Use of ankyrin-g protein as a target in the preparation of a drug for preventing epileptogenesis

Abstract

This invention discloses the application of Ankyrin-G protein as a target in the preparation of drugs for preventing epilepsy, belonging to the field of biomedical technology. This invention is the first to discover that within 24 hours after an acute seizure, the expression of Ankyrin-G protein in the axonal initiation segment of granular cells in the dentate gyrus of the hippocampus is significantly upregulated, and strongly positively correlated with the aggregation density of Nav1.6 channels. Therefore, this invention provides the application of Ankyrin-G protein as a therapeutic target for epilepsy, and the application of substances that inhibit Ankyrin-G expression or activity, as well as CK2 kinase inhibitors, in the preparation of antiepileptic drugs. This invention provides early intervention within the golden time window of epilepsy onset, achieving disease-modifying therapy. With innovative targets and unique mechanisms, it demonstrates significant therapeutic effects and high safety, providing a novel approach for the early treatment and diagnosis of epilepsy.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of Ankyrin-G protein as a target in the preparation of drugs for preventing epilepsy. Background Technology

[0002] Epileptogenesis is the pathological process by which acute brain injury develops into chronic spontaneous epilepsy. Clinical observations indicate that the early stages, from several hours to several days after the first seizure, are a critical window for determining the disease's outcome. In the hippocampal neural network, the dentate gyrus (DG), as a key "gating" structure, filters input to the entorhinal cortex through the sparse firing patterns of granule cells (GCs), preventing abnormal excitation from spreading to the CA3 area. Abnormalities in the function of this structure are closely related to epilepsy.

[0003] The axon initial segment (AIS) is a key subcellular structure for the generation of neuronal action potentials, and its molecular composition directly determines the neuronal excitability threshold. The scaffold protein Ankyrin-G (AnkG), as the organizational core of the AIS, anchors voltage-gated sodium channels (Nav1.6) and potassium channels (KCNQ2 / 3) through its scaffold function, forming the molecular basis for action potential initiation. Casein kinase 2 (CK2) can regulate the aggregation density of Nav channels in the AIS by phosphorylating the ankyrin binding motif of Nav channels.

[0004] Current antiepileptic treatments have many shortcomings. Existing antiepileptic drugs (AEDs) mainly control symptoms by blocking voltage-gated sodium channels (such as carbamazepine) or enhancing GABAergic inhibition (such as phenytoin sodium). Approximately 30% of patients develop drug resistance, and they cannot block the progression of epilepsy. Current AIS-related research focuses on structural remodeling (such as length changes) in the chronic phase (≥3 days), neglecting the molecular remodeling mechanisms in the acute phase (<24 hours), thus missing the critical window for early intervention. Some studies have found that targets such as FKBP5, PARP14, and XBP1 can exert antiepileptic effects through different mechanisms, but none of them involve the molecular remodeling mechanisms in the acute phase of AIS. At the same time, the cellular mechanisms in the early stage of epilepsy are not fully understood, there is a lack of key targets for intervention, and there are no early intervention strategies targeting the "golden time window" after the onset of epilepsy, which cannot effectively prevent the transformation of acute damage into chronic network hyperexcitability. Summary of the Invention

[0005] The purpose of this invention is to provide the application of Ankyrin-G protein as a target in the preparation of drugs for preventing epilepsy, thereby solving the problems of existing anti-epileptic drugs that can only control symptoms, lack disease modification treatment methods, and lack effective early intervention targets and diagnostic biomarkers.

[0006] The present invention achieves the above objectives through the following technical solutions:

[0007] First, the present invention provides the application of Ankyrin-G protein as a target in the preparation of drugs for preventing the occurrence of epilepsy, wherein the epilepsy is epilepsy caused by acute seizures, and the drug prevents or treats epilepsy by inhibiting the expression or activity of Ankyrin-G protein.

[0008] Second, the present invention provides the application of a substance that inhibits the expression or activity of Ankyrin-G protein in the preparation of antiepileptic drugs, wherein the substance is an Ankyrin-G specific antisense oligonucleotide.

[0009] As a further improvement of the present invention, the nucleotide sequence of the AnkG-specific antisense oligonucleotide is CTTCACCTACTTGGGTTCCA.

[0010] Third, the present invention provides the application of CK2 kinase inhibitors in the preparation of antiepileptic drugs, wherein the CK2 kinase inhibitors exert their antiepileptic effects by blocking the CK2-AnkG-Nav1.6 signaling axis and inhibiting the upregulation of Ankyrin-G protein and Nav1.6 channels.

[0011] As a further improvement of the present invention, the CK2 kinase inhibitor is 4,5,6,7-tetrabromo-1H-benzotriazole.

[0012] As a further improvement of any one of the first to third claims of the present invention, the drug is used for early intervention within the golden time window of <24 hours after the onset of epilepsy.

[0013] As a further improvement of any one of the first to third claims of the present invention, the drug is administered by means of bilateral dentate gyrus local injection or intraventricular injection for precise drug delivery, or by means of a nano-drug delivery system coupled with AnkG antibody or AIS targeting peptide to achieve precise drug delivery throughout the body.

[0014] Fourth, the present invention provides an antiepileptic drug comprising an effective dose of the substance that inhibits the expression or activity of Ankyrin-G protein or the CK2 kinase inhibitor, and further comprising a pharmaceutically acceptable carrier.

[0015] Fifth, this invention provides the application of reagents for detecting the expression levels of Ankyrin-G protein and / or Nav1.6 channel in the preparation of epilepsy diagnostic products, which are used for early warning of epilepsy, seizure severity grading, or evaluation of the efficacy of anti-epileptic treatment; the reagents can detect the expression levels of Ankyrin-G protein and / or Nav1.6 channel in cerebrospinal fluid or peripheral blood by immunohistochemistry, Western Blot, RT-qPCR, or ELISA methods.

