A primer group for rapidly detecting newcastle disease virus and its acquisition method and application

Abstract

The present application relates to the technical field of poultry detection, and particularly relates to a primer set for rapidly detecting newcastle disease virus and an obtaining method and application thereof, the primer set comprises F3, B3, FIP and BIP, the nucleotide sequence of the F3 is shown as SEQ ID NO. 33, the nucleotide sequence of the B3 is shown as SEQ ID NO. 34, the nucleotide sequence of the FIP is shown as SEQ ID NO. 35, and the nucleotide sequence of the BIP is shown as SEQ ID NO. 36. Compared with the prior art, the present application designs and screens the optimal 9th RT-LAMP primer set, adapts vRT-LAMP and fRT-LAMP two sets of systems, successfully establishes a double-layer grading detection scheme, realizes on-site rapid detection of NDV virulent strain, and effectively excludes false positives by combining fRT-LAMP and HRM analysis of suspicious positive samples.

Description

Technical Field

[0001] This invention relates to the field of avian disease detection technology, specifically to a primer set for rapid detection of Newcastle disease virus, its acquisition method, and its application. Background Technology

[0002] Newcastle disease (ND) is listed as a notifiable animal disease by the World Organisation for Animal Health (OIE), and is classified as a Class A animal disease by my country's Ministry of Agriculture and Rural Affairs. ND is an acute, highly contagious disease caused by a virulent strain of the Newcastle disease virus (NDV) in poultry. ND is characterized by high morbidity, high mortality, and rapid spread, causing enormous economic losses to the global poultry industry. Therefore, it is necessary to promptly screen and detect ND-infected poultry and isolate them in a timely manner to reduce its spread.

[0003] The current GB / T 16550-2020 standard for Newcastle disease diagnosis primarily uses a hemagglutination test to identify the virus, followed by reverse transcription polymerase chain reaction (RT-PCR) with upstream primer P1 of 5'-ATGGGCYCCAGAYCTTCTAC-3' and downstream primer P2 of 5'-CTGCCACTGCTAGTTGTGATAATCC-3' (where Y: C / T). However, this routine nucleic acid detection relies on expensive equipment and cannot meet the needs of rapid on-site screening at the grassroots level. Furthermore, existing technologies such as "Establishment of a Universal Fluorescent RT-PCR Detection Method for Newcastle Disease Virus" select conserved regions of the P gene to design universal primers and probes for NDV. Summary of the Invention

[0004] This invention provides a primer set for rapid detection of Newcastle disease virus, along with its acquisition method and application, aiming to solve the problems of existing detection methods being limited by testing equipment, which prevents rapid screening of highly virulent NDV strains at the grassroots level, and the missed detection of low-load samples.

[0005] To achieve the above objective, a primer set for rapid detection of Newcastle disease virus is provided, the primer set comprising: F3, B3, FIP and BIP, wherein the nucleotide sequence of F3 is shown in SEQ ID NO.33, the nucleotide sequence of B3 is shown in SEQ ID NO.34, the nucleotide sequence of FIP is shown in SEQ ID NO.35, and the nucleotide sequence of BIP is shown in SEQ ID NO.36.

[0006] SEQ ID NO.33: GCAAAATTATGGAGAAGCTGTA; SEQ ID NO.34: CCAAGGCATTGCTGATTG; SEQ ID NO.35: TCAAATTCCCACTGAGCCTCTCCCTGATAGATAGACATTCTTG; SEQ ID NO.36: AGATTCTCAGGTCATCGTGACATGTTGACGTTTCCAAGTTCA.

[0007] This application uses primers designed based on the conserved region of the F gene of the circulating Newcastle disease virus genotype VII strain. Compared to existing technologies that use the conserved region of the P gene, this approach offers several advantages: the F gene is a fusion protein mediating the fusion of the viral envelope with the host cell membrane and viral invasion; this cleavage site sequence is a major molecular marker of Newcastle disease virus virulence; and the P gene is a phosphorylated protein polymerase complex cofactor, readily binding to the L protein to perform replication / transcription; RNA editing produces the V and W proteins, and this gene exhibits significant variability. Therefore, this application utilizes primers designed based on the conserved region of the F gene, resulting in primers with better specificity for differentiating between virulent and weak strains and higher accuracy in detection results.

[0008] Preferably, in the above technical solution, the primer set is used in combination at concentrations of 0.1 μmol / LF3, 0.1 μmol / LB3, 0.8 μmol / LFIP and 0.8 μmol / LBIP.

