Methods for treating primary hyperoxaluria by gene editing of hydroxyacid oxidase 1

Abstract

A composition for gene editing of a hydroxyacid oxidase 1 (HAO1) gene, the composition comprising: (a) a messenger RNA (mRNA) encoding a Cas12i2 polypeptide, (b) a guide RNA (gRNA) targeting the HAO1 gene; and (c) a lipid adjuvant, the lipid adjuvant optionally forming a lipid nanoparticle. Also provided herein are methods for genetically modifying a HAO1 gene in a host cell using the compositions provided herein.

Description

Cross-reference to related applications

[0001] This application claims priority to U.S. Provisional Application No. 63 / 617,867, filed January 5, 2024, the entire contents of which are incorporated herein by reference.

[0002] sequence list This application includes a sequence list, which has been electronically submitted in XML format and is incorporated herein by reference in its entirety. The XML copy was created on January 2, 2025, and is named 063586-536001WO_Seq-Listing_ST26.xml, with a size of 56,491 bytes. Background Technology

[0003] Primary hyperoxaluria (PH) is a disease characterized by recurrent kidney and bladder stones caused by excessive oxalate production. Oxalate combines with calcium to form calcium oxalate, which is the main component of kidney and bladder stones. It is estimated that 1 in 58,000 people worldwide has PH. PH is classified into three types: PH1, PH2, and PH3, with PH1 accounting for approximately 80% of all cases.

[0004] Primary hyperoxaluria is associated with mutations in genes such as AGXT, GRHPR, and HOGA1, leading to abnormal breakdown of glyoxylate. Glycolate oxidase (GO), encoded by the hydroxyacid oxidase 1 (HAO1) ​​gene, converts glyoxylate to oxalate. Knocking out the HAO1 gene reduces GO enzyme levels, thereby lowering oxalate levels and aiding in PH treatment. Summary of the Invention

[0005] This disclosure is based, in at least part, on the development of compositions and methods for gene editing of the hydroxy acid oxidase 1 (HAO1) ​​gene in subjects to facilitate the treatment of primary hyperoxaluria (PH). Therefore, this document particularly provides compositions for gene editing of the HAO1 gene, and methods for using the HAO1 gene editing compositions disclosed herein for gene modification in cells (e.g., cells in a subject) and / or for treating diseases associated with the HAO1 gene (e.g., primary hyperoxaluria (PH)).

[0006] Therefore, this disclosure provides, in one aspect, a composition for gene editing of the hydroxy acid oxidase 1 (HAO1) ​​gene, the composition comprising: (a) a messenger RNA (mRNA) comprising a nucleotide sequence having at least 80% identity with SEQ ID NO: 8, wherein the mRNA encodes the Cas12i2 polypeptide as shown in SEQ ID NO: 7; (b) a guide RNA (gRNA) comprising the nucleotide sequence of SEQ ID NO: 13; and (c) A lipid excipient comprising 45 to 50 mol% cationic lipids, 9 to 11 mol% zwitterionic phospholipids, 38 to 42 mol% cholesterol, and 2.2 to 2.8 mol% polyethylene glycol-modified lipids.

[0007] In some embodiments, the cationic lipid has the following structure: Alternatively, the cationic lipid may be a pharmaceutically acceptable salt or stereoisomer thereof.

[0008] In some embodiments, the polyethylene glycol-modified lipid has the following structure: The average value n is between 45 and 49, including the extreme values.

[0009] In some embodiments, the zwitterionic phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0010] In some embodiments, the mRNA comprises a nucleotide sequence having at least 85% identity with SEQ ID NO: 8. In some embodiments, the mRNA comprises a nucleotide sequence having at least 90% identity with SEQ ID NO: 8. In some cases, the mRNA comprises a poly-A tail at the 3' end of the mRNA, for example, a poly-A tail containing 60 to 135 adenosine (A) residues (e.g., ≥85 A residues). In a specific example, the mRNA comprises the nucleotide sequence of SEQ ID NO: 23. Additionally or further, the mRNA comprises a 5' cap portion and / or one or more modifying nucleotides, such as pseudouridine (e.g., substituted uridine residues). In some examples, the mRNA contains pseudouridine residues at 75% or more of the uridine positions of the mRNA. In one specific example, the mRNA contains pseudouridine residues at all uridine positions of the mRNA. In one specific example, the mRNA contains pseudouridine residues at all uridine positions of the mRNA and comprises a 5' cap portion.

[0011] In some embodiments, the lipid excipient comprises 47.5 mol% of the cationic lipid, 10 mol% of the zwitterionic phospholipid, 40 mol% of the cholesterol, and 2.5 mol% of the polyethylene glycol-modified lipid.

[0012] In any HAO1 gene-editing composition disclosed herein, the ratio between messenger RNA and gRNA may be 1 ± 20% (e.g., 1 ± 10% or 1 ± 5%). In some examples, this ratio may be 1:1 (1). Nucleic acid components (mRNA and gRNA) may be bound to lipid excipients. In some cases, the lipid excipients may form lipid nanoparticles (LNPs), and the nucleic acid components may be attached to or encapsulated within the LNPs.

[0013] In some embodiments, the gRNA in any composition disclosed herein comprises one or more modifications. Examples include phosphate thioester bonds, 2'-O-methylation, or a combination of both. In some cases, the modification is located at the 5' and / or 3' nucleotides. In one specific example, the gRNA is a modified nucleic acid comprising the nucleotide sequence of SEQ ID NO: 14.

[0014] In some embodiments, the nitrogen:phosphorus (N / P) ratio in the compositions provided herein is in the range of 3 to 9. In some examples, the N / P ratio in the composition is 6.0 ± 1.0. In one example, the N / P ratio in the composition is 6.0 ± 0.5 (e.g., about 6.0).

[0015] In another aspect, this disclosure also relates to a method for gene editing the hydroxy acid oxidase 1 (HAO1) ​​gene in a subject, the method comprising: administering an effective amount of any of the HAO1 gene editing compositions disclosed herein to a subject in need. In some embodiments, the subject is a human subject with primary hyperoxaluria (PH). In some examples, the human subject has PH1.

[0016] In some cases, the method may also include assessing the level of HAO1 gene editing in the subject. Alternatively, the method may include analyzing the level of HAO1 gene product (i.e., HAO1 protein, also known as GO protein or GO enzyme), the level of molecules involved in GO enzyme-mediated catalytic pathways (e.g., glycolic acid), or a combination of both.

[0017] The scope of this invention also includes the HAO1 gene editing compositions disclosed herein for use in gene editing of the HAO1 gene in host cells and / or in a subject (who may be a human patient with PH), and for treating PH in a subject requiring treatment. Furthermore, this application provides the use of any of the HAO1 gene editing compositions in the preparation of a medicament for treating PH (e.g., PH1) in a subject (e.g., a human patient with PH).

[0018] Details of one or more embodiments of the present invention will be set forth in the description below. Other features or advantages of the invention will become apparent from the following detailed description of the accompanying drawings and several embodiments, and also from the appended claims. Attached Figure Description

[0019] The following figures form part of this specification and are included to further illustrate certain aspects of this disclosure, which can be better understood by referring to the accompanying drawings in conjunction with the detailed description of the specific embodiments presented herein.

[0020] Figure 1 This figure illustrates the effects of different treatments and dosages on HAO1 gene editing in the liver of non-human primates (NHP). Target insertion-deletion (Indel) editing was set at 55%. N / P: Target nitrogen: phosphorus (N / P) ratio. Guide / RNA: Target gRNA to mRNA ratio.

[0021] Figures 2A to 2C Includes a graph illustrating the therapeutic effects of an exemplary HAO1 gene-editing composition as shown. Figure 2A HAO1 gene editing efficiency. Figure 2B GO enzyme activity. Figure 2C Glycolic acid level.

[0022] Figure 3 This is a graph showing the correlation between HAO1 knockout, glycolic acid, and GO protein in mice treated with mouse homologs of the HAO1 gene editing composition provided herein.

[0023] Figures 4A to 4D This includes a figure illustrating HAO1 gene editing in a mouse model of PH1 using a mouse homolog of the HAO1 gene editing composition provided herein. Figure 4A HAO1 insertions and deletions increase with increasing dose. Figure 4B : Hao1 The effect of editing on GO enzyme activity. Figure 4C : Hao1 The effect of editing on glycolic acid levels. Figure 4D :Depend on Hao1 Gene editing leads to a reduction in urinary oxalate.

[0024] Figures 5A to 5B Includes Agxt - / - A graph showing the long-term persistence of HAO1 gene editing and urinary oxalate levels in mice. Figure 5A The graph shows the endpoint whole liver tissue insertion-deletion at 3 and 6 months after administration of the 1.5 mg / kg dose of the composition. Figure 5B The results after 3 and 6 months of administration of the composition at a dose of 1.5 mg / kg are shown. Agxt - / - A graph of urinary oxalate in mice as a percentage of baseline.

[0025] Figures 6A to 6B This includes examples of juveniles treated with HAO1 gene-editing compositions. Agxt - / - A graph showing Hao1 gene editing and urinary oxalate levels in mice. Figure 6A The results show the effects on juvenile mice of different ages after drug administration at a dose of 2 mg / kg. Agxt - / - liver in mice Hao1 The image was edited. Figure 6B The results showed that after 3 months of drug administration to juvenile rats at a dose of 2 mg / kg were... Agxt - / - A graph showing urinary oxalate levels in mice over 3 months.

[0026] Figure 7 This is a graph showing the normalized GO protein expression in the liver after 30% to 70% hepatectomy. Detailed Implementation

[0027] This disclosure is based, at least in part, on compositions and methods for developing gene editing of the hydroxy acid oxidase 1 (HAO1) ​​gene in subjects to facilitate the treatment of primary hyperoxaluria (PH). As reported herein, the HAO1 gene editing compositions disclosed herein have demonstrated successful gene editing of the HAO1 gene in non-human primates (NHP), as evidenced by the percentage of insertions and deletions at the HAO1 locus. Knocking out the HAO1 gene in animals resulted in reduced GO enzyme activity and increased glycolic acid levels in the treated animals, indicating a reduced level of conversion from glycolic acid to glyoxylate, thereby reducing oxalate. Therefore, the HAO1 gene editing compositions provided herein are expected to benefit the treatment of diseases such as primary hyperoxaluria (PH) through gene editing of the HAO1 gene by reducing molecules that contribute to the formation of kidney and bladder stones, a major symptom associated with PH.

[0028] Furthermore, liver function was observed in a PH1 mouse model after treatment with the HAO1 gene-editing composition provided in this paper. Hao1 The persistence of editing and reduction of urinary oxalate were assessed. Finally, rhampseq of two primary hepatocyte donors treated with the editing composition was used to evaluate 1549 candidate off-target sites screened by computer simulation search (CALITAS) and Digenome-Seq. Although a large number of off-target site candidates were identified in the computer simulation search, only three sites in intron regions not labeled in the Catalogue of Somatic Mutations in Cancer (COSMIC 2024) were shown to have editing activity slightly above the detection limit (0.012%) in one or two donors. No true off-targets were identified in exon regions. No structural variations were detected using long-range sequencing and optical genome mapping, indicating that the editing activity was not significantly affected by the editing composition. HAO1 The chromosome structure was maintained after treatment with the edited composition.

[0029] Therefore, this disclosure provides, among other things, compositions for gene editing of the HAO1 gene, and methods for using such compositions for gene modification of the HAO1 gene in cells (e.g., in a subject) and / or for treating diseases related to the HAO1 gene (e.g., primary hyperoxaluria (PH)).

[0030] I. Composition for gene editing of the HAO1 gene Hydroxy acid oxidase 1 ("HAO1"), also known as glycolate oxidase 1, is a peroxisome protein primarily expressed in the liver and pancreas, and its activities include the oxidation of glycolate and 2-hydroxy fatty acids. The HAO1 gene product is glycolate oxidase (GO), also known as GO protein or HAO1 protein. Structural information of the human HAO1 gene can be found at NCBI reference sequence NG_046733.1.

[0031] This disclosure provides a gene editing composition targeting the HAO1 gene (e.g., the human HAO1 gene). The HAO1 gene editing composition provided herein may comprise: (a) a Cas12i2 polypeptide or a nucleic acid encoding a Cas12i2 polypeptide, (b) a guide RNA targeting a genomic site in the HAO1 gene, and (c) a lipid excipient comprising one or more lipids, the lipid excipient being capable of forming a lipid nanoparticle (LNP) structure. The Cas12i2 polypeptide or encoding a nucleic acid and / or gRNA can be associated with the lipid excipient. When the lipid excipient forms LNPs, the Cas12i2 polypeptide or encoding a nucleic acid and / or gRNA can attach to and / or encapsulate within the LNPs.

[0032] In some embodiments, the HAO1 gene editing composition may comprise a messenger RNA (mRNA) molecule encoding a Cas12i2 polypeptide, the mRNA comprising an amino acid sequence having at least 95% identity with the parental Cas12i2 CRISPR nuclease shown in SEQ ID NO: 1, and comprising at least amino acid substitutions (e.g., D581R, I926R, and V1030G) at positions D581, I926, and V1030 relative to SEQ ID NO: 1. Additionally, the gRNA in the HAO1 gene editing composition may comprise a spacer sequence that is specific to the target sequence 5'-CAAAGTCTATATATGACTAT-3' (SEQ ID NO: 10) in the HAO1 gene. The ratio of mRNA to gRNA in the composition may be 1 ± 20%, for example 1 ± 10%, 1 ± 5%, or 1 ± 2%. In some examples, the ratio is approximately 1:1 (e.g., 1). In addition, both mRNA and gRNA can be associated with (e.g., attached to or encapsulated in) lipid excipients, which can form LNPs.

