Anti-inflammatory and antioxidant composition containing ergothioneine and uses thereof

Abstract

This invention discloses an anti-inflammatory and antioxidant composition containing ergothioneine and its applications, belonging to the field of biomedical technology. The active ingredients of this anti-inflammatory and antioxidant composition include ergothioneine and rosmarinic acid or hesperidin. The two components have complementary pathways, respectively targeting the intracellular mitochondrial antioxidant and NF-κB inflammatory pathways, forming a bidirectional synergistic regulatory network to produce a strong synergistic effect. Simultaneously, it can synergistically inhibit LPS-induced expression of NO and pro-inflammatory factors in macrophages, synergistically enhance the body's antioxidant capacity, reduce lipid peroxidation levels, inhibit intracellular ROS accumulation, and effectively alleviate cell damage caused by inflammation and oxidative stress. The combination index (CI) of this composition can be as low as 0.05, with efficacy far superior to single-drug superposition. Furthermore, it can reduce the effective dose of ergothioneine by approximately 66.7%, significantly improving anti-inflammatory and antioxidant efficacy while avoiding cell stress damage caused by high concentrations of monomers, thus possessing multiple advantages including enhanced efficacy, optimized drug administration safety, and reduced raw material costs.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an anti-inflammatory and antioxidant composition containing ergothioneine and its application. Background Technology

[0002] Inflammation is a complex and orderly defense response of the body to infection, tissue damage, or stress, typically involving the activation of immune cells, the release of inflammatory factors, and the generation of oxidative stress. However, excessive or uncontrolled inflammatory responses can lead to tissue damage and are one of the core pathological mechanisms in the development of various diseases such as sepsis, acute liver injury, arthritis, cardiovascular disease, and neurodegenerative diseases. Meanwhile, oxidative stress is closely related to the inflammatory process; excessive production of reactive oxygen species (ROS) not only directly damages cells but also activates pro-inflammatory signaling pathways, exacerbating the inflammatory response. Therefore, drug strategies with both anti-inflammatory and antioxidant activities are considered an effective approach to treating such diseases.

[0003] Ergothioneine is a naturally occurring sulfur-containing amino acid derivative. Its unique physicochemical properties allow it to efficiently enter cells via the OCTN1 transporter, primarily distributed in mitochondria and other regions prone to oxidative stress, where it plays a key role in scavenging intracellular reactive oxygen species and protecting mitochondrial function. However, ergothioneine itself does not possess the ability to directly regulate classical inflammatory signaling pathways (such as the NF-κB pathway). Its anti-inflammatory effect mainly relies on indirect relief of oxidative stress. When used alone, its inhibitory effect on pro-inflammatory factors such as TNF-α, IL-6, and IL-1β is limited, and high doses are required to achieve the desired antioxidant effect. The balance between safety and efficacy under high-dose conditions remains unclear, limiting its clinical application.

[0004] Polyphenols are a large class of plant secondary metabolites containing multiple phenolic hydroxyl groups. Common natural polyphenols, such as rosmarinic acid, flavonoids, tea polyphenols, hesperetin, and hesperidin, have been shown to possess certain anti-inflammatory activities, directly downregulating the expression of pro-inflammatory genes by inhibiting NF-κB pathway activation. However, the antioxidant effects of rosmarinic acid and hesperidin are mainly limited to scavenging existing reactive oxygen species or chelating metal ions. They primarily clear existing ROS directly on the extracellular or cell membrane surface and cannot exert mitochondrial protective effects through specific transport proteins like ergothionein. Therefore, their ability to regulate intracellular oxidative stress is significantly insufficient.

[0005] This demonstrates that ergothioneine and polyphenols such as rosmarinic acid / hesperidin each possess functional defects: the former exhibits insufficient anti-inflammatory activity, while the latter suffers from insufficient intracellular antioxidant activity. Theoretically, there is a possibility of functional complementarity between the two, but current research generally suggests that ergothioneine, as a strongly reducing sulfur-containing amino acid derivative, readily undergoes redox reactions or forms complexes with polyphenols, leading to mutual cancellation or even antagonism of their activities. Therefore, there is a lack of technical motivation in this field to combine ergothioneine with rosmarinic acid or hesperidin, and the possibility of achieving functional defect complementarity and synergistic effects across dual pathways through their combined use has not been anticipated.

[0006] Currently, no existing technology recognizes the functional complementarity between ergothioneine and polyphenols such as rosmarinic acid / hesperidin, nor has any publicly disclosed technical solution achieved through combined drug use to achieve a synergistic effect of "intracellular antioxidant + extracellular / membrane surface anti-inflammatory" dual pathways. Developing natural compound compositions with synergistic effects, reducing the dosage of single components, and minimizing cellular stress damage caused by high-concentration raw materials has significant clinical and industrial value for the development of drugs and functional foods related to inflammation and oxidative stress. Summary of the Invention

[0007] This invention aims to address the technical shortcomings of existing natural antioxidant and anti-inflammatory monomers, such as single efficacy, high effective dose, and lack of synergistic effects. It provides a natural anti-inflammatory and antioxidant composition with bidirectional synergistic anti-inflammatory and antioxidant functions, and its novel applications. This anti-inflammatory and antioxidant composition is not simply a "combination of active ingredients," but rather a combination with "specific synergistic" effects discovered after systematically screening various structurally similar and functionally related natural anti-inflammatory and antioxidant products. Within a safe concentration range, this composition can achieve synergistic effects through dual pathways of anti-inflammation and anti-oxidation, with a synergistic index (CI) < 1, significantly superior to the combined effects of single-drug therapy.