[0016] As a further improvement of the present invention, the primer sequences used for the RT-qPCR detection are: ANK3 gene Forward5′-ACCTTGAACAGAAGCTCCTACGCCA-3′, Reverse5′-TCCGCTGCCCAACTGTAGTGTCT-3′; SCN8A gene Forward5′-TGGACGATACCAGCTCCTCA-3′, Reverse5′-ACGCAACCCTCTGTAAAGCA-3′.

[0017] This invention is the first to discover that within 12 hours after an acute seizure (such as pilocarpine-induced status epilepticus), rapid molecular remodeling occurs in the AIS of granule cells in the dentate gyrus of the hippocampus. Specifically, Ankyrin-G protein expression is significantly upregulated by about 2-fold, with its mRNA level increasing synchronously; the aggregation density of voltage-gated sodium channel Nav1.6 in the AIS is significantly increased, and the expression change of Nav1.6 is strongly positively correlated with Ankyrin-G expression (r²=0.85); granule cells change from normal adaptive firing to continuous high-frequency firing, leading to the collapse of the "gating" function of the dentate gyrus and triggering abnormal neuronal excitation.

[0018] The above findings were verified through the following mechanism:

[0019] By knocking down AnkG with antisense oligonucleotides (ASO), ASO-m-AnKyrinG-001 was injected bilaterally in the dentate gyrus at a dose of 10 μM and 0.5 μL. The results showed that it could significantly reduce the severity of seizures, reduce the duration of grade IV-V seizures, reduce neuronal loss, protect NeuN-positive cells, and restore the normal firing characteristics of granulocytes.

[0020] The causal relationship of activity-dependent remodeling was verified by optogenetic manipulation. In the inhibition experiment, eNpHR3.0, 589nm yellow-green light, 5 mW light power, 1Hz frequency, and 20ms pulse were used to inhibit granulosa cell firing during seizures, which could effectively block the upregulation of AnkG / Nav1.6 and neuronal hyperexcitability. In the excitation experiment, ChR2, 473nm blue light, 5 mW light power, 5Hz frequency, and 30ms pulse were used to photoexcite granulosa cells alone, which could induce seizures and replicate the upregulated AnkG / Nav1.6 phenotype.

[0021] Intraventricular injection of the CK2 kinase inhibitor TBB at a dose of 6 mM and 5 μL significantly inhibited the upregulation of AnkG and Nav1.6, confirming that the CK2-AnkG-Nav1.6 signaling axis is the molecular basis of activity-dependent remodeling in the acute phase of epilepsy.

[0022] The beneficial effects of this invention are as follows:

[0023] This invention targets the golden window of epilepsy onset (hours to days after a seizure), acting during the reversible stage of the epilepsy pathological process. It can block the transformation of acute injury into chronic hyperexcitability of the network, achieving disease-modifying therapy, unlike existing technologies that only control symptoms. For the first time, the AnkG-AIS axis is used as a therapeutic target for epilepsy, differentiating it from traditional ion channel targets and recently discovered cytoplasmic / nuclear targets such as FKBP5 and PARP14, providing a novel target direction for antiepileptic drug development. This invention elucidates the positive feedback loop of acute-phase neuronal activity-AIS molecular remodeling-neuronal hyperexcitability. By blocking AnkG upregulation, it can simultaneously correct the dual abnormalities of excessive accumulation of sodium channel Nav1.6 and relative insufficiency of potassium channel KCNQ function, fundamentally improving the abnormal excitatory state of neurons. Animal experiments have confirmed that knocking down or inhibiting AnkG can significantly reduce the severity of seizures, reduce neuronal loss, and restore the normal firing characteristics of granulocytes, demonstrating a good disease-modifying effect. The expression level of AnkG / Nav1.6 can serve as an early biomarker for epilepsy, as abnormal changes in it occur earlier than structural damage in epilepsy, enabling early warning and disease grading of epilepsy. This invention targets CK2 or AnkG to block the pathological remodeling of AIS upstream, without directly acting on ion channels, thus preserving normal ion channel function in neurons. Compared to traditional direct channel blockers, it has a better safety window. Attached Figure Description

[0024] Figure 1 The graph shows the upregulation of AnkG expression in the AIS of the dentate gyrus after acute seizures and its correlation with granulocyte hyperexcitability; where a is a schematic diagram of the experimental procedure; b is the electroencephalogram recording; cd is the immunofluorescence staining result; ef is the Western blot detection result; gh is a schematic diagram of the injection and expression of CamKIIa-specific labeled virus and its co-localization with AnkG; ij is the granulocyte discharge curve recorded by patch clamp.

[0025] Figure 2 The image shows the colocalization analysis and correlation plot of AnkG and Nav1.6 expression; where ac represents the immunofluorescence double labeling results of AnkG and Nav1.6; de represents the mRNA quantitative analysis results of AnkG and Nav1.6; and f represents the scatter plot of the correlation analysis of fluorescence intensity between AnkG and Nav1.6.

[0026] Figure 3The diagram illustrates the reduction in seizure severity and neuronal loss caused by AnkG-ASO intervention. Figure a shows the experimental procedure; figure b shows the AnkG mRNA levels in each group; figures cd show the seizure severity statistics and time-varying curves; figure e shows the frequency of grade 4-5 seizures; figure fg shows the NeuN immunofluorescence staining results and quantitative graph; and figure hi shows the patch-clamp recording results.

[0027] Figure 4 A schematic diagram illustrating the complete mechanism by which ASO therapy reverses pathology and alleviates epilepsy.

[0028] Figure 5 The diagram shows the upregulation and hyperexcitability of AnkG in granulosa cells by optogenetic inhibition and blocking; where a is a schematic diagram of the experimental procedure; b is a diagram of viral expression verification; c is a diagram of electroencephalogram analysis; d is a statistical diagram of seizure severity; ef is a quantitative diagram of seizure behavior; gi is the result and quantitative diagram of double immunofluorescence labeling of AnkG and Nav1.6; jk is the result of patch-clamp recording.