[0033] A. Cas12i2 polypeptide and encoding nucleic acid The HAO1 gene editing compositions provided herein involve the Cas12i2 polypeptide or nucleic acid encoding the Cas12i2 polypeptide. In a specific example, the HAO1 gene editing composition comprises a messenger RNA (mRNA) molecule encoding the Cas12i2 polypeptide.

[0034] (a) Cas12i2 peptide The Cas12i2 polypeptide disclosed herein includes a Cas12i2 nuclease domain and optionally includes one or more additional functional motifs, such as nuclear localization signals, peptide linkers, or combinations thereof. The Cas12i2 nuclease is a class 2 type V CRISPR-Cas endonuclease capable of cleaving targeted double-stranded DNA under the guidance of a guide RNA. Cas12i2 nucleases can be found, for example, in WO2021 / 202800 and WO2022 / 256642, the relevant disclosures of which are incorporated herein by reference for the purposes of this document.

[0035] In some embodiments, the Cas12i2 polypeptide involved in the HAO1 gene editing compositions disclosed herein may comprise a Cas12i2 nuclease, which is a variant of the parental Cas12i2 enzyme shown in SEQ ID NO: 1. See the sequence listing below. Such variant Cas12i2 nucleases may comprise an amino acid sequence having at least 90% (e.g., at least 95%, at least 97%, at least 98%, at least 99%, or higher) homology with SEQ ID NO: 1. Homology or identity can be determined by amino acid sequence alignment, for example using procedures such as BLAST, ALIGN, or CLUSTAL as described herein.

[0036] The "percentage identity" of the two nucleic acids or two amino acid sequences was determined using the algorithm proposed by Karlin and Altschul in Proceedings of the National Academy of Sciences 87:2264-68 (1990), which was modified according to Karlin and Altschul in Proceedings of the National Academy of Sciences 90:5873-77 (1993). This algorithm was incorporated into the NBLAST and XBLAST procedures (version 2.0) in the Journal of Molecular Biology 215:403-10 (1990). The NBLAST program can be used to perform a BLAST nucleotide search (score = 100, word length = 12) to obtain nucleotide sequences homologous to the nucleic acid molecules of this application. The XBLAST program can be used to perform a BLAST protein search (score = 50, word length = 3) to obtain amino acid sequences homologous to the protein molecules of this application. When there is a gap between the two sequences, Gapped BLAST can be used as described by Altschul et al. in Nucleic Acids Res. 25(17): 3389-3402, 1997. When using the BLAST program and the Gapped BLAST program, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.

[0037] The variant Cas12i2 nuclease may contain one or more amino acid substitutions relative to SEQ ID NO: 1, for example at positions D581, I926, V1030, and optionally also at positions G624, F626, P868, E1035, and S1046 in SEQ ID NO: 1. In some cases, the original amino acid residues of SEQ ID NO: 1 at the aforementioned positions (e.g., positions D581, G624, F626, I926, and / or E1035) may be replaced by R or a conservative substitution thereof (e.g., K). Additionally or further, the original amino acid residues of SEQ ID NO: 1 at specified positions (e.g., V1030 and / or S1046) may be replaced by G or a conservative substitution thereof (e.g., A). Furthermore, the original amino acid residue at position P868 may be replaced by T or a conservative substitution thereof (e.g., S).

[0038] As used herein, a “conserved amino acid substitution” refers to an amino acid substitution that does not alter the relative charge or size characteristics of the protein that produces the substitution. Variants can be prepared according to methods known to those skilled in the art for altering polypeptide sequences, such as those found in references compiling such methods, for example, *Molecular Cloning: A Laboratory Manual* (J. Sambrook et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989) or *Current Protocols in Molecular Biology* (FM Ausubel et al., eds., John Wiley & Sons, Inc., New York). York). Conservative substitutions of amino acids include substitutions between amino acids in the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D.

[0039] In one example, the variant Cas12i2 nuclease comprises D581R, I926R, and V1030G relative to SEQ ID NO: 1. Such Cas12i2 nucleases may also comprise the amino acid sequence of SEQ ID NO: 2. See the sequence listing below.

[0040] In another example, the variant Cas12i2 nuclease comprises D581R, G624R, F626R, P868T, I926R, V1030G, E1035R, and S1046G relative to SEQ ID NO: 1. Such Cas12i2 nucleases may also comprise the amino acid sequence of SEQ ID NO: 3.

[0041] In addition to the nuclease domain, any Cas12i2 polypeptide may contain one or more functional motifs. For example, a Cas12i polypeptide contains at least one (e.g., two, three, four, five, six, or more identical or different) nuclear localization signal (NLS). In some embodiments, a Cas12i polypeptide contains at least one (e.g., two, three, four, five, six, or more identical or different) nuclear export signal (NES). In some embodiments, a Cas12i polypeptide includes at least one (e.g., two, three, four, five, six, or more) NLS and at least one (e.g., two, three, four, five, six, or more) NES. In some examples, a Cas12i2 polypeptide may contain one NLS at the C-terminus. In other examples, a Cas12i2 polypeptide may contain one NLS at the N-terminus and one NLS at the C-terminus. In some cases, the N-terminal and C-terminal NLS motifs may be the same. Suitable NLS motifs known in the art can be used in the Cas12i2 polypeptides disclosed herein. Examples are provided in the sequence listing below.

[0042] In some embodiments, the Cas12i2 peptide may include one or more flexible peptide linkers between the nuclease domain and one or more additional functional motifs (e.g., NLS motifs). Any suitable flexible peptide linker can be used (e.g., those G / S-rich peptide linkers known in the art). An example is provided in the sequence listing below.

[0043] In one specific example, the Cas12i2 polypeptide may include a Cas12i2 nuclease domain and an NLS from the N-terminus to the C-terminus. In another specific example, the Cas12i2 polypeptide may include a first NLS, a first flexible peptide linker, a Cas12i2 nuclease domain, a second flexible peptide linker, and a second NLS from the N-terminus to the C-terminus. Such Cas12i2 polypeptides may contain the amino acid sequence of SEQ ID NO: 7. In another example, the Cas12i2 polypeptide may contain the amino acid sequence of SEQ ID NO: 17. See the sequence listing below. The NLS motif is shown in italics and bold, and the peptide linker is underlined.

[0044] (b) mRNA encoding Cas12i2 In some embodiments, the HAO1 gene editing compositions disclosed herein may comprise nucleic acids, such as mRNA molecules, encoding the Cas12i2 polypeptide disclosed herein.

[0045] In some examples, the nucleotide sequence encoding the Cas12i polypeptide described herein can be codon-optimized for use in specific host cells or organisms (e.g., human hepatocytes). Codon usage tables are readily available, for example, from the Codon Usage Database at www.kazusa.orjp / codon / , and these tables can be adapted in various ways. See Nakamura et al., Nucl. AcidsRes 28:292 (2000), which is incorporated herein by reference for the purposes of this citation. Computer algorithms for codon optimization of specific sequences for expression in specific host cells are also available, such as Gene Forge (Aptagen; Jacobus, PA). In some examples, the nucleic acid encoding a Cas12i polypeptide (e.g., the Cas12i2 polypeptide) as disclosed herein may be an mRNA molecule capable of codon optimization. Exemplary encoding sequences SEQ ID NO:4 (encoding the Cas12i2 polypeptide of SEQ ID NO:7) and SEQ ID NO:18 (encoding the Cas12i2 polypeptide of SEQ ID NO:17) are provided in the sequence listing below.

[0046] In addition to the coding sequence for the Cas12i2 polypeptide, the nucleic acid (e.g., mRNA molecule) may also contain untranslated regions (UTRs) at the 5' and / or 3' ends. For example, the mRNA molecule may contain a 5' cap modification. mRNA typically contains a 5' cap for efficient translation, stabilization, and transport in eukaryotic cells. In some examples, the mRNA molecules disclosed herein may contain a native 5' m7G cap. Alternatively, the mRNA molecule may contain a synthetic 5' cap that is not naturally occurring, such as those known in the art for use in mRNA, such as those provided by BioTechnologies of TriLink, see also Ishikawa et al., Nucleic Acid Symposium Series No. 53, pp. 129-130, the relevant disclosure of which is incorporated herein by reference for the subject matter and purposes of this citation. Examples include, but are not limited to: CAP(G(5')ppp(5')G), mCAP(m7G(5')ppp(5')G), ARCA(3´-O-Me-m7G(5')ppp(5')G), m7(3'OMeG)(5')ppp('5)m6(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, and m7G(5')ppp(5')(2'OMeA)pG.

[0047] Additionally or further, the mRNA molecules disclosed herein may contain one or more modifications, such as modifications to nucleotides and / or modifications to backbone linkages. In one example, the mRNA molecule may contain pseudouridine residues. In some cases, the content of pseudouridine residues in the mRNA at uridine sites in the mRNA may be at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, or higher). In some examples, the mRNA may contain pseudouridine residues at all uridine sites in the mRNA.

[0048] In one specific example, the mRNA in the HAO1 gene editing composition disclosed herein may contain a nucleotide sequence having at least 70% identity with SEQ ID NO: 8 and encode a Cas12i2 polypeptide (e.g., containing the amino acid sequence of SEQ ID NO: 7). For example, the mRNA may contain a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or higher identity with SEQ ID NO: 8 and encode the Cas12i2 polypeptide of SEQ ID NO: 7. In one specific example, the mRNA contains the nucleotide sequence of SEQ ID NO: 8 (e.g., composed of the nucleotide sequence of SEQ ID NO: 8).

[0049] In another specific example, the mRNA in the HAO1 gene editing composition disclosed herein may contain a nucleotide sequence having at least 70% identity with SEQ ID NO: 18 and encoding a Cas12i2 polypeptide (e.g., containing the amino acid sequence of SEQ ID NO: 17). For example, the mRNA may contain a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or higher identity with SEQ ID NO: 18 and encoding the Cas12i2 polypeptide of SEQ ID NO: 17. In one specific example, the mRNA contains the nucleotide sequence of SEQ ID NO: 18 (e.g., composed of the nucleotide sequence of SEQ ID NO: 18).

[0050] Any such mRNA molecule may contain a 5' cap, such as an m7G(5')ppp(5')(2'OMeA)pG cap, and at least 75% (e.g., at least 80%, at least 85%, at least 90%, at least 95%) of pseudouridine residues at the uridine sites of the mRNA. In one example, the mRNA contains pseudouridine residues at all uridine sites.

[0051] Additional modifications to RNA molecules known in the art (such as those provided herein) may be introduced into the mRNA molecules encoding Cas12i2 disclosed herein.

[0052] Additionally, the mRNA encoding the Cas12i2 polypeptide may contain a 3' poly-A tail. In some cases, the poly-A tail in the mRNA may contain approximately 50 to 150 adenosine (A) residues. In some examples, the length of the poly-A tail may be approximately 60 to 140 A residues. In other examples, the length of the poly-A tail may be approximately 70 to 140 A residues or approximately 80 to 140 A residues. In some examples, the length of the poly-A tail may be approximately 85 to 135 A residues. In some examples, the length of the poly-A tail may be equal to or greater than 85 A residues. In one specific example, the mRNA encoding the Cas12i2 polypeptide may contain the nucleotide sequence of SEQ ID NO: 23.

[0053] B. RNA Guide The HAO1 gene editing compositions disclosed herein also relate to a guide RNA (gRNA) or nucleic acid encoding such gRNA that targets the HAO1 gene. As used herein, the term "RNA guide" or "RNA guide sequence" refers to any RNA molecule (e.g., a modified RNA molecule) that facilitates the targeting of a target sequence (e.g., a sequence of the HAO1 gene) by a CRISPR nuclease (e.g., any of the Cas12i2 peptides described herein). For example, an RNA guide can be a molecule that targets a nucleic acid sequence (target sequence) in a target gene (e.g., the HAO1 gene in this disclosure). More specifically, the RNA guide contains a domain (spacer sequence) specific to the target sequence in the target gene (i.e., an RNA homolog that is the target sequence). In addition to the spacer sequence, the RNA guide may also contain a direct repeat (DR) sequence that can be recognized by a CRISPR nuclease. In some cases, the RNA guide may be a modified RNA molecule containing one or more deoxyribonucleotides, for example, in the spacer sequence, the modified RNA molecule binds to a complementary sequence of the target sequence. In some examples, the spacer sequence may contain a DNA sequence or a DNA / RNA hybrid sequence.

[0054] As used herein, the term "complementary" refers to a level of complementarity between a first polynucleotide (e.g., a spacer sequence of an RNA guide) and a second polynucleotide (e.g., a complementary sequence of a target sequence), such that the first and second polynucleotides can form a double-stranded complex through base pairing, allowing an effector polypeptide complexed with the first polynucleotide to act on (e.g., cleave) the second polynucleotide. In some embodiments, the first polynucleotide may be substantially complementary to the second polynucleotide, i.e., having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity. In some embodiments, the first polynucleotide is completely complementary to the second polynucleotide, i.e., having 100% complementarity.

[0055] In some embodiments, the RNA guide may include a spacer sequence followed by direct repeat sequences, which are sequences along the 5' to 3' direction. In some embodiments, the RNA guide may include a first direct repeat sequence followed by a spacer sequence and a second direct repeat sequence, which are sequences along the 5' to 3' direction. In some embodiments, the first and second direct repeat sequences of such an RNA guide may be the same. In some embodiments, the first and second direct repeats of such an RNA guide may be different.

[0056] In some embodiments, the RNA guide spacer sequence and (one or more) direct repeat sequences exist within the same RNA molecule. In some embodiments, the spacer sequence and direct repeat sequences are directly linked to each other. In some embodiments, there is a short linker between the spacer sequence and the direct repeat sequences, such as an RNA linker of 1, 2, or 3 nucleotides in length. In some embodiments, the RNA guide spacer sequence and (one or more) direct repeat sequences exist in separate molecules, which are linked to each other by base pairing interactions.