[0009] To achieve the above objectives, the present invention also provides a method for obtaining the above-mentioned primer set, the method comprising: S1. Download the F gene sequence of a virulent NDV strain, design NDV primers using software, verify the specificity of the primers, and obtain several sets of candidate primers; S2, primers were screened using fRT-LAMP-HRM to select the optimal primer set; S3, the optimal primer sets F3, B3, FIP and BIP were configured into experimental groups with different concentration gradients, and the optimal concentration of the optimal primer sets was screened by fRT-LAMP-HRM experiment; S4. The optimal concentration of the optimal primer set is used as the detection primers for vRT-LAMP and fRT-LAMP. The results are compared with those of national standard RT-qPCR and WOAH RT-qPCR. When the optimal primer set is specific to a highly virulent strain, it is identified as the primer set for rapid detection of Newcastle disease virus.

[0010] Preferably, in the above technical solution, in S1, the NDV primers are designed using software to set the target sequence to 200-300 bp, the F3 / B3 span to 120-400 bp, the F1c / B1c Tm to 64-66℃, the F2 / B2 / F3 / B3 Tm to 59-61℃, the primer length to 18-22 nt, the GC to 40%-65%, the 5' and 3' ends to have ΔG ≤ -4 kcal / mol, and the primer dimer minimum free energy threshold to be ≥ -3 kcal / mol.

[0011] Preferably, in the above technical solution, the reaction system and reaction procedure of fRT-LAMP-HRM are as follows: The reaction system consisted of 0.5 μL 10×LAMP Buffer, 3.5 μL 10 mM dNTPs, 4.0 μL 5 M betaine, 1.5 μL 100 mM MgSO4, 1.0 μL 100 μM SYTO13 fluorescent dye, 1.0 μL primer mixture, 1.0 μL Bst3.0 DNA polymerase, 0.5 μL reverse transcriptase, and 1.0 μL template RNA, with enzyme-free deionized water added to a final volume of 25 μL. The reaction program was to amplify at 64℃ for 60 min, with fluorescence signals collected every minute. After amplification, the HRM program was automatically run: denaturation at 95℃ for 1 min, annealing at 63℃ for 1 min, and then slowly heated to 95℃ at a rate of 0.1℃ / s.

[0012] Preferably, in the above technical solution, the reaction system and reaction procedure of the vRT-LAMP are as follows: The vRT-LAMP reaction system consisted of 2.5 μL 10×LAMP Buffer, 3.5 μL 10 mM dNTPs, 4.0 μL 5 M betaine, 1.5 μL 100 mM MgSO4, 1.0 μL 2 mM HNB, 1.0 μL primer mixture, 1.0 μL Bst 3.0 DNA polymerase, 0.5 μL reverse transcriptase, and 1.0 μL template RNA. Enzyme-free deionized water was added to bring the volume to 25 μL, and 50 μL of liquid paraffin was placed on top of the liquid. The vRT-LAMP reaction program is a constant temperature of 64℃ in a water bath for 60 minutes, and the results are visually interpreted after the reaction is complete.

[0013] Preferably, in the above technical solution, the screening conditions for selecting the optimal primer set in S2 are strong positive amplification, low background and Nt / Pt≥1.5.

[0014] To achieve the above objectives, the present invention also provides a primer set for rapid detection of Newcastle disease virus (NDV) for rapid screening of virulent NDV strains.

[0015] Preferably, in the above technical solution, the rapid screening of highly virulent NDV strains specifically involves: collecting samples, first performing on-site preliminary screening using a vRT-LAMP system containing the primer set according to the vRT-LAMP procedure, and then performing fRT-LAMP combined with HRM analysis on suspicious positive samples in the preliminary screening for confirmation.

[0016] Preferably, in the above technical solution, the highly virulent NDV strains include F48E9 and SD01.

[0017] Compared with the prior art, the beneficial effects of this application are as follows: This study designed and screened the optimal RT-LAMP primer set No. 9 for the conserved region of the F gene in the circulating strain of Newcastle disease virus (NDV) genotype VII, adapting it to both vRT-LAMP and fRT-LAMP systems. A two-tiered detection protocol was successfully established: first, a visualization-based RT-LAMP using hydroxynaphthol blue (HNB) (vRT-LAMP) for rapid initial screening at the grassroots level; second, fRT-LAMP using SYTO 13 fluorescent dye (hereinafter referred to as fRT-LAMP), supplemented by high-resolution melting curve (hereinafter referred to as HRM) analysis, specifically for accurate verification of positive samples in the laboratory. This tiered detection method specifically amplifies only virulent wild-type NDV strains, showing no cross-reactivity with NDV vaccine strains and 13 common avian viruses. The HRM analysis of positive products showed a single characteristic peak (Tm value of 85.7℃).

