An engineered exosome for promoting tumor targeting and endosome escape, and a preparation method and application thereof

Abstract

This invention belongs to the field of biomedical technology and provides an engineered exosome that promotes tumor targeting and endosome escape, along with its preparation method and applications. The engineered exosomes have their membrane surface modified with iRGD peptide and L17E peptide, and are enriched with tumor-suppressing siRNA internally. This invention introduces siRNA capable of inhibiting gastric cancer progression into exosomes modified with iRGD and L17E peptides. iRGD possesses both tumor targeting and deep tissue penetration capabilities, while DSPE-PEG-L17E peptide prolongs in vivo circulation time and promotes efficient siRNA escape from endosomes to the cytoplasm to exert its effect, thereby enhancing the anti-cancer effect. The engineered exosomes of this invention integrate active targeting, long-lasting circulation, and efficient endosome escape, exhibiting good anti-cancer effects and biosafety in vivo, providing a potential new strategy for tumor treatment.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an engineered exosome that promotes tumor targeting and endosome escape, its preparation method, and its application. Background Technology

[0002] Early symptoms of gastric cancer are often subtle, and most patients are already in advanced stages when they are first diagnosed, resulting in a generally unfavorable prognosis. Although surgical resection, conventional chemotherapy, and radiotherapy have shown some efficacy in early-stage or locally advanced gastric cancer, there is still a lack of truly effective and durable treatment strategies for patients with advanced, metastatic, or recurrent drug-resistant gastric cancer.

[0003] RNA interference (RNAi) technology, as an important tool in gene therapy, has broad application prospects. However, the clinical translation of siRNA faces many delivery bottlenecks, including the instability and easy degradation of naked siRNA in the blood, its lack of targeting, and its difficulty in entering the cytoplasm of target cells. Exosomes are small extracellular vesicles secreted by cells with a diameter of less than 200 nm. They possess natural biocompatibility, low immunogenicity, and good tissue penetration ability, and are considered to be highly promising delivery vectors. However, natural exosomes have limitations such as insufficient targeting, susceptibility to clearance by the mononuclear phagocytic system, and the inability to release the payload due to endosome / lysosome retention (i.e., the "endosome escape dilemma").

[0004] Therefore, there is an urgent need to provide an exosome that combines active tumor targeting, long-lasting in vivo circulation, and efficient endosomal escape to solve the technical problems of poor stability, insufficient targeting, low payload release efficiency, and limited anti-tumor effects of existing siRNA delivery systems. Summary of the Invention

[0005] The purpose of this invention is to provide an engineered exosome that promotes tumor targeting and endosome escape, as well as its preparation method and application. The engineered exosome of this invention integrates active targeting, long-term circulation, and efficient endosome escape, providing a potential new strategy for tumor treatment.

[0006] This invention provides an engineered exosome that promotes tumor targeting and endosome escape. The membrane surface of the engineered exosome is modified with iRGD peptide and L17E peptide, and the interior is enriched with tumor suppressor siRNA.

[0007] As a preferred embodiment, the amino acid sequence of the L17E peptide is shown in SEQ ID NO:1; The amino acid sequence of the iRGD is shown in SEQ ID NO:2.

[0008] As a preferred embodiment, the anti-cancer treatment includes inhibiting gastric cancer.

[0009] The present invention also provides a method for preparing the engineered exosomes, comprising the following steps: After infecting cells with a recombinant lentiviral vector, the cell supernatant was collected, separated, and iRGD-modified exosomes were obtained. Tumor suppressor siRNA was introduced into the iRGD-modified exosomes to obtain siRNA-enriched exosomes; The DSPE-PEG-L17E peptide and the enriched siRNA exosomes were mixed and incubated to obtain the engineered exosomes.

[0010] As a preferred embodiment, the recombinant lentiviral vector includes a basic lentiviral vector and a target protein inserted into the basic lentiviral vector, wherein the target protein includes Lamp2b protein and iRGD expressed by fusion with the extracellular N-terminus of the Lamp2b protein; The nucleotide sequence encoding the Lamp2b protein is shown in SEQ ID NO:3.

[0011] As a preferred embodiment, the cells comprise HEK293T cells.

[0012] As a preferred embodiment, the method of introduction includes electroporation.

[0013] As a preferred embodiment, the mass ratio of the DSPE-PEG-L17E peptide to the exosomes enriched with siRNA is 1:1.