[0057] (a) Interval sequence In some embodiments, the RNA guide in the HAO1 gene editing compositions provided herein includes a spacer sequence specific to a target sequence in exon 1 of the human HAO1 gene, the nucleotide sequence of which is provided in the sequence listing below. The target sequence is adjacent to a 5'-NTTN-3' or 5'-TTN-3' “near-original spacer motif” or “PAM” sequence, where N represents any nucleotide sequence. In some cases, the target sequence is downstream of the PAM sequence, for example, at the 3' end of the PAM sequence.

[0058] The PAM sequence is a DNA sequence adjacent to the target sequence, containing a complex of an RNA guide (e.g., an RNA guide targeting HAO1) ​​and the Cas12i2 peptide described herein, which binds to the PAM sequence. In a double-stranded DNA molecule, the strand containing the PAM motif is referred to as the "PAM strand," and the complementary strand is referred to as the "non-PAM strand." The spacer sequence in the RNA guide can bind to a site on the non-PAM strand that is complementary to the target sequence disclosed herein.

[0059] In some embodiments, the PAM strand is a coding (e.g., sense) strand. In other embodiments, the PAM strand is a non-coding (e.g., antisense) strand. Because the RNA guide binds to the non-PAM strand via base pairing, the non-PAM strand is also referred to as the target strand, and the PAM strand is also referred to as the non-target strand.

[0060] The spacer sequence of the RNA guide can be between 15 and 30 nucleotides in length (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides) and is complementary to a non-PAM strand sequence. In some embodiments, the spacer sequence is designed to be complementary to a specific DNA strand (e.g., a specific DNA strand at a genomic site), and the spacer sequence can be located within exon 1 of the human HAO1 gene. In a specific example, the target sequence is as shown in 5'-CAAAGTCTATATATGACTAT-3' (SEQ ID NO: 10) of the HAO1 gene.

[0061] In some embodiments, the spacer sequence in the RNA guide is substantially identical to the complementary strand of the target sequence (e.g., SEQ ID NO: 10). In some embodiments, the spacer sequence may have at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity with the complementary strand of the target sequence (e.g., SEQ ID NO: 10). The percentage identity between two such nucleic acids can be determined manually by examining two best-aligned nucleic acid sequences, or by using software programs or algorithms (e.g., BLAST, ALIGN, CLUSTAL) with standard parameters.

[0062] In some examples, the spacer sequence in the RNA guide disclosed herein may contain the nucleotide sequence 5'-CAAAGUCUAUAUAUGACUAU-3' (SEQ ID NO: 11). Alternatively, the spacer sequence may contain a nucleotide sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or higher identity with SEQ ID NO: 11.

[0063] In some embodiments, the spacer sequence described herein comprises uridine (U). In some embodiments, the spacer sequence described herein comprises thymine (T). Unless otherwise expressly stated, any nucleotide sequence provided herein refers to a nucleic acid having a defined nucleotide sequence, regardless of whether that nucleic acid contains any modifications.

[0064] (b) Direct repeating sequence Any of the RNA guides disclosed herein may also include direct repeat sequences. In some embodiments, the length of the direct repeat sequence in the RNA guide is 15 to 30 nucleotides. In some examples, the length of the direct repeat sequence may be 20 to 30 nucleotides, such as 23 to 26 nucleotides.

[0065] In some embodiments, the direct repeat sequence may comprise a nucleotide sequence of 5'-AGAAAUCCGUCUUUCAUUGACGG-3' (SEQ ID NO: 12). Alternatively, the spacer sequence may comprise a nucleotide sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or higher identity with SEQ ID NO: 12.

[0066] (c) Modification The RNA guides (and, where applicable, mRNAs) provided herein may contain one or more covalent modifications relative to a reference sequence (in particular, parental polynucleotides), and such one or more covalent modifications are included within the scope of this disclosure.

[0067] Exemplary modifications can include any modification to sugars, nucleosides, nucleoside linkages (e.g., linkage to phosphate groups / linkage to phosphodiester groups / linkage to phosphodiester backbones), and any combination thereof. Some exemplary modifications provided herein are described in detail below.

[0068] RNA guides can contain any useful modifications, such as modifications to sugars, nucleotides, or nucleoside linkages (e.g., modifications to linking phosphates / phosphodiester linkages / phosphodiester backbones). One or more atoms of the pyrimidine nucleotides may be replaced or substituted with optionally substituted amino groups, optionally substituted thiols, optionally substituted alkyl groups (e.g., methyl or ethyl), or halogens (e.g., chlorine or fluorine). In some embodiments, modifications (e.g., one or more modifications) are present in each of the sugar and nucleoside linkages. Modifications can modify ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), threonucleic acids (TNAs), glycerol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs), or hybrids thereof. Additional modifications are described herein.

[0069] In some embodiments, the modification may include chemical modifications or cell-induced modifications. For example, some non-limiting examples of intracellular RNA modifications are described by Lewis and Pan in Nat Reviews Mol Cell Biol, 2017, 18: 202-210, RNA modifications and structures cooperate to RNA guide-protein interactions.

[0070] Different sugar modifications, nucleotide modifications, and / or nucleotide linkages (e.g., backbone structures) can be present at different positions in the sequence. Those skilled in the art will understand that nucleotide analogs or one or more other modifications can be located at any position in the sequence without significantly reducing the function of the sequence. The sequence may contain about 1% to about 100% of modified nucleotides (whether relative to the total nucleotide content or relative to one or more nucleotide types, i.e., any one or more of A, G, U, or C) or any percentage in between (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 1...). 0.00%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%.

[0071] In some embodiments, sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions at one or more ribonucleotides in the sequence, as well as backbone modifications, include phosphodiester-linked modifications or substitutions. Specific examples of sequences include, but are not limited to, sequences containing a modified backbone or lacking natural internucleotide links, such as internucleotide modifications that thus include phosphodiester-linked modifications or substitutions. Sequences having a modified backbone include, among others, those sequences that do not contain a phosphorus atom in their backbone. For the purposes of this application, and as sometimes referred to in the art, modified RNAs whose internucleotide backbone does not contain a phosphorus atom can also be considered oligonucleotides. In certain embodiments, the sequence will contain ribonucleotides whose internucleotide backbone contains a phosphorus atom.

[0072] The modified sequence backbone may include, for example, thiophosphates, chiral thiophosphates, dithiophosphates, triphosphates, aminoalkyl phosphates, methylphosphonates and other alkylphosphonates (e.g., 3'-alkylene phosphonates and chiral phosphonates), hypophosphonates, phosphoramidites (e.g., 3'-aminophosphatides and aminoalkylphosphatides), thiophosphatides, thioalkylphosphonates, thioalkyl phosphates, and borophosphates having conventional 3'-5' linkages, 2'-5' linkage analogs of the above groups, and groups having reverse polarity, i.e., analogs where adjacent nucleoside units are linked in a 3'-5' to 5'-3' manner or in a 2'-5' to 5'-2' manner. Various salts, mixed salts, and free acid forms are also included. In some embodiments, the sequence may be negatively or positively charged.

[0073] Modifying nucleotides that can bind to a sequence can be modified at nucleoside links (e.g., phosphate backbones). In the context of polynucleotide backbones, the terms "phosphate" and "phosphate diester" are used interchangeably. A backbone phosphate group can be modified by replacing one or more oxygen atoms with different substituents. Furthermore, modified nucleosides and nucleotides can include complete replacement of the unmodified phosphate moiety with another nucleoside linker, as described herein. Examples of modified phosphate groups include, but are not limited to, thiophosphates, selenophosphates, boroalkyl phosphates, borate phosphates, hydrophosphonates, phosphoramide esters, phosphoridamide esters, alkyl or aryl phosphonates, and phosphate triesters. In dithiophosphates, both unlinked oxygen atoms are replaced with sulfur. Phosphate linkers can also be modified by replacing the linking oxygen with nitrogen (bridging phosphoramide esters), sulfur (bridging thiophosphates), and carbon (bridging methylene-phosphonates).

[0074] The α-thiosubstituted phosphate moiety is provided to confer stability to RNA and DNA polymers via a non-natural thiophosphate backbone. Thiophosphate DNA and RNA exhibit increased nuclease resistance and thus a longer half-life in the cellular environment.

[0075] In certain embodiments, the modified nucleosides include α-thio-nucleosides (e.g., 5'- O -(1-thiophosphate)-adenosine, 5'- O -(1-thiophosphate)-cytidine (α-thio-cytidine), 5'- O -(1-thiophosphate)-guanosine, 5'- O -(1-thiophosphate)-uridine, or 5'- O -(1-thiophosphate)-pseudouridine.

[0076] Other nucleoside linkages that may be used under this disclosure (including nucleoside linkages that do not contain phosphorus atoms) are described herein.

[0077] In some embodiments, the sequence may contain one or more cytotoxic nucleosides. For example, cytotoxic nucleosides may be incorporated into the sequence, for example, through bifunctional modifications. Cytotoxic nucleosides may include, but are not limited to, vidarabine, 5-azacytidine, 4'-thiocytarabine, cyclopentenylcytidine, cladribine, clofarabine, cytarabine, vidarabineuridine, 1-(2-C-cyano-2-deoxy-β-D-arabinofuranyl)-cytosine, decitabine, 5-fluorouridine, fludarabine, fluorouridine, gemcitabine, a combination of tegafur and uridine, tegafur ((RS)-5-fluoro-1-(tetrahydrofuran-2-yl)pyrimidin-2,4(1H,3H)-dione), trisatabine, terzacitabine, 2'-deoxy-2'-methylenecytidine (DMDC), and 6-mercaptopurine. Additional examples include fludarabine phosphate, N4-behenyl-1-β-D-arabinofuranylcytosine, N4-octadecyl-1-β-D-arabinofuranylcytosine, N4-palmitoyl-1-(2-C-cyano-2-deoxy-β-D-arabinofuranyl)cytosine, and P-4055 (cytarabine 5'-trans oleate).

[0078] In some embodiments, the sequence comprises one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, poly-A sequence, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.). One or more post-transcriptional modifications can be any post-transcriptional modification, such as any of the more than one hundred different nucleoside modifications identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. Nucleic Acids Res 27: 196-197). In some embodiments, the first isolated nucleic acid comprises messenger RNA (mRNA). In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of: pyridine-4-ketoribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyluridine, 1-carboxymethyl-pseudouridine, 5-propynyluridine, 1-propynyl-pseudouridine, 5-taurylmethyluridine, 1-taurylmethyl-pseudouridine, 5-taurylmethyl-2-thio- Urate, 1-taurylmethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-denitro-pseudouridine, 2-thio-1-methyl-1-denitro-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxypseudouridine, and 4-methoxy-2-thio-pseudouridine.In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of: 5-aza-cytidine, pseudocytidine, 3-methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudocytidine, pyrrole-cytidine, pyrrole-pseudocytidine, 2-thiocytidine, 2-thio-5-methylcytidine, 4-thiopseudocytidine, 4-thio-1-methylcytidine 4-Thio-1-methyl-1-deazo-pseudo ... In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of: 2-aminopurine, 2,6-diaminopurine, 7-deadenine, 7-deaden-8-aza-adenine, 7-deaden-2-aminopurine, 7-deaden-8-aza-2-aminopurine, 7-deaden-2,6-diaminopurine, 7-deaden-8-aza-2,6-diaminopurine, and 1-methyladenosine. N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycylcarboxamideadenosine, N6-threonylcarboxamideadenosine, 2-methylthio-N6-threonylcarboxamideadenosine, N6,N6-dimethyladenosine, 7-methyladenosine, 2-methylthio-adenosine, and 2-methoxy-adenosine. In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of: inosine, 1-methyl-inosine, wyoside, wyoside, 7-deazoguanosine, 7-deazo-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deazo-guanosine, 6-thio-7-deazo-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.

[0079] The sequence can be uniformly or non-uniformly modified along the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., naturally occurring nucleotides, purines or pyrimidines, or any one or all of A, G, U, C, I, pU) can be uniformly or non-uniformly modified in or within a given region of the sequence. In some embodiments, the sequence contains pseudouridine. In some embodiments, the sequence contains inosine, which can help the immune system recognize the sequence as endogenous RNA rather than viral RNA. Binding of inosine can also mediate improved RNA stability / reduced degradation. See, for example, Yu, Z. et al., (2015) RNA editing by ADAR1 marks dsRNA as “self”. CellRes. 25, 1283-1284, which is incorporated herein by reference in its entirety.

[0080] In some embodiments, one or more nucleotides of the RNA guide contain 2'- O -Methylthiophosphate modification. In some embodiments, each of the first three nucleotides of the RNA guide contains 2'- O -Methyl thiophosphate modification. In some embodiments, each of the last four nucleotides of the RNA guide contains a 2'- O -Methyl thiophosphate modification. In some embodiments, each of the penultimate, penultimate, and penultimate nucleotides of the RNA guide contains 2'- O -Methyl thiophosphate modification, wherein the last nucleotide of the RNA guide is unmodified. In some embodiments, each of the first three nucleotides of the RNA guide contains 2'- O -Methyl thiophosphate modification, and each of the penultimate, penultimate, and penultimate nucleotides of the RNA guide contains 2'- O 1-Methyl thiophosphate modification.

[0081] When the gene editing systems disclosed herein contain nucleic acids (e.g., mRNA molecules) encoding the Cas12i polypeptide disclosed herein, such nucleic acid molecules may contain any of the modifications disclosed herein (where applicable).

[0082] (d) Exemplary RNA Guide In some examples, the RNA guide provided herein may contain a direct repeat sequence of SEQ ID NO: 12 and a 20-nucleotide spacer sequence that is specific to a target sequence (e.g., SEQ ID NO: 10) within exon 1 of the HAO1 gene. In some specific examples, the spacer sequence may consist of the nucleotide sequence of SEQ ID NO: 11. In some examples, the RNA guide may contain a direct repeat sequence and a spacer sequence from 5' to 3'.

