A fluorescence sensor for ab42 based on peptide-nucleic acid dual recognition and gold-silver alloy nanoparticle quenching, and a preparation method and application thereof

Abstract

The application discloses a kind of based on peptide-nucleic acid double recognition and gold-silver alloy nanoparticles quenching A beta 42 fluorescence sensor and its preparation method and application, belong to biological sensing and Alzheimer's disease in vitro diagnosis technical field.The sensor utilizes tetrahedral DNA nanoframe as rigid support, and is modified with nucleic acid aptamer of specific recognition A beta 42 at its vertex, and embeds fluorescent group in skeleton;Polypeptide is used as second recognition element, and is modified on the surface of AuAgNPs.The application significantly improves detection specificity by peptide-nucleic acid double recognition mechanism, and effectively overcomes the interference of complex serum matrix.The LOD of the sensor to A beta 42 can reach fg / mL, in 0.01-100 pg / mL range, good linear relationship is shown, and reproducibility is excellent.The application does not need expensive instrument, reaction time is fast, provides low-cost, fast, accurate technical scheme for early high-throughput blood screening of Alzheimer's disease.

Description

Technical Field

[0001] This invention relates to the field of biosensing and in vitro diagnostic technology for Alzheimer's disease, and in particular to an Aβ42 fluorescent sensor based on peptide-nucleic acid dual recognition and quenching by gold-silver alloy nanoparticles (AuAgNPs), its preparation method and application. Background Technology

[0002] Alzheimer's disease (AD), a global and irreversible neurodegenerative disease, seriously threatens the health and quality of life of the elderly. Its core pathological feature is the abnormal deposition of amyloid-β (Aβ) in the brain, forming senile plaques. Among various Aβ peptides, Aβ42 is widely recognized as a major driver of senile plaque formation due to its stronger aggregation tendency and neurotoxicity. Therefore, highly sensitive and specific quantitative detection of Aβ42, especially in the early stages of the disease, is crucial for the diagnosis, prognostic assessment, and monitoring of treatment regimens in AD.

[0003] Currently, the diagnosis of Alzheimer's disease (AD) primarily relies on invasive cerebrospinal fluid (CSF) testing and expensive positron emission tomography (PET) imaging. While these two methods are considered the "gold standard," their inherent invasiveness, high cost, and complex operation make them unsuitable for large-scale population screening. In contrast, blood samples, due to their ease of acquisition and high reproducibility, have become an ideal source for developing novel AD diagnostic tools. However, the concentration of Aβ42 in blood is extremely low, and it exists in various polymeric states and bound to other proteins in the complex serum matrix, posing a significant challenge to traditional analytical methods. Therefore, developing a novel detection technology that can adapt to the complex blood environment, is highly sensitive, easy to operate, and inexpensive is a cutting-edge research topic in the field of Aβ detection.

[0004] Fluorescence analysis methods, due to their inherent advantages such as low cost, ease of use, and high sensitivity, have become ideal detection methods. This sensing method achieves efficient loading of fluorescent probes and in-situ signal amplification through the rigid support of tetrahedral nucleic acids. Utilizing the excellent quenching properties of AuAg alloy nanoparticles, combined with interfacial antifouling modification of multifunctional peptides, background interference from complex matrices is significantly reduced. A pioneering "nucleic acid tetrahedron-functional peptide" dual-recognition sandwich mechanism is employed, which greatly enhances detection specificity through cross-validation. This method exhibits excellent stability in serum environments, with intra-batch reproducibility errors strictly controlled within 5%. With its ultra-high sensitivity and anti-interference capability, this strategy provides a reliable and rapid analytical solution for early blood screening of Alzheimer's disease. Summary of the Invention

[0005] To address the technical problems of insufficient sensitivity, high cost, and limited throughput in existing detection technologies for Aβ42, this invention provides an Aβ42 fluorescent sensor based on peptide-nucleic acid dual recognition and quenching by gold-silver alloy nanoparticles (AuAgNPs), along with its preparation method and applications. This sensor utilizes a tetrahedral DNA nanoframework (TDN) as a rigid scaffold, with nucleic acid aptamers specifically recognizing Aβ42 modified at its vertices, and fluorescent groups embedded within the framework. Simultaneously, a peptide is used as a second recognition element, modified onto the surface of AuAgNPs. The Aβ42 fluorescent sensor based on peptide-nucleic acid dual recognition and quenching by gold-silver alloy nanoparticles (AuAgNPs) provided by this invention improves the sensitivity, specificity, speed, and scalability of the analytical method.