[0014] As a preferred embodiment, the incubation time is 2 hours and the incubation temperature is 40°C.

[0015] The present invention also provides the application of the engineered exosomes or engineered exosomes obtained by the preparation method described above in the preparation of drugs for treating tumors.

[0016] Beneficial Effects: This invention provides an engineered exosome that promotes tumor targeting and endosome escape, along with its preparation method and applications. The engineered exosomes have their membrane surface modified with iRGD peptide and L17E peptide, and are enriched with tumor-suppressing siRNA internally. This invention introduces siRNA capable of inhibiting gastric cancer progression into exosomes modified with iRGD and L17E peptides. iRGD possesses both tumor targeting and deep tissue penetration capabilities, while DSPE-PEG-L17E peptide prolongs in vivo circulation time and simultaneously promotes efficient siRNA escape from endosomes to the cytoplasm to exert its effect, thereby enhancing the anti-cancer effect. The engineered exosomes of this invention integrate active targeting, long-lasting circulation, and efficient endosome escape, exhibiting good anti-cancer effects and biosafety in vivo, providing a potential new strategy for tumor treatment.

[0017] Compared with the prior art, the present invention also has the following beneficial effects: 1) The engineered exosomes provided by this invention not only have the characteristics of low immunogenicity and high biocompatibility, but also integrate active tumor targeting, prolonged circulating half-life and efficient endosomal escape, which can overcome the bottlenecks of poor efficacy, strong toxic side effects and low delivery efficiency of tumor treatment drugs.

[0018] 2) The engineered exosomes provided by this invention can significantly inhibit the proliferation of gastric cancer cells by delivering small interfering RNA of the oncogenic molecule circ512 and exert a good anti-tumor effect in vivo. When combined with cisplatin, it exerts a better therapeutic effect.

[0019] 3) The engineered exosomes provided by this invention do not cause damage to major organs or abnormal liver and kidney function during in vivo treatment, exhibiting excellent biocompatibility and extremely high application value. This invention provides a new targeted therapy for gastric cancer and has great potential for clinical translation. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0021] Figure 1 This is a plasmid map of the empty vector GL188 pcSLenti-EF1-EGFP-CMV-MCS-WPRE in Example 1; Figure 2 The plasmid map of the target vector pcSLenti-EF1-EGFP-CMV-LAMP2-Linker-iRGD-WPRE in Example 1; Figure 3 The image shows the transmission electron microscopy morphology and particle size analysis results of the engineered exosomes in Example 1; Figure 4 This is a graph showing the protein biomarker analysis results of engineered exosomes in Example 1; Figure 5 The image shows the fluorescence uptake of engineered exosomes by SNU-1 gastric cancer cells and RAW264.7 macrophages in Example 2. Figure 6 This is a graph showing the knockdown efficiency of circ512 after treating SNU-1 gastric cancer cells with engineered exosomes in Example 2. Figure 7 This is a graph showing the endosome escape of siRNA after treatment of gastric cancer cells with engineered exosomes in Example 2. Figure 8The image shows the results of tumor targeting and blood half-life detection of engineered exosomes in a nude mouse tumor-bearing model in Example 2; where A is the in vitro fluorescence imaging of exosomes in tumor tissue of tumor-bearing nude mice in each group; and B is the detection of fluorescence signals of exosomes in peripheral blood of nude mice at different time points. Figure 9 The graph shows the results of the inhibition of SNU-1 gastric cancer cells by engineered exosomes after treatment in Example 3, verified by colony formation and CCK-8 assays. Among them, A is the crystal violet staining image of SNU-1 cell colony formation; B is the bar chart of the number of SNU-1 cell colonies in each group; C is the curve of SNU-1 cell proliferation activity detected by CCK-8 assay. Figure 10 The results of the nude mouse tumor-bearing models of gastric cancer treated with engineered exosomes alone and in combination with cisplatin in Example 4 are shown; where A is an in vitro image of tumors from each group of tumor-bearing nude mice; and B is a scatter plot of the quantitative tumor weight of the six groups. Figure 11 The images show the pathological changes of major organs and the changes in liver and kidney function indicators in nude mice after treatment with engineered exosomes for gastric cancer using a tumor-bearing model in Example 5. A shows the H&E pathological staining images of the heart, liver, spleen, lungs, and kidneys of each group of nude mice; B shows the statistical chart of quantitative detection of liver and kidney function biochemical indicators in mouse serum. In the accompanying diagrams of the instruction manual, ns represents no significant difference; represent P <0.05; represent P <0.01; represent P <0.001. Detailed Implementation

[0022] This invention provides an engineered exosome that promotes tumor targeting and endosome escape. The membrane surface of the engineered exosome is modified with iRGD peptide and L17E peptide, and the interior is enriched with tumor suppressor siRNA.