[0083] In some specific examples, the RNA guide may comprise the nucleotide sequence of SEQ ID NO: 13 provided in the sequence listing below (e.g., composed of the nucleotide sequence of SEQ ID NO: 13 provided in the sequence listing below). Alternatively, the RNA guide may be a variant of SEQ ID NO: 13 comprising a nucleotide sequence having at least 80% identity with SEQ ID NO: 13 (e.g., composed of a nucleotide sequence having at least 80% identity with SEQ ID NO: 13), such as having at least 85%, at least 90%, at least 95%, at least 97%, or higher identity with SEQ ID NO: 13. In some examples, the variant of SEQ ID NO: 13 may comprise up to 5 nucleotide variations relative to SEQ ID NO: 13, for example, up to 4, 3, 2, or 1 nucleotide variations relative to SEQ ID NO: 13.

[0084] The RNA guide provided herein may include one or more modifications, such as those disclosed herein. In some embodiments, the modification comprises 2'-O-methylation and / or phosphate thioester linkage. In some cases, such modifications can be located at the 5' and / or 3' ends of the RNA guide. A specific example is SEQ ID NO: 14 provided in the sequence listing below.

[0085] C. Lipid excipients and lipid nanoparticles (LNP) In some embodiments, the HAO1 gene editing compositions provided herein may include lipid adjuvants, which may comprise one or more types of lipids, such as cationic lipids, phospholipids (e.g., zwitterionic phospholipids), PEGylated lipids, cholesterol, or combinations thereof. Nucleic acid components (mRNA and RNA guides) may be associated with the lipid adjuvants.

[0086] Lipid excipients can form lipid nanoparticles (“LNPs”), which are particles comprising one or more lipids. In some embodiments, lipid nanoparticles may comprise a monolayer lipid membrane. Examples of such LNPs include micelles and reverse micelles. In other embodiments, LNPs may comprise a bilayer lipid membrane (e.g., liposomes). In yet another embodiment, LNPs are multilayer vesicles comprising multiple lamellar lipid bilayers. In still some embodiments, LNPs may be solid lipid nanoparticles comprising a solid lipid core matrix capable of dissolving lipophilic molecules. In some cases, solid lipid nanoparticles can also be used to dissolve molecules (e.g., nucleic acids) that can be encapsulated based on charge. In solid lipid nanoparticles, the lipid core can be stabilized by a surfactant (emulsifier), and cargoes can be distributed into the lipid core.

[0087] The LNPs disclosed herein refer to particles that are nanoscale (e.g., 1 nm to 1,000 nm) in at least one dimension. LNPs can comprise various lipids, such as cationic lipids, ionizable lipids, anionic lipids, neutral lipids, amphiphilic lipids, conjugated lipids (e.g., polyethylene glycol-modified lipids), amphiphilic lipids (e.g., phospholipids), and / or cholesterol. In some embodiments, the LNPs provided herein are included in gene-editing compositions and used to deliver an active agent or therapeutic agent (e.g., a nucleic acid (e.g., mRNA)) to a target site (e.g., a cell, tissue, organ, tumor, etc.). In some embodiments, the active agent or therapeutic agent (e.g., a nucleic acid (e.g., mRNA)) may be encapsulated in the lipid portion of the lipid nanoparticle or in an aqueous space encapsulated by some or all of the lipid portion of the lipid nanoparticle, thereby protecting the active agent or therapeutic agent from enzymatic degradation or other adverse effects induced by mechanisms of the host organism or cell (e.g., adverse immune responses).

[0088] In some embodiments, the LNP provided herein may comprise cationic lipids, neutral lipids (zwitterionic lipids), cholesterol, and polyethylene glycol-modified lipids.

[0089] (a) cationic lipids In some embodiments, the lipid excipient comprises one or more cationic lipids, which are positively charged lipids.

[0090] "Cationic lipids" refer to lipids capable of carrying a positive charge. Exemplary cationic lipids contain one or more positively charged amine groups. Exemplary cationic lipids are ionizable, allowing them to exist in a positively charged or neutral form depending on pH. Ionization of cationic lipids affects the surface charge of lipid nanoparticles under different pH conditions. This charge state can influence plasma protein uptake, blood clearance, and tissue distribution (Semple, SC et al., Adv. Drug Deliv Rev 32: 3-17 (1998)), as well as the ability to form endosome-soluble non-bilayer structures crucial for intracellular delivery of nucleic acids (Hafez, IM et al., Gene Ther 8: 1188-1196 (2001)).

[0091] In one specific example, the cationic lipid is bis(2-butyloctyl)10-(N-(3-(pyrrolidin-1-yl)propyl)nonanamido)nonadecanedioate, the structure of which is provided below: Or, the cationic lipid is a pharmaceutically acceptable salt or stereoisomer; In some examples, the cationic lipid is an amino lipid. In some cases, the cationic lipid is the only amino lipid among the lipid excipients contained in the HAO1 gene editing composition.

[0092] (b) amphiphilic lipids In some embodiments, the lipid excipients disclosed herein comprise one or more amphiphilic lipids, i.e., lipids having both polar and nonpolar portions. Exemplary amphiphilic lipids suitable for use in the nanoparticles of this disclosure include, but are not limited to, sphingolipids, phospholipids, fatty acids, and amino lipids. In some examples, the lipid excipients comprise one or more phospholipids, such as one or more saturated or (poly)unsaturated phospholipids or combinations thereof. Typically, phospholipids comprise a phospholipid portion and one or more fatty acid portions.

[0093] In some examples, the phospholipids in the lipid excipients may be zwitterionic phospholipids. Examples include, but are not limited to, diacylphosphatidylcholine (or 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC)).

[0094] In one example, the lipid adjuvant in the HAO1 gene editing composition provided herein comprises zwitterionic phospholipids, which can be DSPC.

[0095] (c) PEGylated lipids In some embodiments, the lipid excipients disclosed herein comprise one or more polyethylene glycol-modified lipids. PEGylated lipids (also known as PEG lipids or PEG-modified lipids) are lipids modified with polyethylene glycol.

[0096] In some examples, the lipid adjuvant in the HAO1 gene editing compositions provided herein comprises PEG lipids, specifically 2-[2-(ω-methoxy(polyethyleneglycol2000)ethoxy)]-N,N-ditetradecylacetamide (2-[2-(ω-methoxy(polyethyleneglycol2000)ethoxy]-N,N-ditetradecylacetamide), the structure of which is provided below: (The average value of n is 45 to 49, including extreme values) (d) Exemplary LNP In some examples, the LNP may comprise (e.g., composed of the following components): cationic lipids (e.g., bis(2-butyloctyl)10-(N-(3-(pyrrolidone-1-yl)propyl)nonanoamide)nonadecanedioate), zwitterionic phospholipids (e.g., DSPC), polyethylene glycol-modified lipids (e.g., 2-[2-(ω-methoxy(polyethylene glycol 2000)ethoxy)]-N,N-bistetradecylacetamide), and cholesterol. In some examples, the molar ratio of cationic lipids to phospholipids is in the range of about 2:1 to about 8:1, the molar ratio of cationic lipids to cholesterol is in the range of about 2:1 to 1:1, and / or the molar ratio of cationic lipids to polyethylene glycol-modified lipids is in the range of about 100:1 to about 25:1.

[0097] In some embodiments, based on the total molar amount of lipid excipients in the LNP, the lipid excipients in the HAO1 gene-editing composition may comprise about 45 to 50 mol% cationic lipids, for example, about 45 to 48 mol%, about 46 to 49 mol%, about 47 to 48 mol%, or about 48 to 50% cationic lipids. In some examples, the lipid excipients in the gene-editing composition may contain about 47.5 ± 10% mol% cationic lipids. In other examples, the lipid excipients in the gene-editing composition may contain about 47.5 ± 5% mol% cationic lipids. In one specific example, the lipid excipients in the gene-editing composition may contain about 47.5 mol% cationic lipids.

[0098] Additionally, based on the total molar amount of lipid excipients in the LNP, the lipid excipients in the HAO1 gene-editing composition may contain about 9 to 11 mol% zwitterionic phospholipids, for example, about 9 to 10 mol%, about 9.5 to 10.5 mol%, or about 10 to 11 mol% zwitterionic phospholipids. In other examples, the lipid excipients in the gene-editing composition may contain about 10 ± 10% mol% zwitterionic phospholipids. In another specific example, the lipid excipients in the gene-editing composition may contain about 10 ± 5% mol% zwitterionic phospholipids. In some specific examples, the lipid excipients in the gene-editing composition may contain about 10 mol% zwitterionic phospholipids.

[0099] Additionally, based on the total molar amount of lipid excipients in the LNP, the lipid excipients in the HAO1 gene-editing composition may contain approximately 38 to 42 mol% cholesterol, for example, approximately 38 to 40 mol%, approximately 39 to 41 mol%, approximately 39.5 to 41.5 mol%, or approximately 40 to 42 mol% cholesterol. In some examples, the lipid excipients in the gene-editing system may contain approximately 40 ± 10 mol% cholesterol. In other examples, the lipid excipients in the gene-editing system may contain approximately 40 ± 5 mol% cholesterol. In one specific example, the lipid excipients in the gene-editing system may contain approximately 40 mol% cholesterol.

[0100] Additionally, based on the total molar amount of lipid excipients in the LNP, the lipid excipients in the HAO1 gene-editing composition may comprise about 2.2 to 2.8 mol% of polyethylene glycol-modified lipids, for example, about 2.2 to 2.5 mol%, about 2.4 to 2.6 mol%, or about 2.6 to 2.8 mol% of polyethylene glycol-modified lipids. In some examples, the lipid excipients in the gene-editing composition may comprise 2.5 ± 10 mol% of polyethylene glycol-modified lipids. For example, the lipid excipients in the gene-editing composition may comprise about 2.5 ± 5 mol% of polyethylene glycol-modified lipids. In some specific examples, the lipid excipients in the gene-editing composition may comprise about 2.5 mol% of polyethylene glycol-modified lipids.

[0101] In one specific example, the lipid excipient comprises approximately 47.5 mol% of cationic lipids (e.g., bis(2-butyloctyl)10-(N-(3-(pyrrolidone-1-yl)propyl)nonanoamide)nonadecanedioate), approximately 10 mol% of zwitterionic phospholipids (e.g., DSPC), approximately 40 mol% of cholesterol, and approximately 2.5 mol% of PEG lipids (e.g., 2-[2-(ω-methoxy(polyethylene glycol 2000)ethoxy]-N,N-bistetradecylacetamide).

[0102] The N / P ratio of the LNP (where N represents the moles of cationic lipids and P represents the moles of phosphorus present as part of the nucleic acid backbone) ranges from 2:1 to 30:1, for example, from 3:1 to 22:1. In other embodiments, the N / P range is from 6:1 to 20:1, from 3:1 to 9:1, or from 2:1 to 12:1. Exemplary N / P ranges include about 3:1, about 6:1, about 9:1, about 12:1, and about 22:1.

[0103] D. Exemplary HAO1 gene editing compositions In some embodiments, the HAO1 gene editing compositions provided herein comprise an mRNA molecule encoding a Cas12i2 polypeptide as disclosed herein (e.g., SEQ ID NO: 7 or SEQ ID NO: 17), an RNA guide comprising a spacer sequence specific to SEQ ID NO: 10 and a direct repeat sequence of SEQ ID NO: 12 in exon 1 of the human HAO1 gene, and a lipid adjuvant comprising cationic lipids (which may be aminolipids), zwitterionic phospholipids, cholesterol, and PEGylated lipids. The lipid adjuvant forms an LNP, and the nucleic acid components (mRNA and RNA guide) are attached to or encapsulated by the LNP.

[0104] In some examples, the mRNA contains a nucleotide sequence that has at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 98%, or higher) identity with SEQ ID NO: 8. In one specific example, the mRNA may contain the nucleotide sequence of SEQ ID NO: 8.

[0105] In lipid excipients, cationic lipids can have the following structures: Alternatively, the cationic lipid can be a pharmaceutically acceptable salt or stereoisomer. Polyethylene glycol-modified lipids can have the following structures: The average value of n is 45 to 49, including extreme values ​​(e.g., 45, 46, 47, 48, or 49). The zwitterionic phospholipid is 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC).

[0106] In the exemplary HAO1 gene editing composition, based on the total molar amount of lipid excipients in the LNP, the LNP may contain 45 to 50 mol% (e.g., about 47.5 mol%) of cationic lipids, 9 to 11 mol% (e.g., about 10 mol%) of zwitterionic phospholipids, 38 to 42 mol% (e.g., about 40 mol%) of cholesterol, and 2.2 to 2.8 (e.g., about 2.5) mol% of polyethylene glycol-modified lipids. In a specific example, based on the total molar amount of lipid excipients in the LNP, the LNP may contain about 47.5 mol% of cationic lipids, about 10 mol% of zwitterionic phospholipids, about 40 mol% of cholesterol, and about 2.5 mol% of polyethylene glycol-modified lipids.

[0107] In some examples, the mRNA contains UTRs flanking the coding sequence for the Cas12i2 polypeptide, such as 5' UTRs and 3' UTRs, as well as a poly-A tail. In one specific example, the mRNA may contain the nucleotide sequence of SEQ ID NO: 23 (e.g., composed of the nucleotide sequence of SEQ ID NO: 23). Furthermore, the mRNA may carry a 5' cap, such as m7G(5')ppp(5')(2'OMeA)pG, and may contain pseudouridine residues that replace uridine residues (e.g., 100%).