[0006] The first objective of this invention is to provide an Aβ42 fluorescence sensor based on peptide-nucleic acid dual recognition and gold-silver alloy nanoparticle quenching, comprising a DNA tetrahedron specifically recognizing Aβ42 with a surface modified with fluorescent signal molecules, and a composite quenching unit with AuAgNPs surface modified with multifunctional peptides.

[0007] The second objective of this invention is to provide a method for preparing the Aβ42 fluorescence sensor based on peptide-nucleic acid dual recognition and gold-silver alloy nanoparticle quenching, characterized by comprising the following steps: I. DNA tetrahedra with surface-modified fluorescent signal molecules that specifically recognize Aβ42 were prepared by the following method: Four single-stranded DNT1, DNT2, DNT3 and DNT4 containing the Aβ42 aptamer sequence were taken and dissolved in buffer to obtain a DNA mixture solution. The DNA mixture solution was heated to destroy the secondary structure, and then transferred to an ice water bath and left to stand for more than 30 minutes to promote complementary base pairing between single strands and obtain a stable three-dimensional rigid framework structure. The three-dimensional rigid framework structure was mixed with a fluorescent dye and co-incubated to obtain a DNA tetrahedron with a surface modified with fluorescent signal molecules that specifically recognizes Aβ42. II. The composite quenching unit is prepared by the following method: Spherical gold-silver alloy nanoparticles were dispersed in a buffer solution, and then Aβ42 multifunctional peptide solution was added. The mixture was incubated in the dark, allowing the multifunctional peptide to spontaneously assemble on the surface of the spherical gold-silver alloy nanoparticles through physical adsorption and affinity, thus obtaining the composite quenching unit. 3. The Aβ42 fluorescent sensor is obtained by mixing the DNA tetrahedron with the surface modified with fluorescent signal molecules that specifically recognize Aβ42 with the composite quenching unit.

[0008] In some embodiments of the present invention, in step one, the buffer solution is a TM buffer solution with a pH of 7.4-8.0; The sequence of DNT1 is shown in SEQ ID NO 1 (ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTATTTTTGGGACCAGTACAAAAGTGGGTAGGGCGGG). The sequence of DNT2 is shown in SEQ ID NO 2 (TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATA). The sequence of DNT3 is shown in SEQ ID NO 3 (TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC). The sequence of DNT4 is shown in SEQ ID NO 4 (TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT). The final concentration of the four single-stranded DNAs in the DNA mixture is 2 μM.

[0009] In some embodiments of the present invention, in step one, the conditions for the heating reaction are: heating temperature of 95-100°C and heating time of 10-15 min.

[0010] In some embodiments of the present invention, in step one, the co-incubation time is 0-30 min and the temperature is 37°C; the volume ratio of the tetrahedral framework structure to the fluorescent dye is 4:1, the concentration of the tetrahedral framework structure is 2 μM, and the concentration of the fluorescent dye is 5 μM.

[0011] In some embodiments of the present invention, in step two, the average particle size of the spherical gold-silver alloy nanoparticles is 10~50nm; The concentration of the spherical gold-silver alloy nanoparticles is 6.58-6580 mg / mL; The concentration of the Aβ42 multifunctional peptide solution is 0.5-4 μM; The volume ratio of the spherical gold-silver alloy nanoparticles to the Aβ42 multifunctional peptide is 4:1. The sequence of the Aβ42 multifunctional peptide is shown in SEQ ID NO 5 (CKEKEKEKEKLVFF).

[0012] In some embodiments of the present invention, in step two, the conditions for incubation in the dark are: a temperature of 4°C and a time of 12 to 16 hours.

[0013] The third objective of this invention is to provide the application of the aforementioned Aβ42 fluorescence sensor based on peptide-nucleic acid dual recognition and gold-silver alloy nanoparticle quenching in the qualitative or quantitative detection of Aβ42.

[0014] In some embodiments of the present invention, the concentration of Aβ42 in the quantitative detection is 0.01 pg / mL-100 pg / mL.

[0015] In some embodiments of the present invention, the interaction time between the Aβ42 fluorescence sensor and the sample to be detected is 10 min-25 min, and the temperature is 37°C.