[0018] The two-tiered detection system constructed by this institute has a clear division of labor: vRT-LAMP is easy to operate, and the results can be directly interpreted by the naked eye, with results available on-site within 60 minutes, meeting the timeliness requirements for emergency screening and highly meeting the needs of on-site initial screening; fRT-LAMP combined with HRM analysis can effectively eliminate false positives, using a single characteristic melting peak at 85.7℃ as the criterion for determining a positive result for wild-type virus, accurately distinguishing specific products from non-specific impurities such as primer dimers, and ensuring the accuracy of the results; the combination of vRT-LAMP and fRT-LAMP-HRM provides a complete technical solution for the rapid detection of Newcastle disease wild-type virus. Attached Figure Description

[0019] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings.

[0020] Figure 1 This is a bar chart showing the positive and negative peak times of the fluorescent RT-LAMP screening primers for 20 candidate primers; Figure 2 The amplification patterns of fRT-LAMP assays with five concentration gradients of the optimal primers are shown. Figure 3 The graph shows the HRM melting curves for five concentration gradients of the optimal primers. Figure 4 Different concentrations (10) of highly virulent NDV strains 0 ~10 -6 The color development diagram of vRT-LAMP; Figure 5 Different concentrations (10) of highly virulent NDV strains 0 ~10 -6 amplification patterns of fRT-LAMP assays; Figure 6 Different concentrations (10) of highly virulent NDV strains 0 ~10 -6 RT-qPCR amplification pattern; Figure 7 This is a colorimetric graph showing the results of vRT-LAMP detection of virulent Newcastle disease strains and common avian vaccines; Figure 8 This is an amplification map of virulent Newcastle disease strains and common avian vaccines detected by fRT-LAMP; Figure 9 This is an HRM melting curve of fRT-LAMP assays of virulent Newcastle disease strains and common avian vaccines. Figure 10 This is a flowchart illustrating the application of the present invention. Detailed Implementation

[0021] The technical solutions in the embodiments of this invention are clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. Example 1

[0022] (1) Equipment: constant temperature water bath (temperature control accuracy ±0.5 ℃); real-time fluorescence quantitative PCR instrument (with HRM function); -80 ℃ ultra-low temperature freezer; biosafety cabinet (2) Reagents: Bst 3.0 DNA polymerase and WarmStart reverse transcriptase were purchased from NEB; one-step fluorescent premix was purchased from Aikerui; animal RNA extraction kit was purchased from Tiangen; SYTO 13 fluorescent dye was purchased from Invitrogen; hydroxynaphthol blue (HNB) and betaine were purchased from Sigma; dNTP, MgSO4, liquid paraffin and enzyme-free water were all of molecular biology grade.

[0023] (3) Test strain: 3.1. Highly virulent NDV strains: RNA from the standard highly virulent F48E9 strain and RNA from the domestically dominant genotype VII highly virulent isolate chicken / China / SD01 / 2016 (KY075887.1) were both provided by the China Animal Disease Prevention and Control Center.

[0024] 3.2 NDV vaccine strains: La Sota strain, Clone30 strain, CS2 strain, and La Sota+H52 bivalent live vaccine are all products of Harbin Pharmaceutical Group Biological Vaccine Co., Ltd.

[0025] 3.3 Other raw materials for avian diseases: Duck plague live vaccine (Harbin Pharmaceutical Group), duck viral hepatitis attenuated live vaccine CH60 strain (Harbin Pharmaceutical Group), goose plague live vaccine SYG41-50 strain, chicken infectious laryngotracheitis live vaccine K317 strain (Ruipu Biopharmaceutical), Muscovy duck reovirus disease live vaccine CA strain (Yibang Biotechnology), infectious bursal disease live vaccine B87 strain (Harbin Pharmaceutical Group), fowlpox live vaccine quail-modified attenuated strain (Harbin Pharmaceutical Group), Marek's disease turkey herpesvirus live vaccine FC-126 strain (Harbin Pharmaceutical Group), duck parvovirus live vaccine (Guangdong Wenshi Dahua Agricultural Biotechnology), avian influenza virus H9 subtype hemagglutination inhibition test antigen (Harbin Pharmaceutical Group), duck Tembusu virus inactivated vaccine DF2 strain (Wuhan Keqian), avian influenza virus H5 subtype (H5-Re14 strain) hemagglutination inhibition test antigen (Harbin Pharmaceutical Group), avian influenza virus H7 subtype (H7-Re4 strain) hemagglutination inhibition test antigen (Harbin Pharmaceutical Group). All materials were reconstituted according to the instructions before total RNA was extracted, and a template-free negative control was set up.