[0008] This invention provides an anti-inflammatory and antioxidant composition, the active ingredients of which include ergothioneine and polyphenols, and the combination index CI of ergothioneine and the polyphenols is <1, the two synergistically regulating the antioxidant pathway and the NF-κB inflammatory pathway; wherein the polyphenols are rosmarinic acid or hesperidin.

[0009] Furthermore, the active ingredient comprises ergothioneine and rosmarinic acid in a molar ratio of 1:2 to 1:8, such as 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, etc. Preferably, the active ingredient consists of ergothioneine and rosmarinic acid in a molar ratio of 1:3 to 1:6; more preferably, the optimal molar ratio is 1:5. The safe molar concentration of this active ingredient for inflammatory cells and hepatocytes is ≤96 μM; that is, the total molar concentration of ergothioneine and rosmarinic acid is ≤96 μM.

[0010] Furthermore, the active ingredient comprises ergothioneine and hesperidin in a molar ratio of 2:1 to 2:5, such as 2:1, 2:2, 2:3, 2:4, 2:5, etc. Preferably, the active ingredient consists of ergothioneine and hesperidin in a molar ratio of 2:2 to 2:4; more preferably, the optimal molar ratio is 2:3. The safe molar concentration of this active ingredient for inflammatory cells and hepatocytes is ≤80 μM; that is, the total molar concentration of ergothioneine and hesperidin is ≤80 μM.

[0011] This invention also provides the application of the above-mentioned anti-inflammatory and antioxidant composition in the preparation of anti-inflammatory and antioxidant drugs, health products, antioxidant health products, food additives, or feed additives. The anti-inflammatory and antioxidant drug is a drug for preventing and / or treating diseases related to lipopolysaccharide (LPS)-induced inflammatory damage and hydrogen peroxide-induced oxidative stress damage. More preferably, the anti-inflammatory and antioxidant drug is a drug for improving diseases related to acute inflammatory embryonic damage. Furthermore, the optimal effective dosage concentration of the anti-inflammatory and antioxidant composition is: 16 μM ergothioneine + 80 μM rosmarinic acid (total concentration 96 μM, molar ratio 1:5) and 16 μM ergothioneine + 24 μM hesperidin (total concentration 40 μM, molar ratio 2:3). Compared to the anti-inflammatory effect of 48 μM ergothioneine monomer at the highest safe dose, the compound system achieves far superior anti-inflammatory and antioxidant activity with only 16 μM ergothioneine, directly reducing the amount of ergothioneine used by 66.7%. This significantly reduces the cost of expensive ergothioneine raw materials while achieving a leapfrog improvement in efficacy.

[0012] This composition leverages the synergistic effects of mitochondrial-targeted antioxidant and NF-κB inflammatory signaling blockade pathways to achieve potent anti-inflammatory and antioxidant effects without requiring high-dose administration of a single active ingredient. This reduces overall production costs and avoids the stress side effects of high-concentration ergothioneine, such as intracellular redox homeostasis imbalance and decreased cell activity. It achieves multiple technological advantages: enhanced efficacy, reduced raw material usage, and improved drug safety. The specific pharmacological effects of the synergistic combination of ergothioneine and polyphenolic components include: inhibiting LPS-stimulated macrophage NO release and downregulating the mRNA expression of various pro-inflammatory factors; enhancing overall cellular antioxidant levels, alleviating lipid peroxidation damage, and inhibiting the excessive accumulation of intracellular reactive oxygen species (ROS); and significantly alleviating cell damage and embryonic developmental damage mediated by both oxidative stress and inflammation.

[0013] Compared with the prior art, the technical solution provided by the present invention has the following characteristics:

[0014] Discovery of Specific Synergistic Combinations: This invention systematically screened the effects of combining various natural products with anti-inflammatory / antioxidant activities (hesperidin, glycyrrhizic acid, etc.) with ergothioneine (see Example 1). Surprisingly, only ergothioneine with rosmarinic acid and ergothioneine with hesperidin at specific ratios showed strong synergistic effects (CI values ​​as low as 0.16 and 0.05, respectively), while structurally similar hesperidin and functionally related glycyrrhizic acid showed no synergy or antagonism when combined with ergothioneine (CI>1). This result indicates that the synergistic effect of this invention has unpredictable combination specificity. More importantly, as a strong reducing thiol compound, ergothioneine has been subject to limited technical motivation in those skilled in the art due to concerns about potential redox interactions with polyphenols. This invention experimentally demonstrates that specific combinations not only do not produce activity cancellation but also achieve strong synergistic effects, thus successfully overcoming technical biases in the field.

[0015] Achieving a dual-pathway synergistic mechanism of "intramural antioxidation + extracellular / membrane surface anti-inflammation": Ergothioneine specifically enters cells via the OCTN1 transporter (Organic Cation / Carnitine Transporter 1), accumulating in high-oxidative stress regions such as mitochondria, primarily targeting intracellular ROS clearance and mitochondrial function protection; Rosmarinic acid and hesperidin act on the extracellular or cell membrane surface, directly downregulating the expression of pro-inflammatory genes such as TNF-α, IL-6, and IL-1β by inhibiting NF-κB signaling pathway activation. Ergothioneine and the aforementioned polyphenols act at different levels and target different sites, respectively targeting the intracellular mitochondrial antioxidation and NF-κB inflammatory pathways, without interference and with complementary functions, forming for the first time a spatially layered dual-pathway synergistic regulatory network, overcoming the limitations of traditional single-target or single-pathway drugs. It forms a two-layer synergistic regulatory network of intracellular antioxidant defense and cell membrane inflammatory signal blocking, which solves the shortcomings of traditional single antioxidant or single anti-inflammatory active ingredients that have single intervention targets and are difficult to block the vicious cycle of inflammation-oxidative stress.