[0029] Figure 6 The images show the effects of optogenetic excitation alone on induced seizures and AnkG upregulation; where a is a schematic diagram of the experimental procedure; b is a diagram of viral expression verification; c is a diagram of electroencephalogram (EEG) spectrum analysis; df is a statistical diagram of seizure behavior; gi is an immunofluorescence staining and quantitative diagram of AnkG and Nav1.6; and jk is the patch-clamp recording result.

[0030] Figure 7 This diagram illustrates the regulatory effect of the CK2 inhibitor TBB on the AnkG-Nav1.6 axis; where ab represents the AnkG immunofluorescence staining results and quantitative map; and cd represents the Nav1.6 immunofluorescence staining results and quantitative map. Detailed Implementation

[0031] At least one embodiment of the present invention discloses the use of Ankyrin-G protein as a target in the preparation of drugs for preventing epilepsy, where epilepsy is caused by acute seizures, and the drugs prevent or treat epilepsy by inhibiting the expression or activity of Ankyrin-G protein.

[0032] At least one embodiment of the present invention discloses the use of a substance that inhibits the expression or activity of Ankyrin-G protein in the preparation of an antiepileptic drug, wherein the substance is an Ankyrin-G specific antisense oligonucleotide.

[0033] The nucleotide sequence of the AnkG-specific antisense oligonucleotide is CTTCACCTACTTGGGTTCCA (as shown in SEQ ID NO. 1).

[0034] At least one embodiment of the present invention discloses the application of CK2 kinase inhibitors in the preparation of antiepileptic drugs. CK2 kinase inhibitors exert their antiepileptic effect by blocking the CK2-AnkG-Nav1.6 signaling axis and inhibiting the upregulation of Ankyrin-G protein and Nav1.6 channel.

[0035] Among them, the CK2 kinase inhibitor is TBB (4,5,6,7-tetrabromo-1H-benzotriazole).

[0036] The medication is used for early intervention within the golden time window of <24 hours after the onset of epilepsy.

[0037] At least one embodiment of the present invention discloses an antiepileptic drug comprising an effective dose of the substance that inhibits the expression or activity of Ankyrin-G protein or the CK2 kinase inhibitor described above.

[0038] The drug in this invention is administered precisely via bilateral dentate gyrus local injection and intraventricular injection.

[0039] In addition to local injection, nano-drug delivery systems with AIS targeting (such as liposomes conjugated with AnkG antibodies or AIS-targeting peptides) can be developed to achieve precise delivery after systemic administration; long-term stable AnkG knockdown can be achieved by using lentivirus or AAV vector-mediated shRNA continuous expression systems.

[0040] The dosage of the substance or CK2 kinase inhibitor that inhibits the expression or activity of Ankyrin-G protein in this invention varies depending on the patient's or test subject's weight, age, sex, health status, diet, excretion rate, and disease severity.

[0041] The substance or CK2 kinase inhibitor that inhibits the expression or activity of Ankyrin-G protein of the present invention may also include pharmaceutically acceptable additives, wherein pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silica, and hydrogen phosphate. Calcium, lactose, mannitol, syrup, rubber arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, omega-3, sodium glycolate starch, carnauba extract, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, sucrose, and glucose, sorbitol, and talc may be used.

[0042] In actual clinical application, substances that inhibit Ankyrin-G protein expression or activity, or CK2 kinase inhibitors, can be administered in various oral and parenteral dosage forms. During formulation, diluents or excipients are used, such as commonly used fillers, expanders, binders, wetting agents, disintegrants, and surfactants.

[0043] Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms contain at least one excipient, such as starch, calcium carbonate, and water, in the mixed extract of the present invention. It can be prepared by mixing sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. Oral liquid dosage forms include suspensions, liquid solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients, such as wetting agents, sweeteners, flavorings, and preservatives, can also be included.

[0044] Preparations intended for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. As non-aqueous and suspension solvents, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate can be used. As a base for suppositories, Witepsol, polyethylene glycol, Tween 61, cocoa butter, lauric acid, and glycerin gelatin can be used.

[0045] At least one embodiment of the present invention discloses the application of reagents for detecting the expression levels of Ankyrin-G protein and / or Nav1.6 channel in the preparation of epilepsy diagnostic products. These diagnostic products are used for early warning of epilepsy, seizure severity grading, or evaluation of the efficacy of anti-epileptic treatment. The reagents can detect the expression levels of Ankyrin-G protein and / or Nav1.6 channel in cerebrospinal fluid or peripheral blood using immunohistochemistry, Western blotting, RT-qPCR, or ELISA methods.

[0046] The primer sequences used for RT-qPCR detection are as follows: ANK3 gene Forward5′-ACCTTGAACAGAAGCTCCTACGCCA-3′ (as shown in SEQ ID NO.2), Reverse5′-TCCGCTGCCCAACTGTAGTGTCT-3′ (as shown in SEQ ID NO.3); SCN8A gene Forward5′-TGGACGATACCAGCTCCTCA-3′ (as shown in SEQ ID NO.4), Reverse5′-ACGCAACCCTCTGTAAAGCA-3′ (as shown in SEQ ID NO.5).

[0047] The present application will be further described in detail below with reference to the embodiments and accompanying drawings. Unless otherwise specified, the methods used in this invention are conventional methods known to those skilled in the art; the reagents and materials used are commercially available products; and the instruments used are conventional instruments known to those skilled in the art. The gene name of AnkG is ankyrin 3, epithelial [Mus musculus (house mouse)], Gene ID: 11735.

[0048] Example 1. Dynamic changes in AnkG expression in the AIS of the dentate gyrus after pilocarpine-induced acute seizures.

[0049] Detection

[0050] I. Materials

[0051] SPF-grade adult male C57BL / 6 mice, weighing 25-30g and aged 6-8 weeks, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. They were housed in an SPF-grade animal room at a temperature of 22±2℃ and a humidity of 50±5%, with a 12-hour light-dark cycle and free access to food and water. After one week of acclimatization, they were used for experiments.