[0026] The F gene sequence (accession number KY075887.1) of the dominant virulent strain chicken / China / SD01 / 2016 (hereinafter referred to as SD01 strain) was downloaded from GenBank. NDV RT-LAMP primers were designed using PrimerExplorer V5 software, including F3 / B3 and FIP / BIP, with target sequences controlled at 200-300 bp and F3 / B3 spanning 120-400 bp. The Tm for F1c / B1c was 64-66℃, and for F2 / B2 / F3 / B3 it was 59-61℃. Primer lengths were 18-22 nt, GC content was 40%-65%, and ΔG at the 5' and 3' ends was ≤-4 kcal / mol. The minimum free energy of the primer dimer was [not specified]. dG threshold: ≥-3 kcal / mol. After design, the primer specificity was verified using BLAST software, and 20 sets of candidate primers were finally obtained. The F3 / B3 and FIP / BIP of these 20 sets of candidate primers are as follows:

[0027]

[0028]

[0029]

[0030] After synthesis, the above primers were diluted to working concentration with DNA / RNA-free deionized water and stored at −20℃ for later use.

[0031] Primer screening was performed using fRT-LAMP-HRM to generate amplification and melting curves. The specific methods are shown in the fRT-LAMP-HRM reaction system and reaction procedure below. Primer sets with significant differences between positive amplification and non-specific reactions, low background interference, and high amplification efficiency were screened out.

[0032] Melting curve: Fluorescence signals were continuously acquired while heating from 65℃ to 95℃ at a rate of 0.05℃ / s. Amplification characteristics were determined based on the peak shape and Tm value of the melting curve—specific positive amplification exhibited a single sharp melting peak, while non-specific reactions showed disordered peak shapes or deviated Tm values. Primer sets with significant differences between positive and non-specific reactions, low background interference, and high amplification efficiency were selected by combining real-time amplification curves and HRM analysis results.

[0033] RNA extraction template: RNA was extracted from the experimental materials using a magnetic bead extraction kit, following the instructions of the commercial kit. The extracted RNA was immediately used for RT-LAMP amplification or stored at −80℃.

[0034] The vRT-LAMP experiment was conducted, and the reaction system and procedure are as follows: vRT-LAMP reaction system: 2.5 μL 10×LAMP Buffer, 3.5 μL 10 mM dNTPs, 4.0 μL 5 M betaine, 1.5 μL 100 mM MgSO4, 1.0 μL 2 mM HNB, 1.0 μL primer mixture, 1.0 μL Bst 3.0 DNA polymerase, 0.5 μL reverse transcriptase and 1.0 μL template RNA, with enzyme-free deionized water added to a final volume of 25 μL, and 50 μL liquid paraffin covering the surface of the liquid. vRT-LAMP reaction procedure: 64℃ water bath for 60 min, and visual interpretation after the reaction is completed.

[0035] Judgment criteria: A positive result is indicated when the reaction solution changes from blue-purple to sky blue, while a negative result is indicated when there is no color change.

[0036] The fRT-LAMP-HRM experiment was conducted, and the reaction system and procedure are as follows: The fRT-LAMP-HRM reaction system consisted of: 2.5 μL 10×LAMP Buffer, 3.5 μL 10 mM dNTPs, 4.0 μL 5 M betaine, 1.5 μL 100 mM MgSO4, 1.0 μL 100 μM SYTO13 fluorescent dye, 1.0 μL primer mixture, 1.0 μL Bst 3.0 DNA polymerase, 0.5 μL reverse transcriptase, and 1.0 μL template RNA. Enzyme-free deionized water was added to bring the volume to 25 μL, and 50 μL of liquid paraffin was placed on top of the mixture. fRT-LAMP-HRM reaction program: Amplification at 64℃ for 60 min, with fluorescence signals acquired every minute. After amplification, the HRM program is automatically run: denaturation at 95℃ for 1 min, annealing at 63℃ for 1 min, and then slowly increasing the temperature to 95℃ at a rate of 0.1℃ / s, continuously acquiring fluorescence signals and plotting melting curves.