[0023] As a specific embodiment, the amino acid sequence of the L17E peptide is shown in SEQ ID NO:1: IWLTALKFLGKHAAKHEAKQQLSKL. In this invention, the L17E peptide is a cationic amphiphilic peptide. In an acidic environment, it can insert into and cleave membrane structures via electrostatic interactions, enabling endosome escape and promoting drug release into the cytoplasm.

[0024] As a specific implementation, the amino acid sequence of the iRGD is shown in SEQ ID NO:2: CRGDKGPDC; the nucleotide sequence encoding the iRGD is shown in SEQ ID NO:4: 5'-TGCAGAGGCGACAAGGGCCCCGACTGC-3'. This invention uses iRGD cyclic peptides to modify exosomes. On the one hand, the RGD motif specifically targets tumors, achieving targeted enrichment of the carrier in tumor tissue and reducing accumulation in normal tissue. On the other hand, iRGD can bind to the NRP-1 receptor to activate the transendothelial transport pathway, breaking through the dense stromal barrier of solid tumors, mediating deep penetration of the carrier into the deep tumor and efficient intracellular internalization, significantly increasing the intratumoral delivery concentration and cellular uptake efficiency of active payloads such as siRNA, and enhancing the therapeutic effect of inhibiting tumor proliferation and invasion.

[0025] In one specific implementation, the anti-cancer effect includes the inhibition of gastric cancer. In a specific embodiment of the present invention, the anti-cancer siRNA is circ512 siRNA. The nucleotide sequence of circ512 is shown in SEQ ID NO:5: 5'-GTGAGTTCCCAGAGAACGGGGCTCCGCGCGAGGTCAGACTGGGCAGGAGATGCCGTGGACCCCGCCCTTCGGGGAGGGGCCCGGCGGATGCCTCCTTTGCCGGAGCTTGGAACAGACTCACGGCCAGCGAAGTGAGTTCAATGGCTGAGGTGAG-3'. circ512 is a tumor-promoting molecule. The engineered exosomes provided by the present invention can significantly inhibit the proliferation of gastric cancer cells by delivering small interfering RNA of the tumor-promoting molecule circ512. It should be noted that the present invention does not specifically limit the anti-cancer siRNA. The description of the anti-cancer siRNA in the present invention is only intended to illustrate the technical concept and implementation path of the present invention to ensure the clarity and completeness of the technical solution, and not to limit the selection of the anti-cancer siRNA to the specific examples listed. Those skilled in the art will understand that any tumor suppressor siRNA can be applied to the technical solution of this invention.

[0026] The present invention also provides a method for preparing the engineered exosomes, comprising the following steps: After infecting cells with a recombinant lentiviral vector, the cell supernatant was collected, separated, and iRGD-modified exosomes were obtained. Tumor suppressor siRNA was introduced into the iRGD-modified exosomes to obtain siRNA-enriched exosomes; The DSPE-PEG-L17E peptide and the enriched siRNA exosomes were mixed and incubated to obtain the engineered exosomes.

[0027] This invention first uses a recombinant lentiviral vector to infect cells, then expands and cultures them, collects the cell supernatant, separates them, and obtains iRGD-modified exosomes.

[0028] In one specific embodiment, the recombinant lentiviral vector includes a basic lentiviral vector and a target protein inserted into the basic lentiviral vector. The target protein includes the Lamp2b protein and iRGD expressed by fusion with the extracellular N-terminus of the Lamp2b protein. The basic lentiviral vector includes the GL188 pcSLenti-EF1-EGFP-CMV-MCS-WPRE vector.

[0029]

[0030] In a specific embodiment of the present invention, the method for constructing a recombinant lentiviral vector includes the following steps: inserting a fusion fragment of the targeting peptide iRGD and the extracellular N-terminal domain of Lamp2b into the upstream SpeI restriction site and the downstream BamHI restriction site of the empty vector GL188 pcSLenti-EF1-EGFP-CMV-MCS-WPRE to obtain the target vector: pcSLenti-EF1-EGFP-CMV-LAMP2-Linker-iRGD-WPRE.