[0052] Pilocarpine (MCE, HY-B0726), scopolamine (Beijing Bairddi, M3453), paraformaldehyde (Maclean, Cat No. P804536), sucrose (Sinopharm Group, Cat No. 10021463), AnkG specific primary antibody (mouse antibody, Thermofisher, 33-8800, 1:500), fluorescent secondary antibody (Alexa Fluor 647, Abcam, ab150115, 1:1000), DAPI staining solution (Servicebio, G1012), and anti-fluorescence quenching mounting solution (Servicebio, G1401).

[0053] II. Experiment

[0054] Forty mice were randomly divided into a control group and a model group, with 20 mice in each group. Brain tissue was harvested from the model group 12-24 hours after successful modeling, while brain tissue was harvested from the control group at the same time.

[0055] An acute seizure model was established. Mice in the model group were injected intraperitoneally with scopolamine (Beijing Bairddi, M3453, 1 mg / kg), and 30 min later, they were injected intraperitoneally with pilocarpine (MCE, HY-B0726, 280-300 mg / kg) to induce status epilepticus (SE). Mice in the control group were injected intraperitoneally with an equal volume of physiological saline, and the remaining procedures were the same as those in the model group.

[0056] After injection of pilocarpine, mice were observed for 2 hours. The severity of seizures was determined according to the Racine scoring system. A score ≥ IV (forelimb clonus with standing) was considered a successful model establishment, and mice that did not reach grade IV were excluded.

[0057] 12-24 hours after modeling, mice in each subgroup of the model group and the control group were anesthetized with 20% urethane intraperitoneally, perfused with PBS (50 mL) through the left ventricle, and then perfused with 1% paraformaldehyde (50 mL). The whole brain was taken, fixed in 1% paraformaldehyde for 2-3 hours, and then dehydrated in 20% and 30% sucrose solutions in a gradient until the brain tissue settled to the bottom.

[0058] The dehydrated brain tissue was placed in a cryostat (Leica, CM1950) and coronal sections were prepared with a thickness of 20 μm. Sections containing the hippocampal DG region were selected, attached to an adhesive slide, and stored at -80°C for later use.

[0059] ① Immunofluorescence staining

[0060] Rinse sections three times with PBS for 10 min each time; permeate with 0.3% Triton X-100 PBS at room temperature for 20 min, then rinse three times with PBS for 10 min each time; block with 5% goat serum in PBS at room temperature for 1 h; add AnkG primary antibody (1:500) and incubate in a humidified chamber at 4°C for 12-15 h; warm to room temperature for 30 min, then rinse three times with PBS for 10 min each time; add fluorescent secondary antibody (1:1000) and incubate at room temperature in the dark for 2 h; stain with DAPI at room temperature in the dark for 10 min, then rinse three times with PBS for 10 min each time; mount with anti-fluorescence quenching mounting solution and observe under a fluorescence microscope.

[0061] ② Image acquisition and quantitative analysis

[0062] Under a fluorescence microscope, sections of the hippocampal DG region of each group of mice were selected, and three fields of view were randomly selected for each mouse to collect fluorescence images of AnkG (red) and DAPI (blue). The average fluorescence intensity of AnkG was analyzed using ImageJ software, and the relative expression level of AnkG at each time point was calculated based on the fluorescence intensity of the control group.

[0063] ③ RT-qPCR detection of AnkG mRNA levels

[0064] Five mice from each group were sacrificed at the corresponding time points after modeling, and hippocampal DG tissue was quickly collected. Total RNA was extracted using the Trizol method, reverse transcribed into cDNA, and amplified by RT-qPCR. The primer sequences for the ANK3 gene were Forward5′-ACCTTGAACAGAAGCTCCTACGCCA-3′ and Reverse5′-TCCGCTGCCCAACTGTAAAGCA-3′. GAPDH was used as an internal control, and the relative expression level of AnkG mRNA was calculated using the 2^(-ΔΔCt) method.

[0065] III. Results and Analysis

[0066] Mice in the model group began to show obvious seizures about 20-30 minutes after injection of pilocarpine. If the seizures reached Racine IV-V grade within 2 hours of observation, manifested as forelimb clonic jerking, standing, and generalized tonic-clonic jerking, the acute seizure model was considered to have been successfully established. Figure 1 a) No convulsions were observed in the control group.

[0067] In the control group, a small amount of AnkG fluorescence expression was observed in the AIS region of granular cells in the DG region; in the model group, the AnkG fluorescence intensity was significantly increased, and the AnkG fluorescence was mainly located in the AIS region of granular cells, highly overlapping with the AIS structure. Figure 1 b, c, h). The trend of AnkG mRNA level change in the model group was consistent with that of the protein, and the relative expression level of mRNA was 1.9 ± 0.3 times that of the control group (P < 0.001), confirming that the upregulation of AnkG occurred at the transcriptional level. Figure 2 ).

[0068] Electroencephalography (EEG) was performed on mice, and the results showed that the model group mice had high-frequency abnormal discharges (30-50Hz), while the control group mice had normal rhythms (8-12Hz).

[0069] Western blot analysis confirmed significant upregulation of Ankyrin-G protein (270 kDa, 190 kDa), with GAPDH (37 kDa) serving as an internal control. Figure 1 ef).

[0070] All experimental data were statistically analyzed using SPSS 25.0 and plotted using GraphPad Prism 9.0. When the data conformed to a normal distribution and had homogeneous variances, Student's t-tests were used for comparisons between two groups; one-way ANOVA was used for comparisons among multiple groups; otherwise, non-parametric tests were used. P < 0.05 was considered statistically significant, and P < 0.001 was considered highly statistically significant.

[0071] Example 2. Effects of AnkG-ASO intervention on epilepsy

[0072] I. Materials

[0073] Sixty adult male SPF-grade C57BL / 6 mice, weighing 25-30g, were grouped and fed as in Example 1.

[0074] ASO-m-AnKyrinG-001 (nucleotide sequence: CTTCACCTACTTGGGTTCCA, synthesized by Guangzhou Ruibo Biotechnology), negative control ASO (NC-ASO, no target sequence, Ruibo Biotechnology), NeuN specific primary antibody (Abcam, ab177487, 1:500), fluorescent secondary antibody (AlexaFluor 488, Abcam, ab150077, 1:1000), and other reagents are the same as in Example 1.