[0016] Achieving synergistic effects, reduced dosage and improved quality, and optimized safety: The anti-inflammatory and antioxidant composition provided by this invention can reduce the effective dosage of ergothioneine from 48 μM (critical safety concentration) when used alone to 16 μM after compounding (performance test (3) combined concentration), a dosage reduction of about 66.7%, while simultaneously improving the synergistic anti-inflammatory effect by 2-3 times (CI value from >1 to <0.05). This not only reduces the cost of raw materials but also avoids the risk of stress damage such as intracellular redox imbalance and decreased cell viability caused by long-term use of high-concentration monomers, ultimately achieving the triple technical advantages of improved efficacy, reduced raw material dosage, and improved drug administration safety. Animal experiments have shown that the anti-inflammatory and antioxidant composition provided by this invention can significantly improve acute inflammatory embryonic damage and significantly inhibit the overexpression of inflammatory factors in the body, exerting a synergistic anti-inflammatory effect in vivo.

[0017] In addition, the raw materials of the anti-inflammatory and antioxidant composition provided by this invention are all natural and safe active substances with good biocompatibility, extremely low cytotoxicity, and high industrialization safety; at the same time, it improves the triple pathological changes of inflammatory factor release, oxidase system disorder, and cell apoptosis damage, and has a novel intervention strategy for diseases coupled with inflammation and oxidative stress. Attached Figure Description

[0018] Figure 1 The synergistic effect screening results (CI value analysis) of E (ergothioneine) combined with R (rosmarinic acid), hesperidin, hesperidin and glycyrrhizic acid are shown in the figure.

[0019] Figure 2 The figure shows the results of the safe concentration determination of ergothioneine, rosmarinic acid, and hesperidin in RAW264.7 cells using the CCK8 assay.

[0020] Figure 3 Figure 1 shows the results of the safe concentration determination of ergothionein, rosmarinic acid, and hesperidin in AML12 cells using the CCK8 assay.

[0021] Figure 4 The figure shows the effects of the E+R (ergothioneine + rosmarinic acid) combination and the E+Hs (ergothioneine + hesperidin) combination on LPS-induced NO production in RAW264.7 cells.

[0022] Figure 5 Figure 1 shows the results of RT-qPCR detection of the effects of E+R and E+Hs combinations on LPS-induced expression of pro-inflammatory cytokines (TNF-α, IL-6, IL-1β) mRNA in RAW264.7 cells;

[0023] Figure 6 Figure showing the results of CCK8 assay for the protective effects of E+R combination and E+Hs combination against LPS-induced RAW264.7 cell death and H2O2-induced AML12 cell death.

[0024] Figure 7 The figure shows the effects of the E+R combination and the E+Hs combination on H2O2-induced oxidative stress indicators (T-AOC, MDA, SOD, GSH-PX) in AML12 cells.

[0025] Figure 8 Figure 1 shows the effect of flow cytometry E+R combination and E+Hs combination on ROS levels in H2O2-induced AML12 cells.

[0026] Figure 9 The effects of the E+R combination and the E+Hs combination on the relief of CuSO4-induced inflammation in zebrafish larvae.

[0027] Among them, the above Figure 2-9 The asterisk (*) indicates p < 0.05, the ** indicates p < 0.01, the *** indicates p < 0.001, and the **** indicates p < 0.0001. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Unless otherwise specified, all experimental materials used in this invention are commercially available, and all experimental methods are conventional methods unless otherwise specified.

[0029] The endpoints and any values ​​of the ranges disclosed in this invention are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this invention.

[0030] Unless otherwise specified, the terms used in this invention are all commonly used terms in the relevant field. The methods used in each embodiment, such as real-time quantitative RT-qPCR detection, anti-inflammatory and antioxidant performance characterization and detection, are all conventional methods well known to those skilled in the art unless otherwise specified. The raw materials and equipment used can be obtained from publicly available commercial channels.

[0031] All cells, culture media, reagents, kits, antibodies, consumables, and detection instruments used in this invention are commercially available products. Routine cell culture was performed using DMEM high-glucose complete medium supplemented with 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. The culture environment was a 37 ℃, 5% CO2, saturated humidity incubator. All experiments were independently replicated at least three times, with multiple replicates per group. Experimental data are expressed as mean ± standard deviation. Statistical analysis was performed using SPSS software. One-way ANOVA was used for comparisons among multiple groups, with p < 0.05 considered statistically significant.

[0032] Example 1: Screening of drug combinations with synergistic anti-inflammatory activity

[0033] RAW264.7 cells (mouse mononuclear macrophage leukemia cells) in the logarithmic growth phase were harvested and used at a concentration of (5 × 10⁻⁶) 5 (Number of samples / well) were inoculated into 96-well culture plates. Different concentration gradients of ergothioneine (E) in the 0-100 μM range were set up as combined treatment groups with rosmarinic acid (R), hesperidin (Hs), hesperidin (Ht), and glycyrrhizic acid (G) in the 0-200 μM range, as well as treatment groups for each compound alone. LPS at a final concentration of 100 ng / mL was added to each well, along with the corresponding concentration of the drug combination or single drug. The plates were co-cultured at 37°C and 5% CO2 for 24 h. The NO content in the supernatant of each well was determined using the Griess method. The Combination Index (CI) for each combination was calculated using CompuSyn software. The criteria were: CI < 1 for synergistic effect, CI = 1 for additive effect, and CI > 1 for antagonistic effect. In this example, the CI values ​​are the average values ​​obtained from three independent parallel experiments.

