus, in order to meet the needs of rapid on-site screening, clinical sample testing, and related disease monitoring of bamboo rat plague virus. Summary of the Invention

[0008] The purpose of this invention is to provide a primer pair that specifically recognizes the RdRp gene of bamboo rat plague virus and a probe with FITC / Biotin dual labeling.

[0009] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a primer-probe combination for detecting bamboo rat plague virus, wherein the primers in the primer-probe combination include a forward primer Pestivirus-F1 and a reverse primer Pestivirus-R1; The nucleotide sequence of the forward primer Pestivirus-F1 is shown in SEQ ID NO.1; The nucleotide sequence of the reverse primer Pestivirus-R1 is shown in SEQ ID NO.2; The probe in the primer-probe combination is Pestivirus-probe, and the complete nucleotide sequence of the probe Pestivirus-probe is shown in SEQ ID NO.3.

[0010] Preferably, the 5' end of the reverse primer Pestivirus-R1 sequence is modified with biotin.

[0011] Preferably, the 5' end of SEQ ID NO.3 is connected to fluorescein isothiocyanate, and the 3' end is connected to the C3 interarm.

[0012] The present invention also provides a detection kit for detecting bamboo rat plague virus, the kit comprising a negative control sample, a positive control sample, a buffer solution, a test strip, and the primer-probe combination described above.

[0013] The present invention also provides a detection method for detecting bamboo rat plague virus for non-diagnostic purposes, the method comprising the following steps: S1: Using total RNA from the sample to be tested as a template, cDNA is prepared using reverse transcription reagent; S2: Using the kit described above, perform a RAA reaction with the cDNA prepared in step S1, and obtain the reaction product after isothermal amplification; S3: Visually detect the reaction products obtained in step S2 using nucleic acid-lateral flow chromatography test strips.

[0014] Preferably, the RAA reaction system in step S2 consists of 6.45 μL of sterile water, 12.5 μL of A Buffer, 1 μL of 2 μM forward primer, 1 μL of 2 μM reverse primer, 0.3 μL of 2 μM probe, 2.5 μL of cDNA template, and 1.25 μL of B Buffer.

[0015] Preferably, the concentration of the cDNA is 2.44 × 10⁻⁶. 1 copies / μL.

[0016] Preferably, the RAA reaction temperature in step S2 is 39°C.

[0017] Preferably, the standard for the visual detection in step S3 is that if red bands appear at both the control line and the test line of the test strip, the sample is determined to contain bamboo rat plague virus; if only the control line shows a band and the test line does not, the result is determined to be negative.

[0018] The present invention also provides an application of the primer-probe combination or the kit described above in the detection of bamboo rat plague virus, wherein the application is for non-disease diagnosis purposes.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention provides primer pairs that specifically recognize the RdRp gene of bamboo rat plague virus and probes with FITC / Biotin double labeling. Furthermore, by optimizing and adjusting the concentration of primers and using RAA-LFD (recombinase-assisted amplification-fluid chromatography strip) technology, a very good effect is achieved. The detection result is obtained after reacting at a constant temperature of 39℃ for 30 minutes, reaching the level of nucleic acid detection, which has the advantages of being rapid and effective.

[0020] (2) This invention also achieves high specificity and high sensitivity detection of bamboo rat plague virus by optimizing other parameters in the amplification system and using the designed primers. The detection limit is 2.44 × 10⁻⁶. 1 The sensitivity is higher than that of conventional PCR methods, with a capacity of copies / μL.

[0021] (3) The detection method for bamboo rat plague virus provided by the present invention does not cross-react with other common pathogens and does not react non-specifically with host nucleic acid, and has high specificity.

[0022] (4) The 25μL system used in this experiment can save costs to the greatest extent.

[0023] (5) The implementation process of this invention is simple and easy to operate. It does not require specialized testing personnel to conduct on-site testing. The testing is fast and accurate. It has achieved good application results in the initial application and is of great significance for the prevention and control of bamboo rat plague virus. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 This diagram illustrates the detection results for primer concentration optimization; where 1: 2.0 μL, 2: 1.5 μL, 3: 1.0 μL, 4: 0.5 μL, and 5: negative control.