[0016] This invention combines AuAgNPs with a multifunctional peptide possessing interface modification, antifouling, and recognition properties through overnight incubation to form a composite quenching unit. The DNA tetrahedron is then mixed with the composite quenching unit. When Aβ42 is present in the system, Aβ42 can be specifically recognized by both the DNA tetrahedron and the multifunctional peptide, forming a sandwich structure of "tetrahedron-Aβ42-peptide-AuAgNPs". Because AuAgNPs quench tetrahedral fluorescence, the system exhibits efficient fluorescence quenching. Without Aβ42, the sandwich structure cannot be formed, and fluorescence quenching does not occur. This system integrates the spatial confinement and antifouling effect of nucleic acid nanostructures, the efficient quenching performance of noble metal nanoparticles, and the cross-validation mechanism of dual recognition elements, achieving quantitative detection of Aβ42 in complex serum matrices with an intra-batch reproducibility error of less than 5%.

[0017] The technical solution of the present invention has the following advantages compared with the prior art: The sensor developed in this invention utilizes a tetrahedral DNA nanoframework (TDN) as a rigid scaffold, with its vertices modified to specifically recognize Aβ42 nucleic acid aptamers, and a fluorescent group embedded within the framework. Simultaneously, a peptide is used as a second recognition element, modified onto the surface of AuAgNPs. When Aβ42 is present in the sample, it is simultaneously captured by both the aptamer and the peptide, forming a three-dimensional sandwich structure of "TDN-Aβ42-peptide-AuAgNPs," forcing the AuAgNPs closer to the fluorescent group and efficiently quenching fluorescence using the surface plasmon resonance effect of the nanomaterials. This invention significantly improves detection specificity through a peptide-nucleic acid dual recognition mechanism, effectively overcoming interference from complex serum matrices. Experiments show that the sensor achieves a detection limit for Aβ42 at the fg / mL level, exhibits good linearity in the range of 0.01-100 pg / mL, and demonstrates excellent reproducibility (RSD < 4.48%). This invention requires no expensive instruments and has a reaction time of only 20 minutes, providing a low-cost, rapid, and accurate technical solution for early high-throughput blood screening of Alzheimer's disease. Attached Figure Description

[0018] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein... Figure 1 This is a schematic diagram of the construction mechanism of the Aβ42 fluorescence sensor based on peptide-nucleic acid dual recognition and quenching by gold-silver alloy nanoparticles (AuAgNPs) as described in this invention.

[0019] Figure 2 This is a linear graph of the detection of Aβ42 by the Aβ42 fluorescence sensor based on peptide-nucleic acid dual recognition and gold-silver alloy nanoparticles (AuAgNPs) quenching obtained in Example 1 of the present invention in an aqueous solution system.

[0020] Figure 3 This is a linear graph of the detection of Aβ42 in human serum by the Aβ42 fluorescence sensor based on peptide-nucleic acid dual recognition and gold-silver alloy nanoparticle (AuAgNPs) quenching obtained in Example 1 of the present invention.

[0021] Figure 4 This is a detection diagram of the specificity and stability of Aβ42 by the Aβ42 fluorescence sensor based on peptide-nucleic acid dual recognition and gold-silver alloy nanoparticle (AuAgNPs) quenching obtained in the embodiments of the present invention. Detailed Implementation

[0022] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0023] Example 1:

[0024] This embodiment provides a method for preparing an Aβ42 fluorescence sensor based on peptide-nucleic acid dual recognition and quenching by gold-silver alloy nanoparticles (AuAgNPs), as detailed below: 1. Take a mixture of four single-stranded DNA strands containing the Aβ42 aptamer sequence. Accurately weigh four single-stranded DNA powders (DNT1, DNT2, DNT3, and DNT4), dissolve and dilute them to a final concentration of 10 μM using Tris-EDTA Buffer. Take 10 μL of each of DNT1, DNT2, DNT3, and DNT4, and add 10 μL of TM buffer (Tris-EDTA Buffer) at pH 7.5. Induce self-assembly through heat denaturation and annealing: heat the mixture in a 95-100°C water bath for 10 minutes to disrupt the secondary structure, then quickly transfer it to an ice-water bath and let it stand for at least 30 minutes to promote complementary base pairing between single strands, thereby constructing a stable three-dimensional rigid framework structure (TDNs). Store the obtained TDNs suspension at 4°C in the dark for later use. DNT1:ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTATTTTTGGGACCAGTACAAAAGTGGGTAGGGCGGG; DNT2:TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATA; DNT3:TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC; DNT4: TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT.

[0025] 2. Based on the conformational change and rigid spatial confinement mechanism induced by double-stranded DNA, 5 μM SYBR GreenI fluorescent dye (5 μL) and 2 μM DNA tetrahedra (20 μL) obtained in step 1 were co-incubated at room temperature for 20 min. Due to the electrostatic affinity and π-π stacking effect between the benzothiazole ring domain and the minor groove region of the DNA tetrahedron, the dye specifically intercalates into the base pair gap and anchors inside the backbone. The fluorescence is induced by the microenvironment of the double helix to produce a signal amplification effect, thus constructing a fluorescent signal unit.