[0075] II. Methods

[0076] Sixty mice were randomly divided into a control group, a model group, an NC-ASO group, an AnkG-ASO group, a model + NC-ASO group, and a model + AnkG-ASO group, with 10 mice in each group.

[0077] Mice were anesthetized with isoflurane and then fixed in a stereotaxic apparatus, maintaining anesthesia with continuous inhalation of isoflurane. The coordinates of the hippocampal DG region (2.0 mm posterior to the anterior fontanelle, 1.5 mm lateral to the midline, and 2.0 mm subdural) were determined using a mouse brain stereotaxic atlas. ASO, AnkG-ASO, and NC-ASO were injected bilaterally into the DG region using a microsyringe at a dose of 10 μM each, with an injection volume of 0.5 μL per side and a flow rate of 0.1 μL / min. The needles were left in place for 10 minutes after injection. The control and model groups were injected with the same volume of 0.01 M PBS, with all other procedures performed identically. Figure 3 a).

[0078] Two days after injection, acute seizure models were constructed in the model group, model + NC-ASO group, and model + AnkG-ASO group according to the method in Example 1. Behavioral observations were conducted and Racine scores were recorded.

[0079] ① Epilepsy Seizure Indicators Detection

[0080] Latent period of seizures: Record the time from injection of pilocarpine to the first occurrence of a grade III or higher seizure;

[0081] Seizure duration: Record the cumulative duration of grade IV-V seizures within 2 hours;

[0082] Distribution of attack severity: The percentage of mice with each Racine score grade within 2 hours was statistically analyzed (corresponding to...). Figure 3 cd).

[0083] ② AnkG low-efficiency verification

[0084] 12-24 hours after modeling, hippocampal DG tissues from each group of mice were collected and the effect of AnkG-ASO in knocking down AnkG mRNA was verified by qPCR experiment, using the same method as in Example 1.

[0085] ③ Neuron survival detection (NeuN staining)

[0086] Brain slices containing the DG region were taken from each group and subjected to NeuN immunofluorescence staining, the same method as in Example 1; the number of NeuN positive neurons in the DG region was counted using ImageJ software, and three fields of view were randomly selected from each mouse to calculate the average neuron density (number of neurons / mm²).

[0087] ④ Detection of Granulocyte Discharge Characteristics

[0088] Hippocampal slices were taken from each group of mice, and the firing frequency of action potentials in granule cells of the DG region was recorded using patch-clamp technique. The stimulation current was gradually increased from 0 pA to 300 pA in increments of 10 pA, and the number of action potentials at different stimulation intensities was recorded (corresponding to...). Figure 3 hi).

[0089] III. Results and Analysis

[0090] The relative expression level of Ankyrin-G protein in the DG region of mice in the AnkG-ASO group was approximately 50% of that in the blank control group (P<0.001), while there was no significant difference between the NC-ASO group and the control group (P>0.05), confirming that AnkG-ASO can efficiently and specifically knock down AnkG expression in the DG region. Figure 3 b).

[0091] Compared with the seizure model group, the cumulative duration of grade IV-V seizures in the AnkG-ASO group was significantly shortened (model group: 3.84±0.90 min, AnkG-ASO group: 0.47±0.59 min, P<0.001); the seizure grade distribution showed that 80% of mice in the AnkG-ASO group had seizure grades ≤ III, while 90% of mice in the model group had seizure grades ≥ IV. Figure 3 (b, c) There was no significant difference between the NC-ASO group and the model group (P>0.05), excluding the non-specific effects of ASO.

[0092] The density of NeuN-positive neurons in the DG region of the model group was 414.67±57.11 / mm², significantly lower than that of the control group (681.17±77.18 / mm², P<0.001); the neuronal density of the model + AnkG-ASO group was 581.50±64.88 / mm², significantly higher than that of the model group (P<0.001), confirming that AnkG knockdown can significantly reduce neuronal loss after seizures. Figure 3f、i).

[0093] Patch-clamp results showed that granulosa cells in the model group exhibited sustained high-frequency firing, while granulosa cells in the AnkG-ASO group reverted to adaptive firing (action potential firing frequency decreased with prolonged stimulation time), consistent with the control group. Figure 3 hi).

[0094] One-way ANOVA was used for comparisons between groups. P < 0.05 was considered statistically significant, and P < 0.001 was considered highly statistically significant.

[0095] IV. Conclusion

[0096] Status epilepticus (SE) disrupts neuronal excitability regulation by over-inducing AnkG / Nav1.6 densification of the AIS; while AnkG targeting of the ASO can precisely reverse this pathological remodeling, restore normal neuronal electrical activity and inhibit epilepsy, providing a precise method for epilepsy treatment based on AIS structural regulation.

[0097] Figure 4 The mechanism of pathological remodeling of neuronal axonal initial segment (AIS) induced by status epilepticus (SE) and the AnkG-targeted ASO reversal therapy were presented, specifically:

[0098] After pilocarpine-induced seizures (SE), pathological remodeling of the aisle in granular cells occurs within hours to days: AnkG and Nav1.6 densities are significantly upregulated, and the aisle becomes denser; this directly leads to the loss of adaptive firing patterns in neurons after SE, resulting in excitability and loss of braking regulation, thus laying the structural and functional basis for epileptic seizures.

[0099] Experiments have confirmed that AIS density is activity-dependent: optogenetic activation of neurons increases AnkG / Nav1.6 density, mimicking the pathological changes of SE; optogenetic silencing of neurons decreases both densities, verifying that over-excitation is the direct cause of AIS densification.

[0100] Using AnkG-ASO (ASO-m-AnKyrinG-001) to target and degrade AnkG mRNA, at the structural level, it reverses AIS densification and restores the normal density of AnkG / Nav1.6; at the functional level, it allows neuronal firing to return to adaptive firing and rebuilds the braking mechanism; at the disease level, it successfully alleviates epileptic seizures, achieving a complete reversal from structural abnormality → functional disorder → disease phenotype.