[0026] Figure 2 A schematic diagram of the optimized detection results for reaction time; where 1: negative control, 2: 20 min, 3: 25 min, 4: 30 min, 5: 35 min, 6: 40 min.

[0027] Figure 3 This is a schematic diagram showing the results of primer sensitivity analysis; where 1: negative control, 2: 2.44 × 10⁻⁶. 3 copies / μL, 3: 2.44×10 2 copies / μL, 4: 2.44×10 1 copies / μL, 5: 2.44×10 0 copies / μL, 6: 2.44×10 -1 copies / μL.

[0028] Figure 4 This is a schematic diagram of the detection results for primer specificity analysis. 1: Negative control; 2: Positive control; 3: Bamboo rat hemorrhagic virus cDNA; 4: Pangolin hemorrhagic virus PPEV; 5: Canine parvovirus CPV; 6: Low pathogenic avian influenza virus H9N2; 7: Bamboo rat-derived Klebsiella pneumoniae; 8: Bamboo rat host DNA. Detailed Implementation

[0029] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0030] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0031] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.

[0032] The A Buffer, B Buffer, and reaction powder in the RAA reaction system were all from the RAA-nfo nucleic acid amplification kit, purchased from Hangzhou Zhongce Biotechnology Co., Ltd. The single-strand nucleic acid test strips were purchased from Shanghai Sangon Biotech Co., Ltd.

[0033] Example 1: Design of Specific Primers and Probes RNA was extracted from bamboo rat plague virus using RNA fast 200 total RNA. cDNA was prepared using the TIANScript II cDNA first-strand synthesis kit and stored at -20°C.

[0034] A positive plasmid was constructed, and recombinant plasmid DNA containing the target gene RdRp fragment was created. The recombinant plasmid was transformed into DH5α competent cells for amplification. The plasmid was extracted using the TIANGEN endotoxin-free plasmid mini-prep kit, and the plasmid concentration was determined using a full-wavelength microplate reader (Thermo Fisher Scientific). The plasmid was stored at -20℃. The partial genomic sequence of the target gene RdRp is shown below.

[0035] Target gene fragment: GCTATGAAGGGAAGACACCAATTTTCGAGGTGTTTAACAAAATACAAAAAGAATGGAAAACATTCTCACAACCAGTAGCCATCAGCTTTGACACAAAAGCCTGGGATACACAAGTAACACCTAA (SEQ ID NO. 4) After comparing the complete sequences of bamboo rat plague virus strains published in the NCBI GenBank database, specific primers and probes were designed for conserved regions of the bamboo rat plague virus, as shown in Table 1. The primers and probes were all sent to Wuhan Tianyi Huayu Biotechnology Co., Ltd. for synthesis and modification.

[0036] Table 1 Primer and Probe List

[0037] The sequence shown in SEQ ID NO.3 of the sequence listing of the present invention is a chemically modified DNA oligonucleotide chain; wherein, the base symbol 'n' at position 30 of the sequence represents tetrahydrofuran (THF), i.e., a baseless analog; the 5' end of the sequence is attached with a fluorescein (FITC) label, and the 3' end is attached with a C3 spacer.

[0038] Note: In the sequence list, n in SEQ ID NO.3 represents THF.

[0039] Example 2: Establishment and optimization of the reaction system The total reaction volume of 25 μL contained 6.45 μL of sterile water, 12.5 μL of A Buffer, 1 μL of 2 μM forward primer, 1 μL of 2 μM reverse primer, 0.3 μL of 2 μM probe, 2.5 μL of cDNA template, and 1.25 μL of B Buffer.