[0031] In one specific implementation, this invention utilizes a linker to connect the N-terminus of the iRGD and Lamp2b proteins. This invention does not impose strict limitations on the specific sequence of the linker; any linker capable of connecting the N-terminus of the iRGD and Lamp2b proteins and exerting its effect can be used in this invention.

[0032]

[0033] This invention does not specifically limit the method for separating iRGD-modified exosomes from the supernatant; the conventional method of this invention can be used. In a specific embodiment of this invention, iRGD-modified exosomes are separated by ultracentrifugation: the culture supernatant is centrifuged sequentially at 300×g for 10 min, 2,000×g for 10 min, and 10,000×g for 30 min at 4°C; the supernatant is then passed through a 100 kDa ultrafiltration tube and centrifuged at 2,000×g for 30 min at 4°C; the concentrated supernatant is further centrifuged at 100,000×g for 3 h at 4°C, the precipitate is washed with PBS, and the centrifugation is repeated for 3 h to obtain the iRGD-modified exosomes (iRGD-ex).

[0034] After obtaining iRGD-modified exosomes, tumor suppressor siRNA was introduced into the iRGD-modified exosomes to obtain siRNA-enriched exosomes.

[0035] In a specific embodiment of this invention, the tumor suppressor siRNA is circ512 siRNA. Next, this invention will use circ512 siRNA as an example to illustrate the preparation method of this invention, but the tumor suppressor siRNA of this invention is not limited to circ512 siRNA.

[0036] The method for introducing tumor suppressor siRNA into the iRGD-modified exosomes is not particularly limited in this invention, and conventional methods in the art can be used. In a specific embodiment of this invention, circ512 siRNA is introduced into the iRGD-modified exosomes by electroporation to obtain siRNA-enriched exosomes (circ512si@iRGD-ex).

[0037] After obtaining the exosomes enriched with siRNA, the DSPE-PEG-L17E peptide and the exosomes enriched with siRNA were mixed and incubated to obtain the engineered exosomes (cir512si@iRGD-L17E-ex).

[0038] In a specific embodiment of the present invention, DSPE-PEG-L17E and the exosomes enriched with siRNA are mixed and incubated; DSPE-PEG-L17E is obtained by coupling DSPE-PEG and L17E peptide. DSPE-PEG is an amphiphilic polymer composed of a hydrophobic DSPE phospholipid tail and a hydrophilic PEG segment covalently linked, and the chemical formula of DSPE-PEG is C0. 45 H 90 NO 10P; The DSPE-PEG is inserted into the phospholipid bilayer to modify the L17E peptide coupled to the exosome membrane surface. In this invention, the L17E peptide is a cationic amphiphilic peptide. In an acidic environment, it can insert into and cleave the membrane structure via electrostatic interactions, enabling endosome escape and promoting drug release into the cytoplasm. Its core function is to help siRNA in exosomes escape from the endosome to the cytoplasm, improving silencing efficiency.

[0039] The mass ratio of the L17E peptide to the exosomes enriched with siRNA is 1:1.

[0040] The incubation time is 2 hours; the incubation temperature is 40°C.

[0041] The present invention also provides the application of the engineered exosomes or engineered exosomes obtained by the preparation method described above in the preparation of drugs for treating tumors.

[0042] The engineered exosomes provided by this invention can significantly inhibit the proliferation of gastric cancer cells by delivering small interfering RNA of the oncogenic molecule circ512 and exert a good anti-tumor effect in vivo. When combined with cisplatin, they exhibit even better efficacy.

[0043] Experiments of this invention demonstrate that the engineered exosomes prepared in this invention can efficiently deliver siRNA to target cells and mediate its biological functions. These engineered exosomes significantly promote endosome escape from siRNA, while surface modification endows the carrier with excellent tumor-targeting enrichment capabilities, prolongs the half-life of siRNA in vivo blood circulation, and reduces nucleic acid degradation. Cellular experiments show that iRGD-modified exosomes loaded with circ512 siRNA (circ512si@iRGD-ex) significantly inhibit the proliferation and colony formation of SNU-1 gastric cancer cells; further modification with L17E to obtain circ512si@iRGD-L17E-ex further enhances its antitumor activity. In vivo animal experiments confirm that circ512si@iRGD-L17E-ex alone can effectively inhibit the growth of subcutaneous xenograft tumors, and the antitumor effect is significantly enhanced when the engineered exosomes are combined with cisplatin, demonstrating a good synergistic effect of combined therapy. Furthermore, in vivo toxicity results confirmed that the engineered exosomes prepared in this invention have good biocompatibility and good safety for in vivo application, and possess translational potential for targeted gene therapy of gastric cancer.