[0037] Judgment criteria: If a typical amplification curve is present, and the melting peak and Tm value are consistent with the positive control, it is judged as NDV positive; if there is no typical fluorescence amplification curve, or although there is an amplification signal, the melting peak shape and Tm value are significantly different from the positive control, it is judged as negative.

[0038] The results of fRT-LAMP primer screening of the above 20 sets of RT-LAMP primers are as follows: Figure 1 As shown.

[0039] from Figure 1 It can be seen that, except for candidate primer group 9, the other 19 candidate primer groups all have obvious defects such as late positive peak onset or early negative peak onset, and their Nt / Pt < 1.5, resulting in insufficient differentiation between positive and negative signals and no application value. In contrast, candidate primer group 9 exhibits strong positive amplification, low background, and a Pt value of 20.01 min and an Nt value of 63.05 min, resulting in an Nt / Pt = 3.15. The difference between positive and negative reactions is significant, indicating high application value. Furthermore, candidate primer group 9 covers the 1227–1435 nt region of the NDV F gene, which encodes a membrane fusion protein, and this sequence is conserved. Therefore, candidate primer group 9 is selected as the optimal primer group.

[0040] The optimal primer set was formulated into 5 primer concentration gradient experimental groups, and the grouping is shown in Table 2.

[0041] Table 2. Primer Concentration Gradient Experiment Grouping F3 / B3 / FIP / BIP (μmol / L) 0.2 / 0.2 / 1.6 / 1.6 0.1 / 0.1 / 0.8 / 0.8 0.05 / 0.05 / 0.4 / 0.4 0.025 / 0.025 / 0.2 / 0.2 0.0 / 0.0 / 0.0 / 0.0 Using NDV SD01 strain RNA as a positive template and deionized water as a negative control, the fRT-LAMP-HRM assay was performed. The experimental method was the same as described above for the fRT-LAMP-HRM assay. The results are shown in Table 3 and... Figure 2As shown in the figure. The optimal primer concentration was determined by comprehensively evaluating the positive peak time, negative control amplification, HRM melting peak, and Tm value.

[0042] Table 3 Results of primer concentration gradient fRT-LAMP assay Positive control peak onset time (min) 20.73 22.09 55.08 U U Negative control peak onset time (min) U U U U U Tm (°C) 85.2 85.0 85.3 U U Note: U stands for Undetected, indicating that no detection was detected. From Table 3 and Figure 2-3 It can be seen that gradient 2 performed best: the positive amplification showed a typical amplification curve with a peak time of 22.09 min, and the HRM melting curve showed a single sharp characteristic peak without primer dimer peaks or non-specific peaks. The negative control showed no amplification signal throughout the process and the melting curve was flat without peaks. Although gradient 1 had a slightly faster positive peak (20.73 min), the higher the primer concentration, the greater the risk of non-specific amplification. When the positive reaction intensity was comparable, a lower primer concentration was selected to increase safety redundancy. The positive peak time of gradient 3 dropped sharply to 55.08 min, and the amplification efficiency decreased significantly. Gradients 4 and 5 showed no amplification signal. Considering the amplification efficiency, specificity, and HRM curve, gradient 2 with concentrations of F3 / B3 / FIP / BIP = 0.1 / 0.1 / 0.8 / 0.8 was determined to be the optimal primer concentration.

[0043] NDV viability and attenuation strain detection test: RNA from virulent NDV strains F48E9 and SD01, and vaccine strains La Sota, Clone30, and CS2 were used as test samples. RNA was extracted from each strain as a template, and a template-free negative control was simultaneously set up. Initial screening was performed using vRT-LAMP, followed by identification using fRT-LAMP-HRM.

[0044] The results were validated using both the national standard detection method and the WOAH recommended method, fluorescent RT-PCR, to evaluate the performance of vRT-LAMP and fRT-LAMP-HRM. The national standard detection method was GB / T 16550 "Newcastle Disease Diagnostic Techniques" real-time fluorescent RT-PCR, which is mainly applicable to the detection of highly virulent Class II NDV strains prevalent in my country. The upstream and downstream primers were (5'-CTCAGACAGGGTCAATCATAGT-3') and (5'-GCAACCCCAAGAGCTACA-3'); the probe was (5'-FAM-ATRAAGCGTTTYTGYCTCCTTCCTCC-BHQ1-3').