[0040] The specific steps are as follows: (1) Add the forward primer, reverse primer, probe and sterile water described in Example 1 to centrifuge tubes according to volume, add 12.5 μL of A Buffer, shake briefly and centrifuge to obtain a mixed solution; (2) Transfer the above mixed solution to a reaction unit tube containing the reaction powder, gently tap to mix, then add 2.5 μL of cDNA template to the PCR tube, mix, shake briefly and centrifuge quickly. (3) Add 1.25 μL of B Buffer, mix thoroughly, and activate the reaction; (4) Place the reaction tube in a thermostat at 39 °C and incubate for 30 min; (5) After the reaction is complete, take 5 μL of the reaction product and mix it with 100 μL of sterile water; (6) Visual detection using single nucleic acid test strips: Transfer 80 μL of diluted sample to the sample pad of the single nucleic acid test strip; observe the results after 2-5 minutes; The results are defined as follows: a positive sample should show two bands, while a negative sample should only show one band at the control line; when both the control line and the test line of the re-nucleic acid test strip appear, the sample is considered to contain bamboo rat plague virus.

[0041] Primer concentration optimization: With other reaction components remaining constant, upstream and downstream primers were added to the reaction system at volumes of 2 μL, 1.5 μL, 1 μL, and 0.5 μL, respectively, and brought to a final volume of 25 μL with sterile water. The reaction conditions remained unchanged, and a negative control (sterile water) was included to optimize the primer concentration for the RAA-LFD detection method. Amplification and detection of the positive standard plasmid were performed using primers at different concentrations, and the results are as follows: Figure 1 As shown, clearer detection and control lines appeared at the lowest primer concentration of 1.0 μL.

[0042] To conserve primers, 1.0 μL of primers will be used for the reaction in the following steps.

[0043] Optimization of reaction time: With other reactants in the system remaining constant, the reaction time was adjusted according to a temperature gradient of 20 min, 25 min, 30 min, 35 min, and 40 min. A negative control (sterile water) was set up. The results were obtained at different times according to the detection method of this invention. Figure 2 As shown, the bands are clearest at 30 minutes.

[0044] Subsequent experiments selected 30 min as the reaction temperature.

[0045] Example 3: Determination of Sensitivity Test The concentration of the constructed positive plasmid was determined using a full-wavelength microplate reader (Thermo Fisher Scientific). The copy number was calculated using the following formula: Copy number (copies / μL) = [DNA concentration (ng / μL) / fragment size (bp)] × 9.12 × 10⁻⁶ 11 The positive plasmid was then serially diluted 10-fold. Using the positive plasmids at different dilutions as templates, the primer concentrations and reaction conditions optimized in Example 2 were used, and a negative control (sterile water) was set up to determine the sensitivity of the RAA-LFD detection method.

[0046] The positive plasmids at different dilutions were detected according to the RAA-LFD detection method in Example 2.

[0047] The results are as follows Figure 3 As shown, from Figure 3 As can be seen, when the first primer pair, Pestivirus-F1 and Pestivirus-R1, and the probe Pestivirus-probe are used in the RAA-LFD method, the copy number is 2.44 × 10⁻⁶. 3 ~2.44×10 1 When the concentration is 2.44 copies / μL, clear detection and control bands are visible, indicating that the method has a sensitivity of 2.44 × 10⁻⁶. 1copies / μL, while the sensitivity of PCR detection is approximately 10. 3 Compared to the previous method, which used copies / μL, this detection method offers approximately 100-fold improved sensitivity. Meanwhile, the sensitivity of the qPCR detection is 10... 2 The sensitivity of this detection method is about 10 times higher than that of the previous method, indicating that the RAA-LFD detection method in this experiment has high sensitivity.