[0026] 3. Spherical gold-silver alloy nanoparticles (AuAgNPs) with an average particle size of 10-50 nm were dispersed in MES buffer, and then Aβ42 multifunctional peptide (CKEKEKEKEKLVFF) was added. The mixture was incubated at 4°C in the dark for 12 h, allowing the multifunctional peptide to spontaneously assemble on the surface of AuAgNPs through physical adsorption and affinity, forming a composite interface layer with interface anchoring, antifouling and Aβ42 specific recognition functions, thus obtaining a composite quenching unit.

[0027] 4. Mix the 2 μM DNA tetrahedron (5 μL) modified with fluorescent dye obtained in step 2 with the 6.58 μM composite quenching unit (25 μL) obtained in step 3 to obtain the Aβ42 fluorescent sensor, ready for use.

[0028] Application Example 1: Different concentrations (0.01-100 pg / mL) of Aβ42 test samples prepared in aqueous solution were added to the working solution of the fluorescence sensor obtained in Example 1. After mixing, the mixture was reacted at 37°C for 20 min. When Aβ42 was present, it was recognized by the DNA tetrahedron and the multifunctional peptide, respectively, and the DNA tetrahedron and AuAgNPs-multifunctional peptide were linked together to form a sandwich structure of "tetrahedron-Aβ42-multifunctional peptide-AuAgNPs", which triggered fluorescence quenching. The fluorescence signal of the system was collected using a fluorescence spectrophotometer, and based on the established "fluorescence intensity-Aβ42 concentration" standard curve, with Aβ42 concentration as the abscissa and fluorescence intensity as the ordinate, the standard curve Y = -33.90 × X + 1197 was obtained. 2 =0.9879, the quantitative linear range of the fluorescence sensor is 0.01 pg / mL ~ 100 pg / mL, and the relative standard deviation (RSD) of the intra-batch repeatability test is less than 5%. 2 >0.98. (For example) Figure 2 As shown.

[0029] Application Example 2: Linear Relationship of Aβ42 in Serum System Diluted 10% healthy human serum (this study was approved by the Science and Technology Ethics Committee of Shanghai University (approval number: 2026-052), and all subjects signed informed consent forms. Peripheral venous blood samples were collected from 11 healthy controls, of which...) Different concentrations of Aβ42 were prepared and added to the working solution of the fluorescence sensor obtained in Example 1. After mixing, the mixture was reacted at 37°C for 20 min. When Aβ42 is present, it is recognized by the DNA tetrahedron and the multifunctional peptide, respectively, linking the DNA tetrahedron with the AuAgNPs-peptide to form a sandwich structure of "tetrahedron-Aβ42-multifunctional peptide-AuAgNPs," triggering fluorescence quenching. The fluorescence signal of the system was collected using a fluorescence spectrophotometer, and based on the established "fluorescence intensity-Aβ42 concentration" standard curve, Y = -36.60 × X + 1265, R... 2 =0.9853; the quantitative linear range of the fluorescence sensor is 0.01 pg / mL ~ 100 pg / mL, and the relative standard deviation (RSD) of the intra-batch repeatability test is less than 5%, R 2 >0.98. (For example) Figure 3 As shown.

[0030] Application Example 3: Stability and Specificity like Figure 4 As shown in Figure A, a mixture of interfering substances at a concentration 100 times higher than that in human serum, a standard solution of Aβ42, and a mixture of interfering substances at a concentration 100 times higher than that in human serum (where the concentration of Aβ42 is 1 pg / mL and the concentration of the interfering substances is 100 pg / mL) were prepared. Specifically, the groups were: each interfering substance + Aβ42, Aβ42 alone, and a mixture of all interfering substances and Aβ42 (Mix). Each mixture was incubated at room temperature for 20 minutes. Immediately afterwards, the fluorescence spectra were recorded at 25°C using a fluorescence spectrophotometer. The fluorescence emission spectrum monitoring range of the detection system was 505-600 nm, with an excitation wavelength of 480 nm. The fluorescence intensity at (485 nm / 520 nm) was used for quantitative analysis. The interfering substances included TNF (tumor necrosis factor), TGF (transforming growth factor), SCF (stem cell growth factor), IL-2 (interleukin-2), HGF (hepatocyte growth factor), and EGF (epidermal growth factor).