[0045] The fluorescent RT-PCR detection method included in Clause 1.9 of the WOAH Terrestrial Animal Diagnostic Tests and Vaccines Manual can effectively detect all mainstream NDV genotypes of Class I and Class II branches, from genotypes I to XIII. It can simultaneously cover both virulent and attenuated NDV strains. The upstream and downstream primers are (5'-GAGCTAATGAACATTCTTTC-3') and (5'-AATAGGCGGACCACATCTG-3'), and probe 1 is (5'-FAM-CCAATCAACTTCCC-MGB-3') and probe 2 is (5'-VIC-AATAGTGTATGACAACAC-MGB-3'). A positive result is obtained when both of the above dual probes show specific amplification curves.

[0046] The results of the above-mentioned detection tests of highly virulent NDV strains and vaccine strains are shown in Table 4.

[0047] Table 4 Results of NDV virulent strain and vaccine strain detection tests vRT-LAMP + + - - - fRT-LAMP (min) 39.63 33.7 U U U RT-qPCR (cycle) GB / T 22.43 26.09 U U U RT-qPCR (cycle) WOAH 26.41 / 24.21 27.97 / 25.86 21.85 / 23.03 21.02 / 21.62 23.49 / 22.08 As shown in Table 4, only the F48E9 and SD01 results of vRT-LAMP changed from blue-purple to sky blue, indicating a positive result. However, the La Sota, Clone30, CS2 vaccine strains and the negative control showed no color change, and the results were all negative. This indicates that vRT-LAMP can only detect the virulent NDV strain system but has no detection effect on the NDV vaccine strain system.

[0048] The results of fRT-LAMP combined with HRM were completely consistent with those of vRT-LAMP: the two virulent NDV strains showed typical amplification curves at 39.63 and 33.7, while the vaccine strain and negative control showed no fluorescent amplification signal. This indicates that the three detection methods—RT-LAMP combined with HRM, vRT-LAMP, and the national standard RT-qPCR—all exhibited high specificity for virulent strains, effectively eliminating background interference from vaccine immunization and accurately identifying pathogenic virulent strains. WOAH RT-qPCR showed positive reactions for five strains: F48E9, SD01, La Sota, Clone30, and CS2, with Ct values ​​ranging from 21 to 28. This method can effectively screen for the presence of Newcastle disease vaccine virus in samples, but it cannot distinguish whether the detected virus is a highly pathogenic wild-type strain or a harmless attenuated vaccine strain.

[0049] Detection was performed using serial dilution: RNA from NDV virus strains F48E9 and SD01 was serially diluted 10-fold (10... 0 ~10 -6The detection was performed using three methods: vRT-LAMP, fRT-LAMP, and RT-qPCR (GB / T 16550). The experimental results were compared, and the relative limit of detection of the detection system was evaluated. The operation steps and judgment methods were the same as those for vRT-LAMP, fRT-LAMP, and GB / T 16550. The results are shown in Table 5. Figure 4 , Figure 5 and Figure 6 As shown.

[0050] Table 5. Limits of detection for vRT-LAMP, fRT-LAMP, and RT-qPCR methods. vRT-LAMP + + + + + - - - fRT-LAMP (min) 23.3 26.89 30.76 35.52 44.26 U U U RT-qPCR (cycle) 22.43 26.09 29.54 33.09 34.99 U U U Figure 4 The numbers 1-8 on the centrifuge tubes represent concentrations of 10⁻⁶ and 10⁻⁶, respectively. 0 10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 And NC (negative control), the vRT-LAMP detection results in Table 5 and Figure 4 In combination, it can be concluded that when the RNA concentration of NDV virus strains F48E9 and SD01 is 10... 0 10 -1 10 -2 10 -3 10 -4 At that time, it can be detected by vRT-LAMP.

[0051] Figure 5 This is the amplification pattern of fRT-LAMP, from Figure 5 As can be seen, there were 5 smooth upward curves without any noise interference, indicating that fRT-LAMP detected 5 positive amplifications. Meanwhile, the fRT-LAMP detection method in Table 5 can detect NDV virus concentrations of 10... 0 10 -1 10 -2 10 -3 10 -4 Furthermore, the gradient change of NDV virus concentration in the sample from high to low can be estimated based on the rise time of the amplification curve.