[0048] Example 4: Determination of Specificity Test To investigate whether there is cross-reactivity between the RAA-LFD detection method and other pathogens and bamboo rat host DNA, pangolin plague virus (Phlegmon) was selected. Pangolin pestivirus PPEV), low pathogenic avian influenza virus (PPEV), Avian influenza virus AIV subtype H9N2, canine parvovirus (AIV) Canine parvovirus CPV) and Klebsiella pneumoniae from bamboo rats ( Klebsiella pneumoniae Nucleic acid samples (Kp) were used as templates for non-target pathogens; simultaneously, genomic DNA from bamboo rat tissues, confirmed to be free of bamboo rat hemorrhagic virus, was used as a host-derived template for detection. Positive plasmid DNA containing the RdRp gene fragment of bamboo rat hemorrhagic virus was used as a template for a positive control, and a template-free reaction system was used as a negative control to evaluate the specificity of the RAA-LFD detection method.

[0049] The above-mentioned different templates were detected according to the RAA-LFD detection method of the present invention.

[0050] The results are as follows Figure 4 It shows that, from Figure 4 As can be seen, no bands appeared at the test line of the lateral flow chromatography test strip when the negative control was reacted with PPEV, CPV, H9N2, Klebsiella pneumoniae from bamboo rats and bamboo rat host DNA as templates, while bands appeared at the test line of the test strip of the positive control.

[0051] The above results indicate that this detection method does not cross-react with other common pathogens, does not react nonspecifically with host RNA, and has high specificity.

[0052] In summary, this invention provides RAA primer pairs that specifically recognize the conserved RdRp gene of bamboo rat plague virus and probes with FITC / Biotin dual labeling. Furthermore, by optimizing the primer concentration and using RAA-LFD technology, rapid detection of bamboo rat plague virus with high specificity and high sensitivity can be achieved.

[0053] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer-probe combination for detecting bamboo rat plague virus, characterized in that, The primers in the primer-probe combination include the forward primer Pestivirus-F1 and the reverse primer Pestivirus-R1; The nucleotide sequence of the forward primer Pestivirus-F1 is shown in SEQ ID NO.1; The nucleotide sequence of the reverse primer Pestivirus-R1 is shown in SEQ ID NO.2; The probe in the primer-probe combination is Pestivirus-probe, and the complete nucleotide sequence of the probe Pestivirus-probe is shown in SEQ ID NO.

3.

2. The primer-probe combination according to claim 1, characterized in that, The 5' end of the reverse primer Pestivirus-R1 sequence is modified with biotin.

3. The primer-probe combination according to claim 1, characterized in that, The 5' end of SEQ ID NO.3 is connected to fluorescein isothiocyanate, and the 3' end is connected to the C3 interarm.

4. A detection kit for detecting bamboo rat plague virus, characterized in that, The kit includes a negative control sample, a positive control sample, a buffer solution, a test strip, and the primer-probe combination as described in any one of claims 1-3.

5. A detection method for detecting bamboo rat plague virus for non-diagnostic purposes, characterized in that, The method includes the following steps: S1: Using total RNA from the sample to be tested as a template, cDNA is prepared using reverse transcription reagent; S2: Using the kit described in claim 4, perform a RAA reaction with the cDNA prepared in step S1, and obtain the reaction product after isothermal amplification; S3: Visually detect the reaction products obtained in step S2 using nucleic acid-lateral flow chromatography test strips.

6. The method according to claim 5, characterized in that, The RAA reaction system in step S2 consists of 6.45 μL of sterile water, 12.5 μL of A Buffer, 1 μL of 2 μM forward primer, 1 μL of 2 μM reverse primer, 0.3 μL of 2 μM probe, 2.5 μL of cDNA template, and 1.25 μL of B Buffer.

7. The method according to claim 6, characterized in that, The concentration of the cDNA was 2.44 × 10⁻⁶. 1 copies / μL.

8. The method according to claim 5, characterized in that, The RAA reaction temperature in step S2 is 39°C.

9. The method according to claim 5, characterized in that, The standard for visual detection in step S3 is that if red bands appear at both the control line and the test line of the test strip, the sample is determined to contain bamboo rat plague virus; if only the control line shows a band and the test line does not, the result is determined to be negative.

10. The application of the primer-probe combination according to any one of claims 1-3 or the kit according to claim 4 in the detection of bamboo rat plague virus, characterized in that, The application is not for disease diagnosis purposes.

Images