[0108] In some examples, the RNA wizard may contain the spacer sequence of SEQ ID NO: 11. Such an RNA wizard may contain the nucleotide sequence of SEQ ID NO: 13 (e.g., composed of the nucleotide sequence of SEQ ID NO: 13). The RNA wizard may contain one or more modifications, such as phosphate thioester linkage and 2'-O-methylation, and one or more modifications may be located at the 5' and / or 3' nucleotides. In a specific example, the RNA wizard is shown in SEQ ID NO: 14.

[0109] In some examples, the ratio of mRNA to RNA guide in the HAO1 gene editing composition is 1 ± 20% (e.g., 0.8 to 1.2). In some specific examples, the ratio is 1:1 (1.0).

[0110] In some examples, the nitrogen:phosphorus (N / P) ratio of the HAO1 gene-editing composition is 6.0 ± 20% (e.g., 6.0 ± 15%, 6.0 ± 10%, 6.0 ± 5%, 6.0 ± 2%, or 6.0 ± 1%), which represents the relative amount of LNP to nucleic acid in the composition. In other examples, the nitrogen:phosphorus (N / P) ratio of the HAO1 gene-editing composition is 6.0 ± 1 (e.g., 6.0 ± 0.5). In one example, the N / P ratio in the HAO1 gene-editing composition provided herein ranges from 5.18 to 7 (e.g., 5.6 or 6.0).

[0111] Typically, the N / P ratio can be calculated from the results of two assays: HPLC (for determining the molar number of aminolipids) and ribogreen (for determining the molar number of total RNA). Details are provided in Example 1 below.

[0112] II. Preparation of Gene Editing Components This disclosure provides methods for producing components (e.g., RNA guides) of the gene editing systems disclosed herein, methods for producing mRNA encoding the Cas12i polypeptide, and methods for compounding the RNA guide and Cas12i2 mRNA with lipid excipients.

[0113] A. RNA guide and mRNA encoding Cas12i2 In some embodiments, the RNA guide is prepared by in vitro transcription of a DNA template. Thus, for example, in some embodiments, the RNA guide is generated by in vitro transcription of a DNA template encoding an RNA guide and / or mRNA using an upstream promoter sequence (e.g., a T7 polymerase promoter sequence). In some embodiments, the DNA template encodes multiple RNA guides, or the in vitro transcription reaction includes multiple different DNA templates, each encoding a different RNA guide. In some embodiments, the DNA template encodes both the RNA guide and the mRNA molecule, and it is possible to generate both the RNA guide and the mRNA molecule as separate RNA molecules in vitro.

[0114] In some embodiments, mRNA is prepared by in vitro transcription of a DNA template. In some examples, mRNA prepared by in vitro transcription may be modified according to methods known in the art, such as the addition of a 5' cap (e.g., those 5' caps disclosed herein). In some embodiments, synthetic capping residues, synthetic 5' caps (e.g., synthetic 5' caps disclosed herein), may be used for in vitro transcription such that the mRNA product contains a synthetic 5' cap. Additionally or further, modified nucleotide residues (e.g., pseudouridine residues) may be used for in vitro transcription such that the modified nucleotide residues are incorporated into the resulting mRNA product.

[0115] In some embodiments, the RNA guide is prepared using chemical synthesis methods. In some examples, the RNA guide can be synthesized using one or more modified nucleotides, such as those described above.

[0116] B. LNPs carrying nucleic acids In some embodiments, the HAO1 gene editing compositions disclosed herein comprise lipid excipients (such as those disclosed herein) that form LNPs, and nucleic acid components (mRNA and gRNA) in the composition are attached to or encapsulated by the LNPs to produce nucleic acid-loaded LNPs.

[0117] There are several methods that can be used to prepare LNPs. See, for example, Szoka et al., Ann. Rev. Biophys. Bioeng. 9:467 (1980), U.S. Patent Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, 4,946,787, PCT Publication No. WO 91 / 17424, Deamer & Bangham, Biochim. Biophys. Acta 443:629-634 (1976); Fraley et al., PNAS 76:3348-3352 (1979); Hope et al., Biochim. Biophys. Acta 812:55-65 (1985); Mayer et al., Biochim. Biophys. Acta 858:161-168 (1986); Williams et al., PNAS 85:242-246 (1988); Hope et al., Chem. Phys. Lip. 40:89 (1986); Gregoriadis, Liposome Technology (1984). Such conventional methods can be used to prepare LNPs using the lipid excipients disclosed in this invention. Any of these methods can be carried out in the presence of nucleic acid components (mRNA and gRNA) in the gene editing composition, resulting in lipid nanoparticles carrying nucleic acids to produce nucleic acid-loaded LNPs.

[0118] Lipid nanoparticles prepared according to any method known in the art or any method disclosed herein can be analyzed to determine concentration and / or particle size distribution (e.g., by NTA). Additionally or further, lipid nanoparticles can be fractionated, and particles of suitable size can be collected for use in the fusion methods disclosed herein.

[0119] Furthermore, LNPs carrying nucleic acids can be analyzed according to methods known in the art and / or the disclosures provided herein to determine the N / P ratio. The N / P ratio is the ratio of the molar number of cationic lipids (N) to the molar number of phosphorus (P) present as part of the nucleic acid backbone.

[0120] LNPs can be prepared according to methods known in the art, such as those disclosed in WO 2017 / 004143, which is incorporated herein by reference in its entirety. Briefly, cationic lipids, zwitterionic phospholipids, cholesterol, and PEGylated substances are dissolved in ethanol in a molar ratio of 40-50:5-15:35-45:1-5, respectively. LNPs are typically prepared at a total lipid to mRNA weight ratio of approximately 10:1 to 30:1. The mRNA is diluted to 0.2 mg / mL in 10-50 mM citrate buffer at pH 4. The ethanol lipid solution is mixed with the mRNA aqueous solution at a volume ratio of approximately 1:5 to 1:3 using a syringe pump at a total flow rate greater than 15 mL / min. The ethanol is then removed, and the external buffer is replaced with PBS by dialysis. Finally, the lipid nanoparticles are filtered through a sterile filter with a 0.2 μm pore size.

[0121] III. Gene editing methods for the HAO1 gene and treatment of primary hyperoxaluria Any of the HAO1 gene-editing compositions disclosed herein can be used to gene-edit the HAO1 gene in host cells. In some embodiments, the method includes introducing the HAO1 gene-editing composition into host cells. Such HAO1 gene-editing compositions may contain LNPs carrying nucleic acids (mRNA / gRNA) as disclosed herein. In some cases, the HAO1 gene-editing compositions can be introduced into host cells cultured in vitro. In other cases, the HAO1 gene-editing compositions described herein are delivered to a subject to genetically modify the HAO1 gene in the subject.

[0122] As used herein, the term "edit" refers to one or more modifications introduced into a target nucleic acid (e.g., within the HAO1 gene). This editing can be one or more substitutions, one or more insertions, one or more deletions, or a combination thereof. As used herein, the term "substitution" refers to the replacement of one or more nucleotides with different nucleotides relative to a reference sequence. As used herein, the term "insertion" refers to the gain of one or more nucleotides in a nucleic acid sequence relative to a reference sequence. As used herein, the term "deletion" refers to the loss of one or more nucleotides in a nucleic acid sequence relative to a reference sequence.

[0123] Any of the HAO1 gene-editing compositions disclosed herein (e.g., containing nucleic acid LNPs) or modified cells generated using such gene-editing systems as disclosed herein can be used to treat diseases from which gene editing of the HAO1 gene can benefit, such as primary hyperoxaluria (PH). In some embodiments, PH is PH1, PH2, or PH3. In a specific example, the target disease is PH1.

[0124] Phylogenetic disorder (PH) is a rare genetic disorder that affects individuals of all ages, from infancy to old age. PH comprises three subtypes, each involving a gene defect that alters the expression of three different proteins. PH1 involves alanine-glyoxylate aminotransferase, or AGT / AGT1. PH2 involves glyoxylate / hydroxypyruvate reductase, or GR / HPR, and PH3 involves 4-hydroxy-2-oxoglutarate aldolase, or HOGA.

[0125] In PH1, excess oxalate can also bind with calcium, forming calcium oxalate in the kidneys and other organs. Calcium oxalate deposition can lead to widespread calcium oxalate deposition (nephrocalcinosis) or the formation of kidney and bladder stones (urolithiasis), resulting in kidney damage. Common kidney complications in PH1 include hematuria, urinary tract infections, kidney injury, and end-stage renal disease (ESRD). Over time, the kidneys of patients with PH1 may begin to fail, and blood oxalate levels may rise. Due to high blood oxalate levels, oxalate deposition in tissues throughout the body (such as systemic oxalate deposition) can occur and can lead to complications in the bones, skin, and eyes. Patients with PH1 typically develop kidney failure early in life, and kidney dialysis or combined liver-kidney transplantation is the only treatment option.

[0126] In some embodiments, this document provides a method for treating PH (e.g., PH1) in a subject requiring treatment (e.g., a human patient). The method may include administering any of the HAO1 gene-editing compositions disclosed herein to the subject requiring treatment (e.g., a human patient). The HAO1 gene-editing composition may be delivered to a specific tissue or a specific type of cell requiring gene editing. In some examples, the HAO1 gene-editing composition comprises an LNP carrying an mRNA encoding Cas12i2 and a gRNA targeting HAO1, as also disclosed herein. In specific examples, the exemplary HAO1 gene-editing compositions disclosed above (see, for example, subsection D of Part I above) may be used in the therapeutic methods disclosed herein.

[0127] The HAO1 gene-editing compositions disclosed herein can be prepared, packaged, or marketed in formulation form for use with a suitable route of administration (e.g., intravenous or other routes of administration). The compositions disclosed herein can be prepared, packaged, or marketed in bulk form, as a single unit dose, or as multiple single unit doses. As used herein, a “unit dose” is a discrete amount of a pharmaceutical composition (e.g., a gene-editing system or a component thereof) to be administered to a subject, or a convenient fractional portion of such a dose, such as half or one-third of such a dose.

[0128] In some embodiments, the HAO1 gene-editing composition disclosed herein may be administered to subjects in need, such as those with liver disease associated with the HAO1 gene. In some cases, the gene-editing composition may be delivered to specific cells or tissues (e.g., hepatocytes), wherein the gene-editing component may function to genetically modify the HAO1 gene in such cells.

[0129] Formulations of HAO1 gene-editing compositions suitable for parenteral administration may comprise an active agent (e.g., mRNA encoding nucleases and gRNA) combined with pharmaceutically acceptable excipients (e.g., lipid excipients, such as LNPs formed therefrom) and a carrier (e.g., sterile water or sterile isotonic saline). Such formulations may be prepared, packaged, or marketed in forms suitable for bolus or continuous administration. Some injectable formulations may be prepared, packaged, or marketed in unit doses (e.g., in ampoules or multi-dose containers containing preservatives). Some formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions, ointments, and implantable sustained-release or biodegradable formulations in oily or aqueous carriers. Some formulations may also contain one or more additional ingredients, including but not limited to suspending agents, stabilizers, or dispersants.

[0130] HAO1 gene-editing compositions can be in the form of sterile, injectable aqueous or oily suspensions or solutions. These suspensions or solutions can be formulated using known techniques and may contain additional components besides cells, such as dispersants, wetting agents, or suspending agents as described herein. Such sterile injectable formulations can be prepared using non-toxic, parenteral-acceptable diluents or solvents (e.g., water or saline). Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils (e.g., synthetic monoglycerides or diglycerides). Other useful parenteral-applicable formulations include those that may contain cells, which may be in packaged form, liposome formulations, or as a component of a biodegradable polymer system. Some compositions for sustained release or implantation may contain pharmaceutically acceptable polymeric or hydrophobic materials, such as emulsions, ion exchange resins, slightly soluble polymers, or slightly soluble salts.

[0131] In some embodiments, an effective amount of the HAO1 gene-editing composition disclosed herein (e.g., the exemplary HAO1 gene-editing composition disclosed in Section D of Part I above) can be administered via a suitable route (e.g., intravenous infusion) to a human patient with PH (e.g., PH1) to treat the disease.

[0132] As used herein, the term “treatment” refers to the application or administration of a composition comprising one or more active agents (hereinafter, mRNA encoding a nuclease and gRNA targeting HAO1) ​​to a subject having a target disease or condition (PH, such as PH1 in this disclosure), symptoms of the disease / condition, or susceptibility to the disease / condition, with the aim of curing, healing, alleviating, relieving, altering, remedying, improving, enhancing, or influencing the condition, symptoms of the disease, or susceptibility to the disease or condition.

[0133] Mitigating a target disease / symptom involves delaying its development or progression, reducing its severity, or prolonging survival. Mitigation or prolonged survival does not necessarily require a curative outcome. As used herein, “delaying” the development of a target disease or symptom means postponing, hindering, slowing, delaying, stabilizing, and / or postponing its progression. The length of this delay can vary depending on the individual’s medical history and / or current treatment. A method of “delaying” or mitigating the development of a disease or delaying its onset, compared to not using this approach, refers to reducing the probability of developing symptoms of one or more diseases and / or reducing the degree of symptoms within a given timeframe. Such comparisons are typically based on clinical studies using a sufficient number of subjects to provide statistically significant results.

[0134] The term "development" or "progression" of a disease refers to the initial presentation and / or subsequent progression of the disease. The development of a disease can be detected and assessed using standard clinical techniques known in the art. However, development also refers to progression that may be undetectable. For the purposes of this disclosure, development or progression refers to the biological process of symptoms. "Development" includes occurrence, recurrence, and onset. As used herein, an "onset" or "occurrence" of a target disease or condition includes an initial onset and / or recurrence.