[0052] Figure 6 This is the detection amplification pattern of commercial RT-qPCR.

[0053] Therefore, from Table 5, Figure 4 , Figure 5 and Figure 6It can be seen that the detection results of vRT-LAMP and fRT-LAMP are completely consistent with those of commercial RT-qPCR, and their sensitivity is consistent with that of commercial RT-qPCR. Furthermore, the limits of detection for all three methods are 10-1. -7 NDV RNA diluted 10 times.

[0054] Sample testing: RNA from F48E9, SD01 strains, multiple NDV vaccines, and 13 other avian viruses were used as templates, with a template-free negative control (NTC). The samples were analyzed stepwise using vRT-LAMP and fRT-LAMP methods. The results are shown below. Figure 7 , Figure 8 and Figure 9 As shown.

[0055] Figure 7 This is a colorimetric graph of vRT-LAMP detection. The labels in the graph represent: 1 for Newcastle disease standard virulent strain F48E9 RNA, 2 for domestically superior virulent strain SD12 RNA, 3 for duck plague live vaccine (Harbin Pharmaceutical Group), 4 for duck viral hepatitis attenuated live vaccine CH60 strain (Harbin Pharmaceutical Group), 5 for gosling plague live vaccine SYG41-50 strain (Sinopharm), 6 for chicken infectious laryngotracheitis live vaccine K317 strain (Ruipu Biopharmaceutical), 7 for Muscovy duck reovirus disease live vaccine CA strain (Ebang Biotechnology), 8 for chicken Newcastle disease live vaccine LaSota strain (Harbin Pharmaceutical Group), and 9 for chicken Newcastle disease La... The following vaccines are listed: 10. Live vaccine for infectious bronchitis (HBV) strain 10 + live vaccine for infectious bursal disease (HBV) strain B87 (HBV); 11. Live vaccine for fowlpox (HBV) strain quail-modified attenuated (HBV); 12. Live vaccine for Marek's disease (HBV) strain FC-126 (HBV); 13. Live vaccine for duck parvovirus (Guangdong Wenshi Dahua Agricultural Biotechnology Co., Ltd.); 14. Live vaccine for Newcastle disease (HBV) strain Clone30 (HBV); 15. Live vaccine for Newcastle disease (HBV) strain CS2 (HBV); 16. Hemagglutination inhibition test antigen for avian influenza virus H9 subtype (HBV); 17. Inactivated vaccine for duck Tembusu virus (HBV) strain DF2 (Wuhan Keqian); 18. Hemagglutination inhibition test antigen for avian influenza virus H5 subtype (H5-Re14 strain) (HBV); 19. Hemagglutination inhibition test antigen for avian influenza virus H7 subtype (H7-Re4 strain) (HBV); 20. Negative control (NC).

[0056] from Figure 7 It can be seen that in the vRT-LAMP specific detection, only two strains of virulent Newcastle disease virus F48E9 RNA and SD12 RNA showed positive reactions, while the NDV vaccine strain, the remaining 13 avian virus vaccine strains and the negative control showed no color change and were negative reactions.

[0057] Figure 8This is the amplification pattern of fRT-LAMP. As can be seen from the figure, only two highly virulent NDV strains, numbered 1 and 2, show typical logarithmic amplification curves. Figure 9 The fRT-LAMP product HRM also confirmed that only the two highly virulent NDV strains, numbered 1 and 2, showed a single sharp and specific characteristic peak in their high-resolution melting curves, with a stable melting temperature Tm of 85.7℃; all other test samples did not produce fluorescent amplification signals, had no specific melting peaks, and did not exhibit cross-amplification.

[0058] The overall results show that this primer set specifically recognizes only virulent wild-type NDV strains and has excellent diagnostic capabilities for wild-type virus / vaccine differentiation.

[0059] Various implementations are not limited to the embodiments described above, and those skilled in the art will understand that the present invention can be implemented in other specific ways without changing the technical concept or essential features of the invention. Therefore, it should be understood that the embodiments described above are exemplary and not intended to limit the present invention.

Claims

1. A primer set for rapid detection of Newcastle disease virus, characterized in that, The primer set includes F3, B3, FIP, and BIP, wherein the nucleotide sequence of F3 is shown in SEQ ID NO.33, the nucleotide sequence of B3 is shown in SEQ ID NO.34, the nucleotide sequence of FIP is shown in SEQ ID NO.35, and the nucleotide sequence of BIP is shown in SEQ ID NO.