[0044] To further illustrate the present invention, the engineered exosomes that promote tumor targeting and endosome escape, their preparation method, and applications are described in detail below with reference to embodiments. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0045] Unless otherwise specified, the present invention does not have special requirements for the raw materials used in the preparation, and commercially available products well known to those skilled in the art can be used.

[0046] In this embodiment of the invention, HEK293T cells (ATCC cell bank; catalog number: CRL-3749), RAW264.7 cells (ATCC cell bank; catalog number: TIB-71), and HGC-27 cells (Shanghai Enzyme Research Institute Biotechnology Co., Ltd.; catalog number: CC-Y1228) were cultured in DMEM high-glucose medium, and SNU-1 cells (Shanghai Enzyme Research Institute Biotechnology Co., Ltd.; catalog number: CC-Y1478) were cultured in RPMI 1640 medium. All mediums contained 10% fetal bovine serum and 1% penicillin and streptomycin. All cells were grown at 37°C in a 5% CO2 environment.

[0047] Example 1: Construction, extraction and identification of engineered exosomes (1) Construct the plasmid vector pcSLenti-EF1-EGFP-CMV-LAMP2-Linker-iRGD-WPRE for the fusion expression of Lamp2b and iRGD and package it into a lentivirus. The specific construction method of the plasmid vector is as follows: The fusion fragment of the target peptide iRGD and the extracellular N-terminal domain of Lamp2b (as shown in SEQ ID NO:6) was inserted into the upstream SpeI restriction site and the downstream BamHI restriction site of the empty vector GL188 pcSLenti-EF1-EGFP-CMV-MCS-WPRE (Shanghai Heyuan Biotechnology (Group) Co., Ltd.) to obtain the target vector: pcSLenti-EF1-EGFP-CMV-LAMP2-Linker-iRGD-WPRE (Shanghai Heyuan Biotechnology (Group) Co., Ltd.).

[0048] Step (1) of this embodiment was completed by Heyuan Biotechnology Co., Ltd. The plasmid map of the empty vector GL188 pcSLenti-EF1-EGFP-CMV-MCS-WPRE can be found here. Figure 1 The plasmid map of the target vector, pcSLenti-EF1-EGFP-CMV-LAMP2-Linker-iRGD-WPRE, can be found in [link to plasmid map]. Figure 2 .

[0049] (2) HEK293T cells were infected with the target vector pcSLenti-EF1-EGFP-CMV-LAMP2-Linker-iRGD-WPRE, which was packaged as a lentivirus, and then amplified and passaged in large quantities. When collecting the culture supernatant, fetal bovine serum without exosomes was used to prepare the culture medium. Exosomes were extracted from the culture supernatant by ultracentrifugation as follows: The culture supernatant was centrifuged at 300×g for 10 min, 2,000×g for 10 min, and 10,000×g for 30 min at 4℃. The supernatant was then passed through a 100kDa ultrafiltration tube and centrifuged at 2,000×g for 30 min at 4℃. The supernatant was concentrated and centrifuged at 100,000×g for 3 h at 4℃. The precipitate was washed with PBS and centrifuged again for 3 h. Finally, the supernatant was removed and the precipitate was resuspended in PBS to obtain iRGD-modified exosomes (iRGD-ex).

[0050] (3) The exosomes iRGD-ex obtained in step (2) were introduced into circ512 siRNA using electroporation. The nucleotide sequence of the circ512 gene is shown in SEQ ID NO:5. The specific steps of electroporation are as follows: 0.5 μg / μL of FAM-circ512 siRNA (with FAM fluorescent group added before the circ512 siRNA sequence) was mixed with 2×10 11 iRGD-ex particles / mL were mixed at a volume ratio of 1:9, and siRNA was loaded into iRGD-ex via electroporation (electroporation parameters: PpV 110 V, Pp on 3 ms, Pp off 10 ms, Pd V 25 V, Pd on 50 ms, Pd off 50 ms, Pd N 10, capacitance C 940 μF). The mixture was then incubated at 37 °C for 30 min to restore the membrane structure of the exosomes. circ512si@iRGD-ex was obtained by separation and purification using the Exosupur EVRe-purification Pocket Column kit (Beijing Enzekangtai Biotechnology Co., Ltd.).