[0135] As used herein, “effective amount” refers to the amount of each active agent (e.g., nuclease-encoded mRNA and HOA1-targeting gRNA) required, alone or in combination with one or more other active agents, to produce a therapeutic effect on a subject. Determining whether an amount of the HAO1 gene-editing composition will produce a therapeutic effect will be apparent to those skilled in the art. Effective amounts vary, as will be recognized by those skilled in the art, depending on the specific condition being treated, the severity of the condition, individual patient parameters (including age, physical condition, body type, sex, and weight), the duration of treatment, the nature of any combination therapy, the specific route of administration, and similar factors within the knowledge and expertise of the healthcare practitioner. These factors are well known to those skilled in the art and can be resolved without requiring extensive routine experiments. Generally, the maximum dose of each component or combination thereof is preferred, i.e., the highest safe dose based on reasonable medical judgment.

[0136] Empirical considerations (such as half-life) often help in determining the dosage. The frequency of administration can be determined and adjusted during treatment and is usually (but not necessarily) based on the treatment and / or suppression and / or improvement and / or delay of the target disease / symptom.

[0137] In one example, the dosage of the HAO1 gene-editing composition as described herein, specifically the dosage of its mRNA and gRNA components, can be empirically determined in individuals who have received one or more administrations of the composition. Individuals are given escalating doses of the agonist. To assess the efficacy of the agonist, indicators of the disease / symptom can be tracked.

[0138] In some embodiments, the HAO1 gene-editing composition disclosed herein can be administered to human PH patients at a dose of nucleic acid (total mRNA and gRNA) of about 2.0 to 5.0 mg per kilogram of patient body weight.

[0139] Treatment efficacy can be assessed through routine medical practice. In some embodiments, gene editing of the HAO1 gene in host cells and / or subjects treated with the HAO1 gene-editing composition can be examined, for example, the percentage of Indels in the HAO1 gene (e.g., at the target sequence site). Additionally, or further, the HAO1 gene product (GO enzyme) and molecules involved in the pathway catalyzed by the GO enzyme (e.g., glycolic acid, glyoxylic acid, and / or oxalate) in the subject can be measured before and after treatment to assess the outcome of HAO1 gene editing.

[0140] V. Reagent kit and its uses This disclosure also provides a kit that can be used, for example, to implement the methods described herein for gene modification of the HAO1 gene. In some embodiments, the kit includes components of the HAO1 gene editing composition disclosed herein, such as mRNA encoding the Cas12i2 peptide, gRNA targeting the HAO1 gene, and lipid excipients. In some embodiments, the kit contains LNPs carrying both mRNA and gRNA. The kit may also optionally additionally include buffers and / or instructions for use of the HAO1 gene editing composition.

[0141] In some embodiments, the kit may include instructions for use according to any of the methods described herein. The included instructions may contain a description of administering the HAO1 gene-editing composition disclosed herein to treat, delay the onset of, or alleviate a target disease (PH, such as PH1) also as described herein. The kit may also contain a description of selecting suitable individuals for treatment based on identifying whether an individual has a target disease.

[0142] Instructions for use with the HAO1 gene-editing composition typically include information on the intended therapeutic dose, dosing regimen, and route of administration. Containers may be unit dose, bulk packaging (e.g., multi-dose packaging), or subunit dose. Instructions provided with the kits of this invention are typically written instructions on a label or packaging insert (e.g., paper included in the kit), but machine-readable instructions (e.g., instructions stored on a magnetic or optical storage disk) are also acceptable.

[0143] The label or packaging insert indicates that the composition is intended for the treatment, delay of onset, and / or relief of target diseases. Instructions for use in carrying out any of the methods described herein may be provided.

[0144] The kit of the present invention employs suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed polyester film (Mylar) bags or plastic bags), etc. Packaging for use in combination with specific devices is also contemplated, such as inhalers, intranasal administration devices (e.g., nebulizers), or infusion devices (e.g., micropumps). The kit may have a sterile access port (e.g., the container may be an intravenous infusion bag or a vial with a stopper that can be pierced by a hypodermic needle). The container may also have a sterile access port (e.g., the container may be an intravenous infusion bag or a vial with a stopper that can be pierced by a hypodermic needle).

[0145] The kit may optionally include additional components, such as buffer solutions and explanatory information. Typically, the kit includes a container and a label or one or more packaging inserts on or associated with the container. In some embodiments, this disclosure provides an article comprising the contents of the kit described above.

[0146] sequence list

[0147] • The 2'-O-methyl thiophosphate modification is indicated as follows: Thiophosphate; m,2'-O-methyl • Underlined and italicized nucleotide sequences refer to the 5' and 3' untranslated regions (UTRs). • “n” refers to an adenosine (a) residue or its absence.

[0148] General technology Unless otherwise stated, implementation of this disclosure will employ conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, well known to those skilled in the art. Such techniques are well described in the literature, for example, in *Molecular Cloning: A Laboratory Manual*, 2nd edition (Sambrook et al., 1989, Cold Spring Harbor Laboratory Press). Molecular Cloning: A Laboratory Manual , second edition (Sambrook, et al., 1989) Cold Spring Harbor Press); Oligonucleotide Synthesis (edited by MJ Gait, 1984) Oligonucleotide Synthesis (MJ Gait, ed. 1984); *Methods of Molecular Biology*, Humanities Press ( Methods in Molecular Biology Humana Press); Cell Biology: A Laboratory Manual (edited by JECellis, 1989, Academic Press) Cell Biology: A Laboratory Notebook(J. E. C. Lis, ed., 1989) Academic Press); Animal Cell Culture (RI. Freshney, ed., 1987); Introduction to Cell and Tissue Culture (JP. Mather and PE. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J.B. Griffiths, and D. G. Newell, eds., 1993-1998) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.) Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (Mullis, et al., eds., 1994); Current Protocols in Immunology (JE*Current Protocols in Immunology* (JE Coligan et al., eds., 1991); *Short Protocols in Molecular Biology* (Wiley and Sons, 1999); *Immunobiology* (CA Janeway and P. Travers, 1997); *Antibodies* (P. Finch, 1997); *Antibodies: an application approach* (D. Catty., ed., IRL Press, 1988-1989); *Monoclonal Antibodies: an application approach* (P. Shepherd and C. Dean (eds., Oxford University Press, 2000) (Monoclonal antibodies: an practical approach); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999)); The Antibodies (M. Zanetti and JD Capra, eds., Harwood Academic Publishers, 1995); DNA cloning: a practical approach, Volumes I and II (D. Glover, ed., 1985). DNA Cloning: A practical approach Volumes I and II (DN Glover ed. 1985); Nucleic Acid Hybridization (BD Hames and SJ Higgins eds., 1985) Nucleic Acid Hybridization(BD Hames & S.J. Higgins eds. (1985)); Transcription and Translation (BD Hames and S.J. Higgins eds., 1984) Transcription and Translation (BD Hames & S.J. Higgins, eds. (1984)); Animal Cell Culture (RI Freshney, ed., 1986) Animal Cell Culture (RI Freshney, ed. (1986)); Immobilized Cells and Enzymes (IRL Publishing, 1986) Immobilized Cells and Enzymes (lRL Press, (1986)); and B. Perbal, *Practical Guide to Molecular Cloning* (1984), FM Ausubel et al. (eds.) (B. Perbal, A practical Guide To Molecular Cloning (1984); FM Ausubel et al. (eds.)).

[0149] Without further elaboration, it is believed that those skilled in the art will be able to fully utilize the invention based on the foregoing description. Therefore, the following specific embodiments should be interpreted as illustrative only and in no way limit the remainder of this disclosure. All publications cited herein are incorporated herein by reference for the purposes or subjects described herein.

[0150] Example The following examples are provided to further illustrate some embodiments of the invention, but are not intended to limit the scope of the invention; it will be understood from their exemplary nature that other procedures, methods or techniques known to those skilled in the art may be used instead.

[0151] Example 1: In vivo efficacy and tolerability of the HAO1 gene editing system This example evaluates the efficacy and tolerability of a gene editing system containing Cas12i2 mRNA and HAO1 guide RNA. The mRNA expressing the Cas12i2 protein and the gRNA targeting HAO1 were loaded into lipid nanoparticles.

[0152] Composition and treatment group Table 1 describes the compositions for specific treatment groups.

[0153] Table 1. Composition characteristics and dosage concentrations in the treatment group

[0154] The mRNA contains a 5' cap modification and a pseudouridine modification.

[0155] LNP A comprises 47.5% cationic lipid bis(2-butyloctyl)10-(N-(3-(pyrrolidone-1-yl)propyl)nonamido)nonadecanedioate, 10.0% phospholipid DSPC, 40.0% cholesterol, and 2.5% PEG lipid 2-[2-(ω-methoxy(polyethylene glycol 2000)ethoxy]-N,N-bistetradecylacetamide. LNP A was prepared according to the general procedure of WO 2017 / 004143, which is incorporated herein by reference for the purposes and uses of this document.

[0156] LNP B is a contrasting LNP that contains different lipid excipients than LNP A.

[0157] The nitrogen:phosphorus (N / P) ratio was calculated based on the results of HPLC (for the determination of the molar number of aminolipids) and ribogreen (for the determination of the molar number of total RNAs), as shown in the following formula: Animal treatment plan The test composition containing the nucleic acid LNP was administered to cynomolgus monkeys (NHP) via intravenous infusion over 1 hour. Animals were acclimatized to laboratory conditions for at least 14 days prior to the start of the study. A pretreatment drug containing 1 mg / kg dexamethasone, 0.5 mg / kg famotidine, and 5 mg / kg diphenhydramine was administered intramuscularly to the quadriceps femoris muscle one day prior to administration and 60 to 90 minutes prior to administration.

[0158] The composition was diluted to an appropriate test dose concentration (total RNA mg / mL) using 0.9% sodium chloride as a carrier to achieve an appropriate dose level (mg / kg / dose) at an infusion rate of 5 mL / kg / hr. The dosage form was administered intravenously over 1 hour (±5 minutes). The dosage form was administered using a temporary catheter inserted into a peripheral vein and connected to the infusion line. An appropriate volume was delivered via an infusion pump.

[0159] In some animals, additional doses of dexamethasone were administered to the quadriceps femoris muscle at 1 mg / kg via intramuscular injection 6 hours and approximately 24 hours after administration.

[0160] Following administration, animals were monitored at least twice daily for morbidity, appetite / food consumption, and other cage-side observations such as overall appearance and activity levels. Body weight was monitored at 24, 72, and 168 hours post-administration, and then weekly throughout the study period. Blood samples were also collected at different time points post-infusion for serum chemistry and coagulation assays. Exemplary biomarkers used for these assays are listed in Table 2.

[0161] Table 2. Biomarkers used for testing

[0162] The in vivo observation phase of the NHP study ended 3 to 4 weeks after administration. Animals were fasted overnight before sacrifice. After terminal blood collection, animals were sedated, weighed, and euthanized with an overdose of euthanasia solution. Animals were then perfused with phosphate-buffered saline and underwent a full gross examination and tissue collection.

[0163] HAO1 gene editing: %indel assay Liver tissue was collected at the end of the study to assess indel levels. Approximately 250 mg of tissue was collected from each of the caudate, left, middle, and right lobes of the liver, flash-frozen in liquid nitrogen, and stored at -80°C. This was for extraction of tissue for insertion. For DNA indel analysis, four 20 mg liver samples were taken from each of the four liver lobes, placed on ice, and 700 μL of Quick Extract solution was added. The samples were then homogenized using Qiagen TissueLyser II at low temperature.

[0164] Next-generation sequencing (NGS) samples are prepared using two rounds of PCR. The first round (PCR1) amplifies a specific genomic region dependent on the target. A second round of PCR (PCR2) is performed to add Illumina adapters and indexes. The reactants are then pooled and purified by column purification. Sequencing runs are performed using a 150-cycle NextSeq 500 / 550 Mid or High Output v2.5 kit or a 200-cycle NovaSeq 6000 SP or S1 Reagent Kit v1.5.

[0165] For NGS analysis, the indel plotting function uses the sample's FASTQ file, amplicon reference sequence, and forward primer sequence. For each read, the KMER scanning algorithm is used to calculate the editing operations (matches, mismatches, insertions, deletions) between the read and the reference sequence. To remove a small number of primer dimers present in some samples, the first 30 nucleotides of each read must match the reference sequence, and reads with mismatches in more than half of the aligned nucleotides are also filtered out. A maximum of 50,000 filtered reads are used for analysis, and reads containing insertions or deletions are counted as indel reads. The minimum QC requirement for filtered reads is 10,000.

[0166] For each target, the indel ratio for each sample and its corresponding template-free control is calculated. This indel ratio refers to the percentage of NGS reads containing indels.

[0167] GO enzyme activity and glycolic acid measurement GO activity was measured using an HPLC-based assay that determined glyoxylate levels after the addition of sodium glycolate substrate to liver tissue homogenates. In this assay, 25 to 50 mg of tissue was sonicated in a lysis buffer containing HEPES and 10% Triton-X. Liver lysates were incubated with a sodium glycolate master mixture (100 mM Tris HCl, 5 mM sodium glycolate) at 37°C for 15 min. After incubation, 5 M PCA was added, the sample was centrifuged for 5 min, and the supernatant was run on HPLC to detect glyoxylate levels. HAO1-edited samples were expected to have lower glyoxylate levels because GO (an enzyme encoded by the HAO1 gene) is responsible for the conversion of glycolate to glyoxylate.

[0168] Ion chromatography-mass spectrometry (ICMS) was used to measure glycolic acid levels in serum. Plasma was diluted approximately 10-fold with 13C2-glycolic acid. Large molecules in the plasma were removed by centrifugation using a 0.4 ml Amicon Ultra 10 kD nominal molecular weight cutoff filter (Millipore Sigma). Ion chromatography analysis was performed using an Integrion Reagent Free HPIC with an AS-AP refrigerated autosampler (Thermo Fisher), and mass spectrometry analysis was performed using an ISQ-EC (Thermo Fisher).