[0034] Initial screening of the four compound systems was conducted at full concentration and full molar ratio. The experimental results are shown in […]. Figure 1 , Figure 1 This is a scatter plot showing the CI values ​​under all dosing conditions in this initial screening experiment. It is mainly used for qualitative assessment of the overall synergistic stability of the combination. The dosing concentrations for each individual data point are not labeled. Figure 1 This is only used for qualitative presentation of the overall distribution of CI in each group. Figure 1The results show that within the range of ratios covered in this initial screening, the test points for ergothioneine + rosmarinic acid (blue circles) and ergothioneine + hesperidin (green triangles) all fell below the CI=1 reference line, indicating a stable synergistic effect. However, some scattered points for ergothioneine + glycyrrhizic acid (red squares) and ergothioneine + hesperidin (purple inverted triangles) were above the CI=1 reference line, indicating no stable synergistic anti-inflammatory effect. Therefore, ergothioneine + rosmarinic acid and ergothioneine + hesperidin were selected for subsequent ratio optimization experiments.

[0035] Further preliminary experiments were conducted on the two positive combinations using a gradient molar ratio to screen for ratios that could produce synergistic anti-inflammatory effects. The results are shown in Table 1, which contains all the ratio data obtained in this preliminary experiment (some extreme ratios were not tested in the initial screening shown in Figure 1). The effective synergistic range was defined as a molar ratio of ergothioneine to rosmarinic acid of 1:2–1:8 and a molar ratio of ergothioneine to hesperidin of 2:1–2:5. When the ratios deviated from these ranges, the synergistic effect of the combination was significantly weakened until it disappeared completely. Among them, the representative CI values ​​for the E and R ratios at the endpoints of the range, 1:2 and 1:8, were 0.71 and 0.82, respectively, both less than 1, indicating a weak synergistic effect. When the ratio was adjusted to 1:10 outside the range, the CI value was 1.18, showing antagonistic effects. When the E:Hs ratio was 2:1 and 2:5 at the endpoints of the interval, the representative CI values ​​were 0.74 and 0.85, respectively, indicating a weak synergistic effect with CI < 1. When the ratio was adjusted to 2:6 at the outer end of the interval, the CI value was 1.21, showing no synergistic anti-inflammatory effect. Among them, the ergothioneine + rosmarinic acid combination with a molar ratio of 1:5 (representative concentrations: ergothioneine 16 μM, rosmarinic acid 80 μM) and the ergothioneine + hesperidin combination with a molar ratio of 2:3 (representative concentrations: ergothioneine 16 μM, hesperidin 24 μM) synergistically inhibited LPS-induced NO production in RAW264.7 cells, with the best synergistic effect.

[0036] Table 1. Representative combination drug index and synergistic effect determination of compositions with different molar ratios

[0037] Ergothioneine + Rosmarinic acid 1:1 (Exceeds the minimum value, insufficient rosmarinic acid content) 1.09 Antagonism Ergothioneine + Rosmarinic acid 1:2 (left end of the interval) 0.71 Weak collaboration Ergothioneine + Rosmarinic acid 1:3 0.44 Medium-level coordination Ergothioneine + Rosmarinic acid 1:5 (optimal ratio) 0.16 Strong synergy Ergothioneine + Rosmarinic acid 1:6 0.31 Medium-level coordination Ergothioneine + Rosmarinic acid 1:8 (right end of the interval) 0.82 Weak collaboration Ergothioneine + Rosmarinic acid 1:10 (outside the interval) 1.18 Antagonism Ergothionein + Hesperidin 2:1 (left end of the interval) 0.74 Weak collaboration Ergothionein + Hesperidin 2:2 0.24 Medium-level coordination Ergothionein + Hesperidin 2:3 (optimal ratio) 0.05 Strong synergy Ergothionein + Hesperidin 2:4 0.47 Medium-level coordination Ergothionein + Hesperidin 2:5 (right end of the interval) 0.85 Weak collaboration Ergothionein + Hesperidin 2:6 (outside the interval) 1.21 Antagonism

[0038] It is evident that not all combinations of ergothioneine with any anti-inflammatory or antioxidant substances can produce synergistic effects; the two combinations selected in this invention possess specific synergistic effects.

[0039] Performance test (1): Determination of safe concentration of the composition in RAW264.7 cells

[0040] RAW264.7 cells (a mouse-derived monocyte / macrophage cell line) in the logarithmic growth phase were harvested at a concentration of 2 × 10⁻⁶ cells / cells. 4Cells were seeded per well in 96-well plates. Different concentrations of ergothioneine, rosmarinic acid, and hesperidin were added within the range of 0-320 μM, along with combinations of E+R and E+Hs. The E+R combination had a fixed molar ratio of ergothioneine:rosmarinic acid = 1:5, and the E+Hs combination had a fixed molar ratio of ergothioneine:hesperidin = 2:3. The combined concentrations were the total molar concentrations of the compositions, and a concentration gradient of 0-320 μM was established. Untreated RAW264.7 cells served as the control group. After culturing for 24 h, cell viability was assessed using the CCK-8 assay. Assay procedure: 10 μL of CCK-8 reagent was added to each well, and the cells were incubated in the dark for 2 h. The absorbance at 450 nm was measured using a microplate reader. Cell viability ≥90% was considered within the safe dosing range.