36.

2. The primer set for rapid detection of Newcastle disease virus as described in claim 1, characterized in that, The primer set was used at a concentration of 0.1 μmol / LF3, 0.1 μmol / LB3, 0.8 μmol / LFIP and 0.8 μmol / LBIP mixed together.

3. The method for obtaining the primer set as described in any one of claims 1-2, characterized in that, The acquisition method includes: S1. Download the F gene sequence of a virulent NDV strain, design NDV primers using software, verify the specificity of the primers, and obtain several sets of candidate primers; S2, primers were screened using fRT-LAMP-HRM to select the optimal primer set; S3, the optimal primer sets F3, B3, FIP and BIP were configured into experimental groups with different concentration gradients, and the optimal concentration of the optimal primer sets was screened by fRT-LAMP-HRM experiment; S4. The optimal concentration of the optimal primer set is used as the detection primers for vRT-LAMP and fRT-LAMP. The results are compared with those of national standard RT-qPCR and WOAH RT-qPCR. When the optimal primer set is specific to a highly virulent strain, it is identified as the primer set for rapid detection of Newcastle disease virus.

4. The method for obtaining the primer set as described in claim 3, characterized in that, In S1, NDV primers were designed using software, with target sequences controlled at 200-300 bp, F3 / B3 span at 120-400 bp, F1c / B1c Tm at 64-66℃, F2 / B2 / F3 / B3 Tm at 59-61℃, primer length at 18-22 nt, GC at 40%-65%, 5' and 3' end ΔG ≤ -4 kcal / mol, and primer dimer minimum free energy threshold ≥ -3 kcal / mol.

5. The method for obtaining the primer set as described in claim 3, characterized in that, The reaction system and reaction procedure of fRT-LAMP-HRM are as follows: The reaction system consisted of 0.5 μL 10×LAMP Buffer, 3.5 μL 10 mM dNTPs, 4.0 μL 5 M betaine, 1.5 μL 100 mM MgSO4, 1.0 μL 100 μM SYTO13 fluorescent dye, 1.0 μL primer mixture, 1.0 μL Bst 3.0 DNA polymerase, 0.5 μL reverse transcriptase, and 1.0 μL template RNA, with enzyme-free deionized water added to a final volume of 25 μL. The reaction program was to amplify at 64℃ for 60 min, with fluorescence signals collected every minute. After amplification, the HRM program was automatically run: denaturation at 95℃ for 1 min, annealing at 63℃ for 1 min, and then slowly heated to 95℃ at a rate of 0.1℃ / s.

6. The method for obtaining the primer set as described in claim 3, characterized in that, The reaction system and reaction procedure of the vRT-LAMP are as follows: The vRT-LAMP reaction system consisted of 2.5 μL 10×LAMP Buffer, 3.5 μL 10 mM dNTPs, 4.0 μL 5 M betaine, 1.5 μL 100 mM MgSO4, 1.0 μL 2 mM HNB, 1.0 μL primer mixture, 1.0 μL Bst 3.0 DNA polymerase, 0.5 μL reverse transcriptase, and 1.0 μL template RNA. Enzyme-free deionized water was added to bring the volume to 25 μL, and 50 μL of liquid paraffin was placed on top of the liquid. The vRT-LAMP reaction program is a constant temperature of 64℃ in a water bath for 60 minutes, and the results are visually interpreted after the reaction is complete.

7. The method for obtaining the primer set as described in claim 3, characterized in that, The screening criteria for the optimal primer set in S2 are strong positive amplification, low background, and Nt / Pt ≥ 1.

5.

8. The primer set for rapid detection of Newcastle disease virus as described in any one of claims 1-2 is used for rapid screening of virulent NDV strains.

9. The primer set for rapid detection of Newcastle disease virus as described in claim 8 is used for rapid screening of virulent NDV strains, characterized in that, The rapid screening of highly virulent NDV strains specifically involves: collecting samples, first conducting on-site preliminary screening using a vRT-LAMP system containing the primer set according to the vRT-LAMP procedure, and then performing fRT-LAMP combined with HRM analysis on suspicious positive samples in the preliminary screening for confirmation.

10. The primer set for rapid detection of Newcastle disease virus as described in claim 8 is used for rapid screening of virulent NDV strains, characterized in that, The highly virulent NDV strains include F48E9 and SD01.

Images