[0169] Summarize The results obtained from the above studies demonstrate the effects of optimized guides, LNPs, guide:mRNA ratios, N / P ratios, and nuclease variants on in vivo editing levels in NHP livers. The treatment leading to the highest indel levels (average 60%) was LNP-A containing SEQ ID NO: 23 mRNA and HAO1 E1T2 guide RNA in a 1:1 ratio, with an overall N / P ratio of approximately 6.0 (e.g., 5.64). See also Figure 1 .

[0170] In addition, animals in the treatment group with an average editing rate exceeding 55% showed editing levels on an individual animal basis. Figure 2C ), GO activity ( Figure 2A ), and as a biomarker of glycolic acid levels ( Figure 2BTwo out of three animals had indel levels exceeding 55% (dots represent individual liver lobes). All animals showed a decrease in GO activity exceeding 75% compared to the treatment group, which produced a low editing rate (<5%). All animals showed elevated glycolic acid levels.

[0171] These results indicate that treatment with LNP-A containing mRNA (SEQ ID NO: 23) encoding Cas12i2 B and HAO1gRNA in a 1:1 ratio, with an overall N / P ratio of approximately 6.0, can achieve a target indel rate of over 55% with associated reduction in GO activity and increase the amount of glycolic acid required for physiologically significant results.

[0172] Example 2: In wild-type mice HAO1 The role of gene editing This example illustrates the role of mouse homologs of the HAO1 gene-editing compositions provided herein in wild-type mice.

[0173] Animal treatment plan A short-term pharmacokinetic (PK) study was conducted in male C57BL / 6 mice aged 6 to 8 weeks. Mice were weighed three days prior to administration. After incubation at room temperature for 30 minutes, whole blood was centrifuged at 2,000 xg for 10 minutes. Plasma was transferred to Eppendorf collection tubes and stored at -80°C.

[0174] On the day of administration, the drug contained Cas12i2 mRNA A (SEQ ID NO: 18) (encoding Cas12i2 polypeptide A of SEQ ID NO: 17) and mouse HAO1 guide (mA). mG mA AAUCCGUCUUUCAUUGACCGGUGAAGCACUGAUCGGAC mA mU LNP (LNP A) containing mG (SEQ ID NO: 19) was delivered via tail vein injection, and retro-orbital injection was also possible. LNPs carrying mRNA / gRNA were administered at a dose of 2.5 mg RNA / kg body weight. Autopsies and tissue collection were performed at different time points after treatment, as shown in Table 3 below.

[0175] Whole blood was collected via cardiac puncture using an insulin syringe with a needle to achieve the maximum blood volume. PBS was perfused into the tissue via the vena cava using a 10 ml syringe with a 23-gauge needle. After perfusion, the spleen and two separate liver lobes were collected and flash-frozen on dry ice. For histological examination, a third liver lobe was collected and placed in 10% NBF for 24 to 48 hours, followed by placement in 70% ethanol. Whole blood was processed as described above.

[0176] Table 3. Research Timeline

[0177] This study shows that Hao1 Indel editing efficiency greater than 55% resulted in a more than 90% decrease in GO protein. This reduction in GO protein was associated with an 8-fold increase in plasma glycolic acid. These studies indicate that... Hao1 A 55% gene editing efficiency can produce physiologically beneficial effects. See also... Figure 3 .

[0178] Example 3 - AGXT - / - mice HAO1 Research on gene editing: A model for PH To understand the in vivo pharmacological effects of HAO1 editing, the aforementioned LNPs carrying mRNA / gRNA were administered to alanine-glyoxylate aminotransferase-deficient (AGXT- / -) mice, a model of PH1 disease. Salido et al. Proc. Natl. Acad. Sci. USA The relevant content of (2006) 103(48): 18249-18254 is incorporated herein by reference for the subject and purpose cited in this paper. AGXT- / - mice exhibited complete loss of expression of both AGXT mRNA and protein and showed hyperoxaluria (urinary oxalate increased 3 to 4 times) compared with littermate controls. Male AGXT- / - mice aged 15 to 20 weeks were housed in conventional cages and fed a low-oxalate diet from day 1 to day 7. From day 8 to day 11, the mice were adapted to metabolic cages. Baseline urine and serum were collected from day 15 to day 18. Animals were administered one of two doses (low dose: 1.5 mg / kg; high dose: 3.0 mg / kg) from day 19 to day 20. Serum and urine were collected weekly thereafter, and the study was terminated on day 40. At necropsy, terminal blood collection was performed by cardiac puncture and PBS perfusion was performed for tissue collection.

[0179] HAO1 protein measurement GO protein levels were measured using Jess Simple Western blotting (Protein Simple). Approximately 50 mg of liver tissue was added to 400 μL of RIPA buffer containing a 1X protease inhibitor and homogenized using a Qiagen tissue homogenizer. The sample was centrifuged and the supernatant was collected. The concentration was determined using the BCA assay. The sample was normalized to 1 mg / mL and mixed with the fluorescent master mixture (Protein Simple, PS-ST01EZ-8). The sample was denatured by incubation at 65°C for 5 minutes. Luminol-S / peroxide, primary antibody, and secondary antibody were prepared for GO protein detection, with vitreous adhesion protein (Vinculin) used as a loading control. The sample was loaded into Jess Simple Western blotting for protein measurement.

[0180] HAO1 gene editing: %indel assay Liver tissue was collected at the end of the study to assess indel levels. Approximately 250 mg of tissue was collected from each of the tail lobe, left lobe, middle lobe, and right lobe, flash-frozen in liquid nitrogen, and stored at -80°C. To extract DNA for indel analysis, approximately 20 mg of liver sample from each of the four lobes was placed on ice, 700 μL of Quick Extract solution was added, and homogenization was performed using Qiagen TissueLyser II at low temperature. NGS was performed as described above.

[0181] Next-generation sequencing (NGS) samples are prepared using two rounds of PCR. The first round (PCR1) is used to amplify a specific genomic region dependent on the target. A second round of PCR (PCR2) is performed to add Illumina adapters and indexes. The reactants are then pooled and purified by column purification. Sequencing runs are performed using a 150-cycle NextSeq 500 / 550 Mid or High Output v2.5 kit or a 200-cycle NovaSeq 6000 SP or S1 Reagent Kit v1.5.

[0182] For NGS analysis, the indel plotting function uses the sample's FASTQ file, amplicon reference sequence, and forward primer sequence. For each read, the KMER scanning algorithm is used to calculate the edit operations (matches, mismatches, insertions, deletions) between the read and the reference sequence. To remove a small number of primer dimers present in some samples, the first 30 nucleotides of each read must match the reference sequence, and reads with mismatches in more than half of the aligned nucleotides are also filtered out. A maximum of 50,000 reads that pass the filter are used for analysis, and reads containing insertions or deletions are counted as indel reads. The minimum QC criterion for the number of reads that pass the filter is 10,000.

[0183] For each target, the indel ratio for each sample and its corresponding template-free control is calculated. This indel ratio refers to the percentage of NGS reads containing indels.

[0184] Biological assay GO enzyme activity and glycolic acid levels were determined as described above. Urinary oxalate levels were measured using intact cell mass spectrometry (ICMS). Briefly, urine was acidified to 300 mM HCl, centrifuged to remove any particulate matter, and typically diluted more than 20-fold with a 13C2-oxalate internal standard (final concentration 5 μmol). Ion chromatography was performed using an ICS-5000+ with an AS-AP refrigerated autosampler (Thermo Fisher), and mass spectrometry was performed using an ISQ-EC (Thermo Fisher).

[0185] result The results showed that mice in the liver Hao1 In vivo gene editing is dose-dependent. Figure 4A ).also, Hao1 Highly efficient in vivo editing leads to an 8-fold or greater induction of glycolic acid ( Figure 4B ) and elimination of GO enzyme activity in the liver ( Figure 4C In addition, editing mice Hao1 Genes lead to a reduction of approximately 40% in urinary oxalate levels, which is associated with urinary oxalate levels falling to therapeutic levels. Figure 4D ).

[0186] Example 4 - AGXT - / - Long-term persistence of HAO1 gene editing, glycolic acid induction, and urinary oxalate levels in mice This example explores Hao1The persistence of indel formation and the pharmacodynamic effects resulting from the composition comprising Cas12i2 B mRNA (SEQ ID NO: 23) and mouse-specific Hao1 gRNA. This composition, loaded in lipid nanoparticles, was administered as a single dose of 1.5 mg / kg for C57BL / 6 alanine glyoxylate aminotransferase knockout (…). Agxt - / - Mice.

[0187] Alanine-glyoxylate aminotransferase (ALT) is a hepatic peroxisome enzyme that catalyzes the transamination of L-alanine and glyoxylate to produce pyruvate and glycine, and is crucial for glyoxylate detoxification. Deficiency of this enzyme leads to primary hyperoxaluria type I. (Pey et al., 2013. Biomed Res Int. 687658.) Agxt - / - Mice showed Agxt The complete loss of both mRNA and protein expression, resulting in hyperoxaluria (a 3- to 4-fold increase in urinary oxalate) compared to littermates (Salido et al., Proc. Natl. Acad. Sci. USA, (2006) 103(48):18249-18254), makes it possible to detect liver-related hyperoxaluria. Hao1 The editing caused a decrease in urinary oxalate.

[0188] Due to the species specificity of the gRNA in the test composition, in vivo studies in mice used a mouse substitute composed of the same LNP A and Cas12i2 B mRNAs, but employing a different gRNA that targets mice. Hao1 Targeting in genes Hao1 The 20-nucleotide sequence of exon 1.

[0189] Research Design and Methods male Agxt - / - Mice were housed under the same conditions as described in Example 3 above. Baseline urine and serum were collected from days 15 to 18. Liver function was assessed. Hao1 Editing and oxalate reduction persistence, towards Agxt - / - Mice were administered the test composition or saline intravenously at a dose of 1.5 mg / kg, and measurements were taken after 3 or 9 months. Hao1 Editing and urinary oxalate. Males aged 14 to 17 weeks (at the time of administration). Agxt - / - Mice were administered the test composition via a single injection behind the eye socket and monitored for 12 months.

[0190] Hao1Gene editing and urinary oxalate levels were analyzed according to the methods disclosed herein. See, for example, Example 3 above.

[0191] result A, Whole liver Indels exist Agxt - / - In mice, after administration of the test composition at a dose of 1.5 mg / kg for 3 months, significant liver damage was observed as measured by NGS. Hao1 Editing was performed, and this level of editing was maintained in these animals when assessed at the 6-month time point. Figure 5A ).

[0192] B Uric acid Treated with physiological saline Agxt - / - Urinary oxalate levels in mice did not change relative to baseline at 3 or 6 months. Figure 5B In the group treated with the test composition at a dose of 1.5 mg / kg, urinary oxalate levels decreased at 3 months, and no further decrease in urinary oxalate levels was observed during the 3 to 6 months following administration. Figure 5B Compared with the saline control, the decrease in urinary oxalate at both time points was statistically significant.

[0193] Example 5 - Disease prevention in juvenile subjects This example assesses liver function as juvenile animals transition into adulthood. Hao1 The persistence of the edit and the prevention of uric acid oxalate accumulation.

[0194] Research Design and Methods In order to assess childhood Agxt - / - The liver of mice during their growth into adulthood Hao1 The persistence of the edit and the reduction of uric acid, towards 3-week-old infants Agxt - / - Mice were administered the test composition intravenously (IV) at a dose of 2.0 mg / kg, and the resulting pharmacodynamic (PD) effects were evaluated. Evaluations were conducted at 1, 5, and 9 weeks post-administration. Hao1 Edited, and measured urinary oxalate only at week 9 in test compositions and in mice treated with saline. Urinary oxalate was measured only at week 9 (12 weeks of age) after administration because adequate urine could not be collected from juvenile animals 3 weeks old before administration at baseline, and disease onset before 12 weeks of age had not been fully characterized.

[0195] To determine via insertion / missing analysis Hao1Gene editing was performed using genomic DNA extracted from primary tissues. Libraries were prepared via two rounds of polymerase chain reaction (PCR), followed by sample pooling, column purification, and sequencing using Illumina. See the example above. To detect low-level editing above the background, windowing analysis was performed using only 20 nucleotides centered on the Cas12i2 cleavage site. In windowing analysis, indels identified by NGS were removed if they were 1 nucleotide in length or did not at least partially overlap with a 20-nucleotide window centered on the predicted non-target strand cleavage site. These filtering steps reduced background signal or signal that might be caused by sequencing errors in the region outside the cleavage site, improving the sensitivity of the analysis. Uric acid oxalate levels were measured using intact cell mass spectrometry (ICMS).

[0196] result A, Whole liver Indels exist Agxt - / - In mice, high levels of [specific irritants] were observed after administration of the test composition at a dose of 2.0 mg / kg for one week. Hao1 Editing, and this level of editing was maintained persistently during 5 and 9 weeks post-application. Figure 6A ). Observations were made between the 1-week, 5-week, and 9-week dosing groups. Hao1 There were no statistically significant differences in the editing process. Figure 6A ).

[0197] B Uric acid Three months after application, compared with that treated with physiological saline Agxt- / - Compared with mice, a statistically significant 55% reduction in urinary oxalate levels was observed in the group administered the test composition at 2.0 mg / kg. Figure 4B ).

[0198] These studies collectively demonstrate that after administration of 2.0 mg / kg, Agxt - / - liver in mice Hao1 The persistence of the edit and the reduction of urinary oxalate. The results of this study indicate that, towards childhood... Agxt - / - Treatment of mice (a mouse model representative of the biological characteristics of PH1 disease) with the test composition resulted in persistent liver damage as the animals entered adulthood. Hao1 Editing and prevention of urinary oxalate accumulation.