[0041] The results are as follows Figure 2 As shown: when the concentration of ergothioneine was ≤48 μM, the cell viability was not significantly different from that of the blank control group (p>0.05). When the concentration reached 96 μM, cell viability decreased, exceeding the safe dosing range. When the concentration of rosmarinic acid was ≤96 μM, the cell viability was not significantly different from that of the control group. When the concentration increased to 192 μM, cell viability decreased significantly. When the concentration of hesperidin was ≤40 μM, it was within the safe dosing range. When the concentration reached 80 μM, cell viability decreased significantly.

[0042] When the total molar concentration of the ergothioneine:rosmarinic acid = 1:5 composition was ≤96 μM, the cell viability was not significantly different from that of the control group, which was within the safe dosing range; cell viability decreased significantly after the total concentration reached 192 μM.

[0043] When the total molar concentration of the ergothioneine:hesperidin = 2:3 composition was ≤80 μM, the cell viability was not significantly different from that of the control group, which was within the safe dosing range; when the total concentration reached 160 μM, cell viability decreased significantly.

[0044] The above concentration range represents the safe usage concentrations of each monomer and its corresponding composition in RAW264.7 cells. At the same total administered concentration, the compound formulation exhibits better cell tolerance than high-concentration monomer administration, avoiding cellular stress damage caused by high monomer concentrations and demonstrating superior safety.

[0045] Performance test (2): Determination of safe concentration of the composition in AML12 cells

[0046] Take AML12 cells (mouse hepatocytes) in the logarithmic growth phase, and administer at a dose of 2 × 10⁻⁶. 4Cells were seeded per well in 96-well culture plates. Different concentrations of ergothioneine, rosmarinic acid, and hesperidin were added within the range of 0-320 μM; the E+R fixed molar ratio was 1:5, and the E+Hs fixed molar ratio was 2:3. A gradient of total concentration of the combined agents was set from 0-320 μM for the combined agent group. Untreated AML12 cells served as the control group. After culturing for another 24 h, cell viability was assessed using the CCK-8 assay. The detection method and safety range determination criteria were the same as in Example 2.

[0047] The results are as follows Figure 3 As shown, cell viability declined significantly at higher concentrations for each single drug. Hesperidin at ≤160 μM, ergothioneine at ≤96 μM, and rosmarinic acid at ≤192 μM maintained normal cell viability in AML12 cells, falling within safe dosing ranges. In the combination therapy groups, cell viability remained normal at ≤96 μM for the ergothioneine:rosmarinic acid 1:5 composition (total molar concentration) and ≤80 μM for the ergothioneine:hesperidin 2:3 composition (total molar concentration), indicating safe administration. Subsequent efficacy experiments were conducted within the safe concentration ranges determined in this embodiment, and the observed anti-inflammatory and antioxidant effects can exclude interference from decreased cell viability in the test results.

[0048] Performance test (3): Effect of the composition on LPS-induced NO production in RAW264.7 cells

[0049] RAW264.7 cells in the logarithmic growth phase were harvested at a concentration of 5 × 10⁻⁶ cells. 5 One sample per well was inoculated into a 96-well culture plate. Control group, LPS model group (100 ng / mL LPS), single-drug groups, E+R combination group (16 μM ergothioneine (E) + 80 μM rosmarinic acid (R) molar ratio 1:5), and E+Hs combination group (16 μM ergothioneine (E) + 24 μM hesperidin (Hs) molar ratio 2:3; all concentrations used were within the safe concentration range determined in Example 2). Each group was treated with 100 ng / mL LPS and the corresponding drug for 24 h. The supernatant was collected, and the NO content was detected using a kit method. The results are as follows: Figure 4 As shown. Detection method: Take 50 μL of cell supernatant, add an equal volume of Griess reagent, react at room temperature in the dark for 10 min, and detect the absorbance at 550 nm using an ELISA reader. Calculate the NO content using the sodium nitrite standard curve. NO inhibition rate calculation formula: NO inhibition rate (%) = (NO content in LPS model group - NO content in drug treatment group) / (NO content in model group - NO content in blank group) × 100%.

[0050] Figure 4The study demonstrated the inhibitory effects of various concentration combinations on NO production. Compared with the control group, the LPS model group showed a significant increase in NO production (p<0.001). Compared with the LPS model group, ergothioneine, rosmarinic acid, or hesperidin alone could reduce NO levels to some extent, while E+R and E+Hs showed significantly better inhibitory effects on NO production than the individual compounds used alone (p<0.01 or p<0.001).

[0051] Using the above-mentioned E+R combination group (16 μM ergothioneine + 80 μM rosmarinic acid) as the target for analysis, the total molar concentration of this combination was 96 μM. If a monomer control was set up directly according to the same total concentration, 96 μM of ergothioneine alone would exceed the safe dosing range defined in Example 2, which would cause a significant decrease in cell viability, induce cell damage, and cause a false decrease in NO detection value, failing to reflect the true anti-inflammatory activity. Therefore, the maximum safe dosing concentration of ergothioneine monomer, 48 μM, was selected for single-drug efficacy evaluation. The inhibition rate of 48 μM ergothioneine alone was 30.95%; 96 μM rosmarinic acid was within the safe dosing range for cells, without abnormal interference from cell viability, and the inhibition rate of 96 μM rosmarinic acid alone was 29.76%; the actual inhibition rate of 16 μM ergothioneine + 80 μM rosmarinic acid combination reached 79.76%, which was significantly higher than the effects of ergothioneine and rosmarinic acid monomers administered alone (p < 0.001), showing a strong synergistic effect.