[0031] In the repeatability experiment, 10 sets of sensors were prepared according to Example 1 and tested. Each set was repeated 3 times. The experimental results are as follows: Figure 4 As shown in Figure B: The fluorescence sensor of the present invention exhibits excellent repeatability (or precision) during continuous parallel detection, with stable signal output and no significant fluctuations, fully verifying the high reliability and stability of the detection method and meeting the stringent requirements for methodological reproducibility in clinical or high-throughput detection.

[0032] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. An Aβ42 fluorescence sensor based on peptide-nucleic acid dual recognition and gold-silver alloy nanoparticle quenching, characterized in that, These include DNA tetrahedra specifically recognizing Aβ42 and surface-modified with fluorescent signaling molecules, as well as complex quenching units of AuAgNPs surface-modified with multifunctional peptides.

2. A method for preparing an Aβ42 fluorescence sensor based on peptide-nucleic acid dual recognition and gold-silver alloy nanoparticle quenching as described in claim 1, characterized in that, Includes the following steps: I. DNA tetrahedra with surface-modified fluorescent signal molecules that specifically recognize Aβ42 were prepared by the following method: Four single-stranded DNT1, DNT2, DNT3 and DNT4 containing the Aβ42 aptamer sequence were taken and dissolved in buffer to obtain a DNA mixture solution. The DNA mixture solution was heated to destroy the secondary structure, and then transferred to an ice water bath and left to stand for more than 30 minutes to promote complementary base pairing between single strands and obtain a stable three-dimensional rigid framework structure. The three-dimensional rigid framework structure was mixed with a fluorescent dye and co-incubated to obtain a DNA tetrahedron with a surface modified with fluorescent signal molecules that specifically recognizes Aβ42. II. The composite quenching unit is prepared by the following method: Spherical gold-silver alloy nanoparticles were dispersed in a buffer solution, and then Aβ42 multifunctional peptide solution was added. The mixture was incubated in the dark, allowing the multifunctional peptide to spontaneously assemble on the surface of the spherical gold-silver alloy nanoparticles through physical adsorption and affinity, thus obtaining the composite quenching unit.

3. The Aβ42 fluorescent sensor is obtained by mixing the DNA tetrahedron with the surface modified with fluorescent signal molecules that specifically recognize Aβ42 with the composite quenching unit.

3. The preparation method according to claim 2, characterized in that, In step one, the buffer solution is a TM buffer solution with a pH of 7.4-8.0; The sequence of DNT1 is shown in SEQ ID NO 1; The sequence of DNT2 is shown in SEQ ID NO 2; The sequence of DNT3 is shown in SEQ ID NO 3; The sequence of DNT4 is shown in SEQ ID NO 4; The final concentration of the four single-stranded DNAs in the DNA mixture is 2 μM.

4. The preparation method according to claim 2, characterized in that, In step one, the conditions for the heating reaction are: heating temperature of 95-100℃ and heating time of 10-15 min.

5. The preparation method according to claim 2, characterized in that, In step one, the co-incubation time is 0-30 min, and the temperature is 37℃; the volume ratio of the tetrahedral framework structure to the fluorescent dye is 4:1, the concentration of the tetrahedral framework structure is 2 μM, and the concentration of the fluorescent dye is 5 μM.

6. The preparation method according to claim 2, characterized in that, In step two, the average particle size of the spherical gold-silver alloy nanoparticles is 10~50 nm; The concentration of the spherical gold-silver alloy nanoparticles is 6.58-6580 mg / mL; The concentration of the Aβ42 multifunctional peptide solution is 0.5-4 μM; The volume ratio of the spherical gold-silver alloy nanoparticles to the Aβ42 multifunctional peptide is 4:

1. The sequence of the Aβ42 multifunctional peptide is shown in SEQ ID NO 5.

7. The preparation method according to claim 2, characterized in that, In step two, the conditions for incubation in the dark are: temperature 4℃, time 12~16 hours.

8. The application of the Aβ42 fluorescence sensor based on peptide-nucleic acid dual recognition and gold-silver alloy nanoparticle quenching as described in claim 1 in the qualitative or quantitative detection of Aβ42.

9. The application according to claim 8, characterized in that, The concentration of Aβ42 in the quantitative detection was 0.01 pg / mL-100 pg / mL.

10. The application according to claim 8, characterized in that, The interaction time between the Aβ42 fluorescence sensor and the sample to be tested is 10-25 minutes, and the temperature is 37℃.

Images