[0199] Example 6 - Persistence of Hao1 editing after partial hepatectomy in mice This example explores the mediated reaction by a test composition containing the disclosed Cas12i2 B mRNA and mouse-specific Hao1 gRNA. Hao1 To assess the durability of the edit, the test composition was loaded into lipid nanoparticles and administered at a single dose of 2.0 mg / kg to male C57BL / 6WT mice following intentional liver injury.

[0200] Research Design and Methods Male C57BL / 6 mice aged 6 to 8 weeks were treated with a single retroorbital injection of the test composition at a dose of 2 mg / kg, followed by 30% to 70% hepatectomy or sham surgery 10 days later. Liver biopsy samples were collected during surgery and 28 days after the study endpoint. GO protein expression was assessed in both liver biopsies to detect the persistence of indels and GO protein knockdown mediated by the test composition after sham hepatectomy. Serum albumin (a protein synthesized by hepatocytes) was measured as a marker of liver size before surgery and at the end of the study.

[0201] GOO enzyme activity in liver samples collected at autopsy was assessed using an HPLC-based method. The assay measured glyoxylate levels after the addition of sodium glycolate substrate to liver tissue homogenates. Tissue samples of 25–50 mg were sonicated in lysis buffer containing HEPES and 10% Triton-X. Liver lysates were incubated with a sodium glycolate master mixture (100 mM Tris HCl, 5 mM sodium glycolate) at 37°C for 15 min. After incubation, 5 M PCA was added, the samples were centrifuged for 5 min, and the supernatant was run on HPLC to detect glyoxylate levels. Hao1 The edited samples had lower glyoxylic acid levels because GO (by...) Hao1 The gene-encoded enzyme is responsible for the conversion of glycolic acid to glyoxylic acid.

[0202] result Compared with negative control animals, GO protein expression in the liver was significantly reduced by approximately 88% in surgically removed liver biopsies collected during hepatectomy and in the endpoint liver collected 28 days post-surgery. Figure 7 In animals that underwent hepatectomy, there was no difference in GO protein expression between the resected liver and the final liver.

[0203] This study demonstrates that, in wild-type mice, liver damage caused by HAO1 gene-editing compositions following 30% to 70% hepatectomy can occur. Hao1 The persistence of gene editing and GO protein knockdown was demonstrated. Significant gene editing levels of more than 50% were detected in livers collected during surgery and 28 days post-surgery. Compared with negative control mice, approximately 88% GO protein expression was observed in both biopsies. Moreover, similar levels of serum albumin were detected in both the hepatectomy group and the sham-operated group at both pre-operative and endpoint time points.

[0204] In summary, the data indicate that treatment of WT mice with the HAO1 gene-editing composition produces significant... Hao1 Indels and GO protein knockdown persisted significantly for 28 days after intentional hepatectomy.

[0205] Example 7 - Evaluation of germline transmission in female mouse offspring treated with HAO1-edited compositions This example explores the germline delivery potential of a test composition comprising the disclosed Cas12i2 B mRNA and mouse-specific Hao1 gRNA loaded onto lipid nanoparticles, and measures the delivery of the drug into the offspring of female C57BL / 6 WT mice. Hao1 indel frequency.

[0206] Research Design and Methods Female C57BL / 6 mice (n=38) were administered a single intravenous administration of a test composition containing a mouse-Hao1 gRNA substitute at a dose of 5 mg / kg. This dose was measured in the liver of the mice. Hao1 Five times the saturation dose of the target gene editing. Two weeks after administration, treated female mice were paired with untreated male mice (two females per male). Tail biopsy samples were collected from each pup and genotyped to evaluate... Hao1 Editing. The test composition was confirmed to have pharmacological activity in female mice, with an average concentration in the liver of female mice. Hao1 The edit rate was 56.3%. 583 offspring from 36 drug-treated female mice (each female had 2 to 3 litters) were analyzed to assess the presence of genetically inherited Hao1 indels (the expected indel frequency was 50%, as this frequency indicates that the animals were Hao1 knockdown heterozygous).

[0207] Hao1 Gene editing and urinary oxalate levels were analyzed according to the methods disclosed herein. See, for example, Example 3 above. To detect low-level editing above the background, windowing analysis was performed using only 20 nucleotides centered on the Cas12i2 cleavage site. In windowing analysis, indels at NGS-recognized sites were removed if they were 1 nucleotide in length or did not at least partially overlap with a 20-nucleotide window centered on the predicted non-target strand cleavage site. These filtering steps reduced background signal or signal that might be caused by sequencing errors in the region outside the cleavage site, improving the sensitivity of the analysis.

[0208] result Of the 583 offspring, 0 were positive for maternal germline transmission, and the editing rate for all animals is shown to be <1%. Table 4 provides a summary of the results of germline transmission from maternal mice treated with the test composition to their offspring. This study indicates that, although in the liver of maternal mice... Hao1 Indels were approximately 56.31%, but in the livers of female mice that received the drug were present in... Hao1 Indels are unlikely to be germline transmitted in their offspring. Based on the efficacy analysis performed, this number of assessed offspring had a detection rate of 1.0%. Hao1 The germline transmission frequency assay provides over 99% efficacy, and over 80% efficacy for detecting 0.3% of germline transmission frequencies.

[0209] Table 4. Summary results of germline transfer from female mice edited with the tested compositions to their offspring

[0210] Other embodiments All features disclosed in this specification can be combined in any combination. Each feature disclosed in this specification can be replaced by alternative features serving the same, equivalent, or similar purpose. Therefore, unless otherwise expressly stated, each disclosed feature is merely an example of a general series of equivalent or similar features.

[0211] From the above description, those skilled in the art can readily identify the essential features of the present invention, and various changes and modifications can be made to adapt it to various uses and conditions without departing from its spirit and scope. Therefore, other embodiments are also within the scope of the claims.

[0212] equivalent Although several inventive embodiments have been described and illustrated herein, those skilled in the art will readily conceive of various other means and / or structures for performing the functions and / or obtaining the results and / or one or more advantages described herein, and each such variation and / or modification is considered to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and actual parameters, dimensions, materials, and / or configurations will depend on the specific application or the application to which the teachings of the invention are applied. Those skilled in the art will recognize, or be able to determine, many equivalents of the particular inventive embodiments described herein using no more than conventional experimentation. Therefore, it should be understood that the foregoing embodiments are presented by way of example only, and that inventive embodiments may be practiced in ways other than those specifically described and claimed within the scope of the appended claims and their equivalents. The inventive embodiments of this disclosure pertain to each individual feature, system, article of manufacture, material, kit, and / or method described herein. Furthermore, any combination of two or more such features, systems, articles of manufacture, materials, kits, and / or methods is included within the scope of this disclosure if they do not contradict each other.

[0213] All definitions defined and used herein should be understood to take precedence over dictionary definitions, definitions incorporated in reference to other literature, and / or the general meaning of the defined terms.

[0214] All references, patents and patent applications disclosed herein are incorporated herein by reference for their respective cited subjects, and in some cases may cover the entire literature.

[0215] As used herein in the specification and claims, the indefinite article “a (and an)” shall be understood to mean “at least one” unless expressly indicated otherwise.

[0216] As used herein in the specification and claims, the phrase “and / or” should be understood to mean “any one or both” of the elements so connected, i.e., elements that exist in parallel in some cases and selectively in others. Multiple elements listed with “and / or” should be interpreted in the same way, i.e., “one or more” of the elements so connected. Other elements may optionally be present, whether or not they are related to those specifically specified by the “and / or” clause. Thus, as a non-limiting example, when used in conjunction with open-ended language such as “comprising,” a reference to “A and / or B” may, in one embodiment, mean only A (optionally including elements other than B); in another embodiment, mean only B (optionally including elements other than A); in yet another embodiment, mean both A and B (optionally including other elements); and so on.

[0217] As used herein in the specification and claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” should be interpreted as inclusive, meaning that it includes at least one of the numbers or lists of one or more elements, but also includes more than one, as well as optional additional unlisted items. Only terms that explicitly indicate the opposite, such as “only one” or “exactly one”, or when used in a claim as “consisting of…”, refer to the number of elements or exactly one element in the list. Generally, the term “or” as used herein should be interpreted as indicating an exclusive alternative (i.e., “one or the other, not both”) only when preceded by exclusive terms such as “any,” “one of,” “only one,” or “exactly one”. “Substantially consisting of…” when used in a claim should have its ordinary meaning in the field of patent law.

[0218] As used herein in the specification and claims, the phrase “at least one” when referring to a list of one or more elements should be understood to mean at least one element selected from any one or more elements in the list of elements, but does not necessarily include at least one of each element specifically listed in the list of elements, and does not exclude any combination of elements in the list of elements. This definition also allows for the optional presence of other elements besides those specifically specified in the list of elements referred to by the phrase “at least one,” regardless of their relation to those specifically specified elements. Thus, as a non-limiting example, “at least one of A and B” (or equivalently, “at least one of A and B,” or equivalently, “at least one of A and / or B”) in one embodiment can refer to at least one (optionally including more than one) A, and the absence of B (and optionally including elements other than B); in another embodiment, it refers to at least one (optionally including more than one) B, and the absence of A (and optionally including elements other than A); in yet another embodiment, it refers to at least one (optionally including more than one) A and at least one (optionally including more than one) B (and optionally including other elements); and so on.

[0219] The terms "approximately" or "about" mean within an acceptable range of error for a particular value as determined by a person skilled in the art, depending in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "approximately" can mean within an acceptable standard deviation according to practice in the art. Alternatively, "approximately" can mean a range up to ±20% of a given value, preferably up to ±10% of a given value, more preferably up to ±5% of a given value, and even more preferably, still up to ±1% of a given value. Or, particularly with respect to biological systems or processes, the term can mean within an order of magnitude of a value, preferably within twice the value. When a particular value is described in the specification and claims, the term "approximately" is implied unless otherwise stated, and in this context means within an acceptable range of error for the particular value. In some embodiments, the hinge domain is a hinge domain of a naturally occurring protein.

[0220] It should also be understood that, unless expressly indicated otherwise, in any method claimed herein that includes more than one step or action, the order of the steps or actions of the method is not necessarily limited to the order in which the steps or actions of the method are described.

Claims

1. A composition for gene editing of the hydroxy acid oxidase 1 (HAO1) ​​gene, said composition comprising: (a) a messenger RNA (mRNA) comprising a nucleotide sequence having at least 80% identity with SEQ ID NO: 8, wherein, The mRNA encodes the Cas12i2 polypeptide as shown in SEQ ID NO: 7; (b) a guide RNA (gRNA) comprising the nucleotide sequence of SEQ ID NO: 13; and (c) A lipid excipient comprising 45 to 50 mol% cationic lipids, 9 to 11 mol% zwitterionic phospholipids, 38 to 42 mol% cholesterol, and 2.2 to 2.8 mol% polyethylene glycol-modified lipids, wherein: The cationic lipid has the following structure: Or the cationic lipid is a pharmaceutically acceptable salt or stereoisomer thereof; The polyethylene glycol-modified lipid has the following structure: Where n has an average value of 45 to 49, including extreme values; and The zwitterionic phospholipid is 1,2-distearate-sn-glycerol-3-phosphocholine (DSPC).

2. The composition according to claim 1, wherein, The mRNA contains a nucleotide sequence that is at least 85% identical to SEQ ID NO:

8.

3. The composition according to claim 1, wherein, The mRNA contains a nucleotide sequence that is at least 90% identical to SEQ ID NO:

8.

4. The composition according to any one of claims 1 to 3, wherein, The lipid excipient comprises 47.5 mol% of the cationic lipid, 10 mol% of the zwitterionic phospholipid, 40 mol% of the cholesterol, and 2.5 mol% of the polyethylene glycol-modified lipid.

5. The composition according to any one of claims 1 to 4, wherein, The mRNA contains a 5' cap and a 3' polyadenylated tail.

6. The composition according to any one of claims 1 to 5, wherein, The mRNA contains one or more modified nucleotides, the modified nucleotides containing pseudouridine; optionally, the mRNA contains pseudouridine residues at 75% or more of the uridine positions of the mRNA.

7. The composition according to claim 6, wherein, The mRNA contains pseudouridine residues at all uridine sites in the mRNA.

8. The composition according to any one of claims 1 to 7, wherein, The mRNA contains the nucleotide sequence of SEQ ID NO:

23.

9. The composition according to claim 8, wherein, The mRNA contains a 5' cap portion and contains pseudouridine residues at all uridine sites in the mRNA.

10. The composition according to any one of claims 1 to 9, wherein, The gRNA contains one or more modifications.

11. The composition according to claim 10, wherein, The gRNA contains a phosphate thioester bond and 2'-O-methylation.

12. The composition according to claim 11, wherein, The modification is located at the 5' nucleotide and / or 3' nucleotide.

13. The composition according to claim 1, wherein, The gRNA contains the nucleotide sequence of SEQ ID NO:

14.

14. The composition according to any one of claims 1 to 13, wherein, The nitrogen:phosphorus (N / P) ratio in the composition is in the range of 3 to 9.

15. The composition according to claim 14, wherein, The N / P ratio in the composition is 6.0 ± 1.

0.

16. The composition according to claim 15, wherein, The N / P ratio of the composition is 6.0 ± 0.

5.

17. The composition according to claim 15, wherein, The N / P ratio of the composition is approximately 6.

0.

18. The composition according to any one of claims 1 to 17, wherein, The mRNA:gRNA ratio was 1.0 ± 20%.

19. The composition according to claim 18, wherein, The ratio of mRNA to gRNA is approximately 1.

0.

20. A method for gene editing the hydroxy acid oxidase 1 (HAO1) ​​gene in a subject, the method comprising: Administer an effective amount of the composition for gene editing the HAO1 gene as described in any one of claims 1 to 19 to a subject in need.

21. The method according to claim 20, wherein, The subjects were human subjects suffering from primary hyperoxaluria (PH).

22. The method according to claim 21, wherein, The human subjects had PH1.

Images