[0052] Using the above-mentioned E+Hs combination group (16 μM ergothioneine + 24 μM hesperidin) as the target for analysis, based on the cell viability test results of Example 2, both 40 μM ergothioneine and 40 μM hesperidin were at their respective safe dosing concentrations. Single-drug efficacy controls were set up accordingly. The inhibition rate of 40 μM ergothioneine alone was 25.59%, and the inhibition rate of 40 μM hesperidin alone was 27.91%. However, the actual inhibition rate of the combination of 16 μM ergothioneine and 24 μM hesperidin reached 81.40%, which was significantly higher than the theoretical summation value of the two monomers at high doses alone (p < 0.001), demonstrating a strong synergistic effect.

[0053] Therefore, the above results indicate that the E+R and E+Hs compositions both have synergistic inhibitory activity against NO production, and the synergistic effect is not a simple additive effect.

[0054] Performance test (4): Effect of the composition on LPS-induced expression of pro-inflammatory factors in RAW264.7 cells

[0055] RAW264.7 cells in the logarithmic growth phase were harvested and processed at a rate of 2 × 10⁻⁶ cells / year. 6Cells were seeded per well in 6-well culture plates. Grouping and drug treatment were the same as in performance test (3). Each group was treated with 100 ng / mL LPS and the corresponding drug for 24 h. Cells were collected, total RNA was extracted, and reverse transcribed into cDNA. The relative mRNA expression levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-1β (IL-1β) were detected using real-time quantitative PCR (RT-qPCR). The results are as follows: Figure 5 As shown in Table 2, β-actin was used as the internal reference gene, and the primers for detecting the gene are shown in Table 2.

[0056] Table 2 Primers for quantitative real-time gene detection

[0057] IL-6-F Seq. No. 1 CCAAGAGGTGAGTGCTTCCC IL-6-R Seq. No. 2 CTGTTGTTCAGACTCTCTCCCT TNF-α-F Seq. No. 3 CTGAACTTCGGGGTGATCGG TNF-α-R Seq. No. 4 GGCTTGTCACTCGAATTTTGAGA IL-1β-F Seq. No. 5 GAAATGCCACCTTTTGACAGTG IL-1β-R Seq. No. 6 TGGATGCTCTCATCAGGACAG β-actin-F Seq. No. 7 TCACTATTGGCAACGAGCGGTTC β-actin -R Seq. No. 8 CAGCACTGTGTTGGCATAGAGGTC

[0058] Figure 5 The results showed that LPS stimulation significantly increased the mRNA expression levels of TNF-α, IL-6, and IL-1β (p < 0.001). Compared with the single-drug groups, the E+R combination and the E+Hs combination more significantly reduced the expression levels of the above three pro-inflammatory factors (p < 0.05 or p < 0.01), indicating that the compositions have synergistic inhibitory activity against the expression of pro-inflammatory factors.

[0059] Performance test (5): Protective effect of the composition against LPS / H2O2-induced cell death

[0060] RAW264.7 and AML12 cells in the logarithmic growth phase were harvested and processed at a ratio of 2 × 10⁻⁶ cells / cells. 4 Cells were seeded per well in 96-well culture plates. For RAW264.7 cells, the grouping and drug treatment were the same as in performance experiment (3), with LPS and corresponding drugs added for 24 h. For AML12 cells, control group, H2O2 model group (200 μM H2O2), single drug groups, and combination groups were set up, with H2O2 and corresponding drugs added for 24 h. 100 ng / mL LPS and 200 μM H2O2 were the optimal modeling concentrations obtained from the preliminary experiments. After treatment, cell viability in each well was detected by the CCK-8 assay. The detection method and cell viability calculation method were the same as in Example 2.

[0061] The results are as follows Figure 6 As shown, both LPS and H2O2 treatments significantly reduced cell survival (p < 0.001). Compared with individual administration, the E+R combination and the E+Hs combination more effectively improved cell survival under both stimulation conditions (p < 0.05 or p < 0.01), indicating that the composition can synergistically alleviate LPS-induced inflammatory cell death and H2O2-induced oxidative cell damage.

[0062] Performance test (6): Effect of the composition on H2O2-induced oxidative stress indices in AML12 cells

[0063] Take AML12 cells in the logarithmic growth phase and administer at a ratio of 5 × 10⁻⁶. 5 Cells were seeded per well in 96-well culture plates. A control group, an H2O2 model group (200 μM H2O2), and single-drug and combination groups were set up (see performance test (3)). H2O2 and the corresponding drugs were added and treated for 24 h. Cells were collected, sonicated, centrifuged at low temperature, and the supernatant was collected. Total antioxidant capacity (T-AOC), malondialdehyde (MDA) content, superoxide dismutase (SOD) activity, and glutathione peroxidase (GSH-PX) activity were detected using commercially available kits, following the kit instructions.

[0064] The results are as follows Figure 7 As shown, compared with the H2O2 model group, each treatment group improved the above-mentioned oxidative stress indicators to varying degrees. Compared with the single-drug groups, the E+R combination and the E+Hs combination significantly increased T-AOC, SOD and GSH-PX activities, and significantly reduced MDA content (p < 0.05 or p < 0.01), indicating that the composition has a synergistic effect in enhancing cellular antioxidant defense and reducing lipid peroxidation damage.