[0051] (4) Use the amphiphilic polymer DSPE-PEG (chemical formula C 45 H 90 NO 10 P) The L17E peptide (amino acid sequence as shown in SEQ ID NO:1) was conjugated to obtain DSPE-PEG-L17E, which was customized by Shenzhen MeloPEG Technology Co., Ltd.

[0052] The DSPE-PEG-L17E micelle suspension and circ512si@iRGD-ex were stirred at 40℃ for 2 h at a 1:1 mass ratio. The mixture was then purified again using the Exosupur EV Re-purification Pocket Column kit to obtain engineered exosomes circ512si@iRGD-L17E-ex.

[0053] (5) The preparation method of Blank-ex control exosomes is the same as that of iRGD-ex exosomes, except that the target vector is replaced with an empty vector.

[0054] The morphology of Blank-ex control exosomes, iRGD-ex exosomes obtained in step (2), and circ512si@iRGD-L17E-ex engineered exosome solutions obtained in step (4) were observed under transmission electron microscopy (TEM) (Zhenjiang Zhuanbo Testing Co., Ltd.). The particle size distribution was detected using a nanoparticle tracking analyzer, and the expression of exosome markers was detected by Western blot.

[0055] The results are as follows Figure 3 As shown, the engineered exosome circ512si@iRGD-L17E-ex, like the control exosome, exhibits a biconcave disc-like structure with a particle size distribution between 30 and 200 nm, consistent with the typical structural characteristics of exosomes. The results are as follows... Figure 4 As shown, the engineered exosomes and control exosomes expressed positive proteins Alix, Tsg101, and CD63, but did not express the negative protein Calnexin, indicating that the biological characteristics of the engineered exosomes were not altered.

[0056] Example 2: Verifying the targeting ability, siRNA loading efficiency, half-life, and endosome escape ability of engineered exosomes (1) The targeting ability of engineered exosomes to gastric cancer cells and the anti-phagocytic ability of macrophages were observed by exosome labeling and cell uptake experiments. The specific steps were as follows: engineered exosomes (Blank-ex control exosomes obtained in Example 1, iRGD-ex exosomes, or circ512si@iRGD-L17E-ex engineered exosomes) were fluorescently labeled with Dil dye and incubated at 37°C in the dark for 30 min. Then, the labeled exosomes were transferred to a 100 kDa ultrafiltration tube and centrifuged at 1500×g for 30 min at 4°C. The centrifugation was repeated twice to remove unbound dye. SNU-1 and RAW264.7 cells were seeded onto climbing slides. After the cells adhered, 2.5×10⁻⁶ cells were seeded onto the slides. 9The exosomes were processed for 24 h; the slides were washed twice with PBS and fixed with 4% paraformaldehyde for 15 min; the cell nuclei were stained with DAPI for 10 min; the slides were washed three times with PBS and then mounted and observed under a fluorescence microscope.

[0057] The results are as follows Figure 5 As shown, compared with the Blank-ex control group, both iRGD-ex and circ512si@iRGD-L17E-ex had the ability to be significantly taken up by SNU-1 cells, but in macrophages, only circ512si@iRGD-L17E-ex could inhibit the uptake by RAW264.7 cells.

[0058] (2) The knockdown effect of circ512 on gastric cancer cells treated with engineered exosomes for 48 h was detected by real-time quantitative PCR. The forward primer sequence of circ512 was (as shown in SEQ ID NO:7): 5'-GTTCAATGGCTGAGGTGAGGTG-3', and the backward primer sequence was (as shown in SEQ ID NO:8): 5'-GCATCTCCTGCCCAGTCTGAC-3'. The forward primer sequence of the internal reference β-actin was (as shown in SEQ ID NO:9): 5'-CACGAAACTACCTTCAACTCC-3', and the backward primer sequence was (as shown in SEQ ID NO:10): 5'-CATACTCCTGCTTGCTGATC-3'.

[0059] The results are as follows Figure 6 As shown, treatment of SNU-1 cells with engineered exosomes loaded with circ512 siRNA significantly reduced the expression level of circ512, indicating that engineered exosomes can successfully deliver siRNA into cells and exert biological functions.