[0101] Example 3. The blocking effect of optogenetic inhibition of granulosa cell firing on the upregulation of AnkG / Nav1.6 and neuronal hyperexcitability

[0102] I. Materials

[0103] SPF grade C57BL / 6 adult male mice, weighing 25-30g, 6-8 weeks old, were raised under the same conditions as in Example 1.

[0104] The recombinant adeno-associated virus pAAV-CaMKIIa-eNpHR3.0-EYFP (titer 1×10¹² vg / mL) and the empty vector AAV-CaMKIIa-EGFP were purchased from Heyuan Biotechnology; scopolamine and pilocarpine were the same as in Example 1; AnkG primary antibody (mouse antibody, Thermofisher, 33-8800, 1:500) and Nav1.6 primary antibody (merck, ab5580, 1:500); fluorescent secondary antibody (Alexa Fluor555, Abcam, ab150078, 1:1000); DAPI staining solution and anti-fluorescence quenching mounting solution were the same as in Example 1.

[0105] II. Experiment

[0106] Forty-five mice were randomly divided into a control group, a model group, and an optogenetic inhibition group, with 15 mice in each group.

[0107] After anesthesia, mice were fixed in a stereotaxic apparatus. The bilateral DG regions were positioned as in Example 2. The optogenetic inhibition group was injected with pAAV-CaMKIIa-eNpHR3.0-EYFP virus, the model group was injected with the empty vector AAV-CaMKIIa-EGFP, and the control group was injected with an equal volume of PBS. The injection volume was 1 μL and the injection rate was 0.2 μL / min. At the same time, an optical fiber cannula was implanted above the DG region. After surgery, the mice were fed routinely for 3 weeks to allow the virus to fully express. The virus expression efficiency (EYFP green fluorescence) was verified by fluorescence microscopy. Mice with a positive expression rate of over 80% were included in the experiment.

[0108] After 3 weeks of feeding, acute seizure models were constructed in the model group and optogenetic inhibition group according to the method in Example 1. In the optogenetic inhibition group, pilocarpine was injected, and the DG region was irradiated with 589nm yellow-green light (5mW power, 20ms pulse, 1Hz frequency) via optical fiber for 2 hours. The model group received only optical fiber implantation without laser irradiation, while the control group received saline injection without laser irradiation. Figure 5 a).

[0109] Similar to Example 2, the latency period, duration of seizures, and percentage of severe seizures were recorded for each group. Electroencephalography (EEG) was performed throughout the process, and changes in the EEG spectrum were analyzed.

[0110] 24 hours after modeling, mice in each group underwent cardiac perfusion-fixation-dehydration treatment as in Example 1; hippocampal coronal sections (20 μm) were prepared for AnkG / Nav1.6 immunofluorescence double staining; and acute brain slices were prepared from 5 mice in each group for patch-clamp detection.

[0111] ①Verification of viral expression

[0112] A portion of the tissue was taken and the green fluorescence of EYFP was observed directly under a fluorescence microscope to verify the targeted expression of eNpHR3.0 in granulocytes in the DG region.

[0113] ② AnkG / Nav1.6 immunofluorescence double staining

[0114] After permeabilization and blocking, sections were incubated overnight at 4°C with a mixture of AnkG primary antibody (1:500) and Nav1.6 primary antibody (1:500). After warming to room temperature, sections were incubated for 1 hour at room temperature in the dark with a mixture of Alexa Fluor 488 (labeled AnkG) and Alexa Fluor 555 (labeled Nav1.6) secondary antibodies. After nuclear staining with DAPI, sections were mounted and observed under a laser confocal microscope. ImageJ software was used to analyze the average fluorescence intensity, colocalization coefficient, and fluorescence intensity correlation between the two antibodies.

[0115] ③ Patch-clamp detection of granulocyte firing characteristics

[0116] The operation steps are the same as in Example 2. The discharge patterns of granule cells in the DG region of each group under gradient stimulation current are recorded, and the frequency and number of action potentials are analyzed.

[0117] III. Results and Analysis

[0118] Fluorescence microscopy confirmed that abundant EYFP green fluorescence was observed in granulosa cells of the DG region in the optogenetic suppression group, confirming the targeted and efficient expression of eNpHR3.0 protein. Figure 5 b).

[0119] Behavioral and electroencephalogram (EEG) results showed that mice in the model group experienced more severe seizures, and their EEG showed a significant increase in the power of high-frequency abnormal discharges (γ waves, 30-80 Hz). In the optogenetic inhibition group, mice had prolonged seizure latency, a significantly lower proportion of severe seizures, and a significantly decreased power of abnormal γ-wave discharges on EEG, with no significant difference compared to the control group (P>0.05). Figure 5 (cf), confirming that inhibiting granulocyte discharge in the DG region can effectively reduce acute seizures.

[0120] Immunofluorescence double labeling results showed that the fluorescence intensity of AnkG and Nav1.6 in the DG region of the model group was significantly upregulated. Both were highly co-localized in the AIS region of granulocytes, with a co-localization coefficient of 0.85. Correlation analysis of fluorescence intensity showed a strong positive correlation between the two (r²=0.85). Figure 3 , Figure 5 g); the fluorescence intensity of AnkG and Nav1.6 in the optogenetic inhibition group was significantly reduced, but still higher than that in the control group (P<0.05) and significantly lower than that in the model group (g); Figure 5(gi), confirming that optogenetic inhibition of granulocyte firing can control the synchronous upregulation of AnkG / Nav1.6.

[0121] Patch-clamp examination showed that granulocytes in the model group exhibited a sustained high-frequency firing pattern, with a significantly increased number of action potentials. In the optogenetic inhibition group, granulocytes reverted to normal adaptive firing patterns, and the number of action potentials was not significantly different from the control group (P>0.05). Figure 5 (jk) confirmed that inhibiting granulocyte firing can reverse its hyperexcitability and block the causal link between molecular remodeling in the AIS region and neuronal electrophysiological abnormalities.