[0065] Performance test (7): Effect of the composition on ROS levels in H2O2-induced AML12 cells

[0066] Take AML12 cells in the logarithmic growth phase and administer at a ratio of 5 × 10⁻⁶. 5 Cells were seeded per well in a 96-well culture plate. Grouping and drug treatment were the same as in performance test (3). After treatment, the supernatant was discarded, and DCFH-DA fluorescent probe (final concentration 10 μM) was added. The cells were incubated at 37°C in the dark for 30 min. Cells were washed 2-3 times with PBS. The entire process was carried out in the dark to avoid fluorescence quenching. Fluorescence intensity was detected using a fluorescence microplate reader (excitation wavelength 488 nm, emission wavelength 525 nm) to reflect the level of reactive oxygen species (ROS) in the cells. The relative ROS level of each group was calculated with the fluorescence intensity of the normal control group as a reference.

[0067] The results are as follows Figure 8 As shown, H2O2 stimulation led to a sharp increase in intracellular ROS levels (p<0.001). Treatment with ergothioneine, rosmarinic acid, or hesperidin alone could reduce ROS levels to some extent, while the E+R combination and the E+Hs combination showed more significant inhibitory effects, reducing ROS levels to near the control group level (p<0.001), indicating that the compositions have synergistic activity in scavenging or inhibiting intracellular ROS production.

[0068] Example 2: The effect of the composition in alleviating CuSO4-induced inflammation in zebrafish larvae

[0069] Zebrafish fertilized eggs (embryos) at 10 hpf after fertilization were selected and randomly divided into blank control group, model group, ergothioneine monotherapy group, rosmarinic acid monotherapy group, hesperidin monotherapy group, ergothioneine + rosmarinic acid combination group (E+R), and ergothioneine + hesperidin combination group (E+Hs). The model group and each drug treatment group were treated with copper sulfate embryo culture medium at a final concentration of 10 μg / mL and incubated at 28.5℃ in the dark for 2–4 h to construct an acute inflammatory embryonic injury model. During copper sulfate modeling, the corresponding single drug or compound composition was added to each drug treatment group simultaneously for co-incubation. The drug concentrations for each group were set as follows: ergothioneine single drug final concentration 48 μM (maximum safe dosing concentration of the single drug), rosmarinic acid single drug final concentration 96 μM, hesperidin single drug final concentration 40 μM; the ergothioneine + rosmarinic acid combination group was administered at a molar ratio of 1:5 (ergothioneine 16 μM + rosmarinic acid 80 μM, total molar concentration of the composition 96 μM); the ergothioneine + hesperidin combination group was administered at a molar ratio of 2:3 (ergothioneine 16 μM + hesperidin 24 μM, total molar concentration of the composition 40 μM). The blank control group was incubated simultaneously with an equal volume of pure embryo culture medium.

[0070] After modeling, the culture medium containing copper sulfate and drugs was discarded, and fresh embryo culture medium was used for continuous culturing for 96 hours. The hatching rate of zebrafish embryos from 0 to 96 hours was dynamically recorded (see results). Figure 9 (Top left time-series curve); Simultaneously, zebrafish juveniles were collected at the 72-h culture point, with 25 fish per group. Total RNA was extracted and reverse transcribed into cDNA. Using the cDNA as a template, the mRNA expression levels of inflammation-related target genes (IL-1β, TNF-α, IL-6, and IL-8) were detected by RT-qPCR using specific primers. The expression levels were normalized using the internal reference gene β-actin, and the relative expression levels of each gene were calculated. The downregulation of pro-inflammatory cytokine gene expression by the composition was used as the molecular basis for its anti-inflammatory activity. Primers for gene detection are shown in Table 3.

[0071] Table 3 Primers for RT-qPCR gene detection

[0072] ZfTNF-α-F Seq. No. 9 GCGTTGTGGCTGCATTTTTC ZfTNF-α-R Seq. No. 10 AGCACTTTTCCGTGGTCTGA ZfIL-6-F Seq. No. 11 ATGACGGCATTTGAAGGGGT ZfIL-6-R Seq. No. 12 TCAGGACGCTGTAGATTCGC ZfIL-8-F Seq. No. 13 GAACTCCTTATGCACGTCCG ZfIL-8-R Seq. No. 14 GCAGATTCCGTGTGGGTCTA ZfIL-1β-F Seq. No. 15 GCTCCACGTCTCCACATCTC ZfIL-1β-R Seq. No. 16 GTTTATGGAGCTGCCGGTCT ZfCOX2-F Seq. No. 17 ACAGATGCGCTACCAGTCTT ZfCOX2-R Seq. No. 18 CCCATGAGGCCTTTGAGAGA Zfβ-actin-F Seq. No.19 ACCCCATTGAGCACGGTATT Zfβ-actin-R Seq. No.20 CTTTGGGATTCAGGGGAGCC

[0073] Figure 9The results showed that copper sulfate significantly reduced the hatching rate of zebrafish eggs by 40%, and the expression of inflammatory factors in the hatched zebrafish larvae was also significantly increased (p<0.001). Ergothioneine, rosmarinic acid, or hesperidin, individually, could all improve the hatching rate and reduce the expression of inflammation-related genes to some extent. However, the E+R and E+Hs combinations showed more significant effects in improving the hatching rate and alleviating inflammation, indicating that the compositions can synergistically improve zebrafish embryonic developmental damage caused by acute inflammatory embryonic injury induced by copper sulfate, and significantly inhibit the excessive expression of inflammatory factors, thus exerting a synergistic anti-inflammatory effect in vivo.