[0060] (3) The endosome escape efficiency of engineered exosomes was verified by lysosomal labeling and siRNA tracing experiments. The specific steps were as follows: gastric cancer cells were treated with engineered exosomes FAM-circ512si@iRGD-ex or FAM-circ512si@iRGD-L17E-ex. After 12 h, the cells were treated with Lyso Tracker Red (Beyotime Biotechnology Co., Ltd.) for 30 min to label lysosomes. Subsequently, the cells were fixed with paraformaldehyde, stained with nuclei, mounted, and the localization of siRNA and lysosomes was observed under a fluorescence microscope.

[0061] The results are as follows Figure 7As shown, after treating gastric cancer cells with engineered exosomes modified with L17E, the colocalization of siRNA with lysosomes decreased, while the amount of siRNA in the cytoplasm and nucleus increased, indicating that engineered exosomes can enhance the endosome escape of siRNA.

[0062] (4) Constructing a nude mouse tumor-bearing model to verify the tumor targeting and blood half-life of engineered exosomes in vivo. The specific steps are as follows: First, the engineered exosomes are stained with DiR fluorescence, the process of which is the same as that of Dil labeling. Four-week-old BALB / c nude mice are selected, and 2×10⁻⁶ cells are injected into the right axilla of the forelimb. 6 One HGC-27 cell. Once the tumor has grown to a suitable size, inject 1×10⁻⁶ HGC-27 cells via the tail vein. 10 DiR-labeled exosomes (Blank-ex control exosomes, iRGD-ex exosomes, or circ512si@iRGD-L17E-ex engineered exosomes obtained in Example 1) were used to collect blood from nude mice via the orbital venous plexus at different time points for in vivo imaging to observe the fluorescence intensity. Finally, the nude mice were euthanized and dissected to remove tumor tissue, and the tumor fluorescence intensity of different treatment groups was observed using a small animal in vivo imaging system.

[0063] The results are as follows Figure 8 As shown, the fluorescence of iRGD-ex and circ512si@iRGD-L17E-ex in tumor tissue was stronger than that of the Blank-ex group, and the blood fluorescence of the circ512si@iRGD-L17E-ex group was maintained for a longer time, indicating that engineered exosomes have stronger tumor tissue targeting and prolong their half-life in circulating blood.

[0064] Example 3: Verification of the ability of engineered exosomes to inhibit the proliferation of gastric cancer cells The effect of engineered exosomes on the proliferation of gastric cancer cells was detected using a clonogenic and CCK-8 assay. The specific steps are as follows: 1×10⁻⁶ exosomes were used... 10 Engineered exosomes (Blank-ex control exosomes, iRGD-ex exosomes, or circ512si@iRGD-L17E-ex engineered exosomes obtained in Example 1; PBS was used as a blank control) were used to treat SNU-1 cells seeded in six-well plates for 48 h. Cells were then digested and seeded at 1,000 cells each into 3.5 cm culture dishes and 96-well plates. For the colony formation assay, the culture medium was changed every 3 days for 10 consecutive days. Cell colony size and number were observed by crystal violet staining. For the CCK-8 assay, after cell attachment, the culture medium was replaced with complete medium containing 10% CCK-8 reagent (Novizan Biosciences). After incubation for 2 h, absorbance was measured using a microplate reader for 4 consecutive days.

[0065] The results are as follows Figure 9 As shown, compared with the PBS and iRGD-ex groups, circ512si@iRGD-ex inhibited the clonogenic ability and proliferation of SNU-1 cells, while circ512si@iRGD-L17E-ex had a more significant effect on inhibiting gastric cancer proliferation.

[0066] Example 4: Verifying the antitumor effect of engineered exosomes in animal models The therapeutic effect of engineered exosomes in vivo was verified using a nude mouse tumor-bearing model. The specific steps were as follows: Four-week-old BALB / c nude mice were randomly divided into 6 groups, and each group received an injection of 2×10⁻⁶ exosomes into the right axilla of the forelimb. 6 HGC-27 cells were used to create the model.