[0122] All experimental data were statistically analyzed using SPSS 25.0. The differences between the optogenetic inhibition group and the model group were statistically significant (P<0.05).

[0123] Example 4. Verification of the sufficiency of optogenetic excitation of granulocyte firing alone inducing seizures and AnkG upregulation.

[0124] I. Materials

[0125] SPF grade C57BL / 6 adult male mice, weighing 25-30g, 6-8 weeks old, were raised under the same conditions as in Example 1.

[0126] pAAV-CaMKIIa-hChR2(H134R)-EGFP adeno-associated virus (titer 1×10¹² vg / mL), purchased from Heyuan Bio or Brinkes Bio; AnkG primary antibody, Nav1.6 primary antibody, fluorescent secondary antibody, and DAPI staining solution were the same as in Example 3.

[0127] II. Experiment

[0128] Forty-five mice were randomly divided into a control group, an optogenetic excitation group, and a model group, with 15 mice in each group.

[0129] In the optogenetic stimulation group, pAAV-CaMKIIa-ChR2-EGFP virus was injected into both DG regions, while the control group was injected with an equal volume of PBS. The injection and fiber optic implantation methods were the same as in Example 3. After 3 weeks of post-operative feeding, ChR2-EGFP green fluorescence expression was verified using fluorescence microscopy. Positive expression rates exceeding 80% were included in the experiment. Figure 6 a).

[0130] After 3 weeks of feeding, the optogenetic excitation group was not injected with any modeling drugs, but was irradiated with 473nm blue light (5Hz, 30ms) through an optical fiber to the DG region for 2 hours; the model group was constructed with an acute seizure model according to the method in Example 1, without laser irradiation; the control group was not injected with virus, not irradiated with laser, and not treated with drugs.

[0131] Same as in Example 2, observe continuously for 2 hours, record whether mice in the optogenetic excitation group have seizures and the severity of seizures, perform EEG detection on each group, and analyze the changes in EEG spectrum; the model group modeling criteria are the same as in Example 1.

[0132] 24 hours after intervention / modeling, mice in each group underwent cardiac perfusion-fixation-dehydration treatment as in Example 1; hippocampal coronal sections (20 μm) were prepared for AnkG / Nav1.6 immunofluorescence double staining; and 5 mice from each group were used to prepare acute brain slices for patch-clamp detection.

[0133] ① Virus expression verification: Take some sections and observe the green fluorescence of ChR2-EGFP under a fluorescence microscope to verify its targeted expression in granular cells in the DG region.

[0134] ② AnkG / Nav1.6 immunofluorescence double staining and quantification: The operation steps are the same as in Example 3. The fluorescence intensity, co-localization and fluorescence intensity correlation of AnkG and Nav1.6 in the DG region of each group are detected and analyzed.

[0135] ③ Patch-clamp detection of granulocyte discharge characteristics: The operation steps are the same as in Example 2. Record the discharge patterns of granulocytes in each group and analyze the characteristics of action potential delivery.

[0136] III. Results and Analysis

[0137] Fluorescence microscopy confirmed that abundant ChR2-EGFP green fluorescence was observed in granulosa cells of the DG region in the optogenetic excitation group, confirming the targeted and efficient expression of the ChR2 protein. Figure 6 b).

[0138] Behavioral results showed that mice in the optogenetic stimulation group experienced significant seizures approximately 30 minutes after blue light exposure, with seizure severity reaching Racine III-V levels, manifested as forelimb clonus and standing up, with several grade V seizures observed over a period of 2 hours; the model group experienced seizures reaching grade IV-V levels, while the control group showed no seizures; electroencephalography (EEG) revealed high-frequency abnormal discharges in the DG region of the optogenetic stimulation group, consistent with the trend observed in the pilocarpine model group, with significantly increased gamma wave power and only slightly lower amplitude (…). Figure 6 (cf), confirming that simply exciting granule cells can induce seizures and abnormal brain electrical activity.

[0139] Immunofluorescence double labeling results showed that the fluorescence intensity of AnkG and Nav1.6 in the DG region was significantly upregulated in the optogenetic stimulation group, with no significant difference compared to the model group (P>0.05). Figure 6 gi). Patch-clamp examination showed that granulosa cells in the optogenetic excitation group exhibited a sustained high-frequency firing pattern consistent with the model group, and the number of action potentials fired under the same stimulation current was 2.3±0.4 times that of the control group (P<0.001). Figure 6(jk), confirming that neuronal over-discharge is the core reason for the synchronous upregulation of AnkG / Nav1.6 and the hyperexcitability of granule cells, verifying the causal relationship of "activity-dependent remodeling".

[0140] All experimental data were statistically analyzed using SPSS 25.0. The differences between the optogenetic excitation group and the control group were statistically significant (P<0.001); the differences between the optogenetic excitation group and the model group were not statistically significant (P>0.05).

[0141] Example 5. Regulation of the AnkG-Nav1.6 signaling axis by the CK2 kinase inhibitor TBB

[0142] I. Materials

[0143] SPF grade C57BL / 6 adult male mice, weighing 25-30g, 6-8 weeks old, were raised under the same conditions as in Example 1.

[0144] CK2 kinase inhibitor TBB (4,5,6,7-tetrabromobenzotriazole, Beyotime, Y251185); dimethyl sulfoxide (DMSO, Sigma, D2650); scopolamine and pilocarpine were the same as in Example 1; AnkG primary antibody (Thermofisher, 33-8800, 1:500) and Nav1.6 primary antibody (merck, ab5580, 1:500); fluorescent secondary antibody, DAPI staining solution, and anti-fluorescence quenching mounting solution were the same as in Example 3.

[0145] II. Experiment

[0146] Mice were randomly divided into a DMSO control group, a Pilo+DMSO group, and a Pilo+TBB group. The drugs in each group were injected into the lateral ventricles using a stereotactic method (with the anterior cerebellar point as the origin and coordinates x=1.00mm, z=1.5mm, y=-0.5mm as the coordinates for bilateral lateral ventricle localization injection).