[0074] Mechanism analysis: Ergothionein mainly accumulates in the mitochondria of cells, specifically clearing excess intracellular ROS, stabilizing mitochondrial structure and respiratory function, and upregulating the activity of endogenous antioxidant enzymes such as SOD and GSH-Px, thereby inhibiting the initiation of oxidative stress and reducing the accumulation of oxidative damage from the source; Rosmarinic acid and hesperidin mainly act on cell membrane and extracellular signaling pathways, significantly inhibiting the abnormal activation of the NF-κB pathway, blocking the inflammatory signal cascade, and downregulating the excessive transcription of multiple pro-inflammatory genes such as TNF-α, IL-1β, IL-6, and IL-8, thereby curbing the continuous amplification of inflammation at the signal transduction level.

[0075] The two active components act independently, with non-overlapping regulatory targets and highly complementary pharmacological functions: ergothionein is responsible for intracellular antioxidant damage protection and stabilizing cellular metabolic homeostasis, while polyphenolic components are responsible for blocking core inflammatory pathways and inhibiting cytokine storms. When combined, they form a bidirectional synergistic regulatory network of "endogenous antioxidant defense + NF-κB inflammation blocking," which can simultaneously break the vicious cycle of "oxidative stress → increased inflammation → further ROS accumulation." Therefore, the combination index CI of the composition under the specified ratio of this invention is <1, with a minimum CI of 0.05, demonstrating significantly superior anti-inflammatory, antioxidant, and cytoprotective effects compared to the simple superposition of monomers.

[0076] Meanwhile, compared to high-dose administration of single compounds, the compound system of this invention can significantly reduce the dosage of ergothioneine while maintaining or even greatly enhancing efficacy. This ensures that all components are within a safe dosing range, effectively avoiding the stress risks such as intracellular redox imbalance, decreased cell viability, and tissue developmental damage that are easily caused by high concentrations of single compounds. This achieves multiple technical advantages, including enhanced efficacy, reduced cost, and improved drug safety. In vitro cell experiments and in vivo validation results in zebrafish jointly confirm that only ergothioneine and rosmarinic acid, and ergothioneine and hesperidin, can produce stable and strong synergistic effects within specific ratio ranges. Other structurally similar and functionally related natural active combinations (hesperidin, glycyrrhizic acid, etc.) cannot achieve synergistic gains. This compound synergistic effect has unpredictable combination specificity and ratio dependence.

[0077] Furthermore, a common technical bias exists in this field: the combined use of thiol reducing agents and polyphenols easily leads to redox interactions, resulting in activity cancellation or even antagonistic effects, and those skilled in the art have no inspiration for developing such combinations. This invention, through systematic screening and in vitro / in vivo efficacy verification, demonstrates that specific ratios of these compounds not only do not exhibit activity antagonism but also produce extremely strong synergistic benefits, breaking through the inherent understanding of existing technologies and achieving unexpected technical effects.

[0078] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them; although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications can still be made to the specific implementation of the present invention or equivalent substitutions can be made to some technical features without departing from the spirit of the technical solutions of the present invention, and all such modifications and substitutions should be covered within the scope of the technical solutions claimed in the present invention.

Claims

1. An anti-inflammatory and antioxidant composition containing ergothioneine, characterized in that: The active ingredients include ergothioneine and polyphenols, and the combined index CI of ergothioneine and the polyphenols is <1. The two work synergistically to regulate the antioxidant pathway and the NF-κB inflammatory pathway. The polyphenols are rosmarinic acid or hesperidin.

2. The anti-inflammatory and antioxidant composition according to claim 1, characterized in that, The active ingredients are ergothioneine and rosmarinic acid, and the molar ratio of the two is 1:2 to 1:

8.

3. The anti-inflammatory and antioxidant composition according to claim 2, characterized in that, The active ingredient consists of ergothioneine and rosmarinic acid in a molar ratio of 1:3 to 1:

6.

4. The anti-inflammatory and antioxidant composition according to claim 3, characterized in that, The active ingredient consists of ergothioneine and rosmarinic acid in a molar ratio of 1:

5.

5. The anti-inflammatory and antioxidant composition according to claim 4, characterized in that, The safe molar concentration of the active ingredient for inflammatory cells and hepatocytes is ≤96 μM, with the preferred dosage concentration being 16 μM of ergothioneine and 80 μM of rosmarinic acid.

6. The anti-inflammatory and antioxidant composition according to claim 1, characterized in that, The active ingredients are ergothionein and hesperidin, and the molar ratio of the two is 2:1 to 2:

5.

7. The anti-inflammatory and antioxidant composition according to claim 6, characterized in that, The active ingredient consists of ergothionein and hesperidin in a molar ratio of 2:2 to 2:

4.

8. The anti-inflammatory and antioxidant composition according to claim 7, characterized in that, The active ingredient consists of ergothioneine and hesperidin in a molar ratio of 2:3, and the safe molar concentration for inflammatory cells and hepatocytes is ≤80 μM. The preferred dosage concentration is 16 μM ergothioneine and 24 μM hesperidin.

9. The use of the anti-inflammatory and antioxidant composition according to any one of claims 1 to 8 in the preparation of anti-inflammatory and antioxidant drugs, anti-inflammatory health products, antioxidant health products, food additives or feed additives.

10. The application according to claim 9, characterized in that, The anti-inflammatory and antioxidant drugs are drugs for the prevention and / or treatment of diseases related to polysaccharide-induced inflammatory damage and hydrogen peroxide-induced oxidative stress damage.

Images