[0067] One week after modeling, Group 1 served as a blank control by injecting PBS buffer solution via tail vein; Group 2 received 1×10⁻⁶ PBS via tail vein. 10 One iRGD-ex exosome; Group 3 received 1×10 via tail vein injection. 10 One circ512si@iRGD-ex exosome; Group 4 received 1×10 via tail vein injection. 10 Group 5 received circ512si@iRGD-L17E-ex exosomes; Group 6 received 120 μg of cisplatin via intraperitoneal injection; Group 7 received 1×10 μg of cisplatin via tail vein and intraperitoneal injection respectively. 10 One circ512si@iRGD-L17E-ex exosome and 120 μg of cisplatin. Injected every three days. After 4 weeks, nude mice were anesthetized and euthanized by cervical dislocation. The tumors were removed and their size and weight were recorded.

[0068] The results are as follows Figure 10 As shown, both circ512si@iRGD-ex and circ512si@iRGD-L17E-ex significantly inhibited the growth of subcutaneous tumors, with the latter exhibiting stronger inhibitory activity. When circ512si@iRGD-L17E-ex was combined with cisplatin, the growth of subcutaneous tumors was more significantly inhibited, indicating that the engineered exosomes prepared have significant anticancer effects in vivo, and that the combination with cisplatin treatment has a better therapeutic effect.

[0069] Example 5: Evaluation of the biosafety of engineered exosomes After the tumor-bearing model was treated, the main organs (heart, liver, spleen, lungs, and kidneys) of the nude mice were removed for H&E staining to examine the pathological changes in the tissue structure. Blood samples were collected from mice in each treatment group in Example 4 to monitor the changes in liver and kidney function indicators in the serum.

[0070] The results are as follows Figure 11As shown, no significant pathological changes were observed in the heart, liver, spleen, lung, and kidney tissues of all exosome treatment groups, and no pathological increases were observed in the serum liver function (ALT, AST) and kidney function indicators (Crea, Urea) of mice. However, the kidney tissues of mice treated with cisplatin alone and in combination showed changes such as structural disorder, renal tubular dilation, and epithelial cell degeneration, while the levels of kidney function indicators increased. This is consistent with the nephrotoxic side effects of cisplatin treatment in clinical practice, indicating that the engineered exosomes prepared in this invention have good biocompatibility in vivo.

[0071] In summary, the engineered exosomes prepared in this invention have enhanced tumor targeting, prolonged circulating half-life, and efficient endosome escape ability. The circ512 siRNA delivered by electroporation technology significantly inhibits the proliferation of gastric cancer cells at the cellular level, and shows enhanced gastric cancer intervention effect and cisplatin combination therapy potential at the animal level, without significant tissue damage or hepatotoxicity to organs.

[0072] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An engineered exosome that promotes tumor targeting and endosome escape, characterized in that, The engineered exosomes have their membrane surface modified with iRGD peptide and L17E peptide, and are enriched with tumor suppressor siRNA inside.

2. The engineered exosomes according to claim 1, characterized in that, The amino acid sequence of the L17E peptide is shown in SEQ ID NO:1; The amino acid sequence of the iRGD peptide is shown in SEQ ID NO:

2.

3. The engineered exosomes according to claim 1, characterized in that, The cancer suppression includes the inhibition of gastric cancer.

4. The method for preparing engineered exosomes according to any one of claims 1 to 3, characterized in that, Includes the following steps: After infecting cells with a recombinant lentiviral vector, the cell supernatant was collected, separated, and iRGD-modified exosomes were obtained. Tumor suppressor siRNA was introduced into the iRGD-modified exosomes to obtain siRNA-enriched exosomes; The DSPE-PEG-L17E peptide and the enriched siRNA exosomes were mixed and incubated to obtain the engineered exosomes.

5. The preparation method according to claim 4, characterized in that, The recombinant lentiviral vector includes a basic lentiviral vector and a target protein inserted into the basic lentiviral vector. The target protein includes Lamp2b protein and iRGD expressed by fusion with the extracellular N-terminus of Lamp2b protein. The nucleotide sequence encoding the Lamp2b protein is shown in SEQ ID NO:

3.

6. The preparation method according to claim 4, characterized in that, The cells include HEK293T cells.

7. The preparation method according to claim 4, characterized in that, The method of importation includes electroporation.

8. The preparation method according to claim 4, characterized in that, The mass ratio of the DSPE-PEG-L17E peptide to the exosomes enriched with siRNA is 1:

1.

9. The preparation method according to claim 4, characterized in that, The incubation time is 2 hours; the incubation temperature is 40°C.

10. The use of engineered exosomes according to any one of claims 1 to 3 or engineered exosomes obtained by the preparation method according to any one of claims 4 to 9 in the preparation of drugs for treating tumors.

Images