[0147] TBB was dissolved in DMSO to prepare a 6mM stock solution. The Pilo+TBB group mice were injected into the lateral ventricle with 6mM TBB (administration volume 5uL); the Pilo+DMSO group was injected with an equal volume of DMSO solvent; and the DMSO control group was injected with an equal volume of DMSO. All groups were administered the drugs 48 hours before modeling.

[0148] The Pilo+DMSO group and Pilo+TBB group were used to establish an acute seizure model by intraperitoneal injection of scopolamine (1 mg / kg) and pilocarpine (300 mg / kg) according to the method in Example 1; the DMSO control group was injected with an equal volume of physiological saline, and the model establishment criteria were the same as in Example 1.

[0149] Similar to Example 2, the latency period, duration of seizures, and percentage of severe seizures in each group of mice were recorded. DG area EEG was performed to analyze abnormal EEG discharges.

[0150] 24 hours after modeling / drug administration, mice in each group underwent cardiac perfusion-fixation-dehydration treatment, as in Example 1; hippocampal coronal sections (20 μm) were prepared for AnkG, Nav1.6 immunofluorescence staining and double labeling.

[0151] ① AnkG / Nav1.6 immunofluorescence double staining and correlation analysis: The operation steps are the same as in Example 3. The fluorescence intensity, colocalization coefficient and fluorescence intensity correlation of AnkG and Nav1.6 in the DG region of each group are detected.

[0152] ②AnkG and Nav1.6 single-label immunofluorescence staining and quantification: After permeabilization and blocking, AnkG primary antibody (1:500) and Nav1.6 primary antibody (1:500) were added and incubated overnight at 4℃. After warming to room temperature, the corresponding fluorescent secondary antibody was added and incubated at room temperature in the dark for 1 hour. The nuclei were stained with DAPI, and the slides were mounted and observed under a fluorescence microscope. The average fluorescence intensity of the two antibodies was analyzed using ImageJ software.

[0153] III. Results and Analysis

[0154] AnkG single-label immunofluorescence results showed that the AnkG fluorescence expression level in the DG region was low in the DMSO control group; the AnkG fluorescence intensity was significantly upregulated in the Pilo+DMSO group, with a relative expression level 2.05±0.18 times that of the DMSO control group (P<0.001); the AnkG fluorescence intensity was significantly decreased in the Pilo+TBB group, with no significant difference compared to the DMSO control group (P>0.05). Figure 7 (ab) This confirms that TBB can effectively inhibit the upregulation of AnkG after acute seizures.

[0155] The results of single-label immunofluorescence of Nav1.6 showed that its expression changes were completely synchronized with AnkG: the fluorescence intensity of Nav1.6 in the Pilo+DMSO group was 2.12±0.20 times that of the DMSO control group (P<0.001); the fluorescence intensity of Nav1.6 in the Pilo+TBB group returned to normal levels, with no significant difference from the DMSO control group (P>0.05). Figure 7 (cd), confirming that TBB can simultaneously inhibit the upregulation of Nav1.6.

[0156] All experimental data were analyzed by one-way ANOVA using SPSS 25.0. The Pilo+TBB group showed highly statistically significant differences compared with the Pilo+DMSO group (P<0.001); there was no statistically significant difference compared with the DMSO control group (P>0.05).

[0157] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. The application of Ankyrin-G protein as a target in the preparation of drugs for preventing epilepsy, characterized in that, The epilepsy is epilepsy caused by acute seizures, and the drug prevents or treats epilepsy by inhibiting the expression or activity of Ankyrin-G protein.

2. The use of a substance that inhibits the expression or activity of Ankyrin-G protein in the preparation of antiepileptic drugs, characterized in that, The substance is an AnkG-specific antisense oligonucleotide.

3. The application according to claim 2, characterized in that, The nucleotide sequence of the AnkG-specific antisense oligonucleotide is CTTCACCTACTTGGGTTCCA.

4. The application of CK2 kinase inhibitors in the preparation of antiepileptic drugs, characterized in that, The CK2 kinase inhibitor exerts its anti-epileptic effect by blocking the CK2-AnkG-Nav1.6 signaling axis and inhibiting the upregulation of Ankyrin-G protein and Nav1.6 channel.

5. The application according to claim 4, characterized in that, The CK2 kinase inhibitor is 4,5,6,7-tetrabromo-1H-benzotriazole.

6. The application according to any one of claims 1-5, characterized in that, The drug is used for early intervention within the golden time window of <24 hours after the onset of epilepsy.

7. The application according to any one of claims 1-5, characterized in that, The drug can be administered via bilateral dentate gyrus local injection or intraventricular injection for precise delivery, or via a nano-drug delivery system coupled with AnkG antibody or AIS targeting peptide for precise systemic delivery.

8. An antiepileptic drug, characterized in that, The substance comprising an effective dose of the substance of claim 2 or the CK2 kinase inhibitor of claim 4, further comprising a pharmaceutically acceptable carrier.

9. The application of reagents for detecting the expression levels of Ankyrin-G protein and / or Nav1.6 channel in the preparation of epilepsy diagnostic products, characterized in that... The diagnostic product is used for early warning of epilepsy, seizure severity grading, or evaluation of the efficacy of anti-epileptic treatment; the reagent can detect the expression levels of Ankyrin-G protein and / or Nav1.6 channel in cerebrospinal fluid or peripheral blood by immunohistochemistry, Western Blot, RT-qPCR or ELISA.

10. The application according to claim 10, characterized in that, The primer sequences used for the RT-qPCR detection are: ANK3 gene Forward5′-ACCTTGAACAGAAGCTCCTACGCCA-3′, Reverse5′-TCCGCTGCCCAACTGTAGTGTCT-3′; SCN8A gene Forward5′-TGGACGATACCAGCTCCTCA-3′, Reverse5′-ACGCAACCCTCTGTAAAGCA-3′.

Images