Anti-tnfr1 nanobodies and uses thereof

Abstract

This invention relates to the field of nanobody technology and discloses an anti-TNFR1 nanobody and its applications. The anti-TNFR1 nanobody comprises CDR1 with the amino acid sequence shown in SEQ ID NO:1, CDR2 with the amino acid sequence shown in SEQ ID NO:2, and CDR3 with the amino acid sequence shown in SEQ ID NO:3, wherein the CDRs are defined according to the IMGT numbering scheme. This invention also includes an anti-TNFR1 nanobody-drug conjugate containing the above-mentioned nanobody, a nucleotide encoding the above-mentioned nanobody, an expression vector containing the above-mentioned nucleotide, and a host cell. The anti-TNFR1 nanobody of this invention can specifically bind to TNFR1 and does not cross-react with homologous receptors such as TNFR2 and DR5, exhibiting potent anti-inflammatory activity and blocking necrotic cell death, and can be used to prepare drugs for the detection, treatment, or prevention of TNFR1-related diseases.

Description

Technical Field

[0001] This invention relates to the field of nanobody technology, specifically to an anti-TNFR1 nanobody, a conjugate, a nucleic acid molecule encoding the nanobody, an expression vector, a host cell, and its application in the preparation of reagents for detecting TNFR1 or drugs for treating TNFR1-related diseases. Background Technology

[0002] Tumor necrosis factor-α (TNFα) is an important cytokine regulating inflammation, immune responses, and programmed cell death. Its biological functions are mainly mediated by two receptors: tumor necrosis factor receptor 1 (TNFR1) and TNFR2. TNFR1 is widely expressed and can activate inflammatory signaling pathways such as NF-κB and MAPK after ligand binding. In specific cellular environments, it can induce necrotizing apoptosis through RIPK1, RIPK3, and MLKL. Abnormal TNFR1 signaling is associated with various pathological processes, including rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, psoriasis, inflammatory bowel disease, ischemia-reperfusion injury, ischemic stroke, acute liver injury, ankylosing spondylitis, diabetic nephropathy, colorectal cancer, and neuroinflammatory diseases.

[0003] Current clinical anti-TNFα drugs (such as adalimumab, estaniercept, cerolizumab pegol, etc.) mainly inhibit inflammation by neutralizing TNFα. Traditional TNFα neutralizers non-selectively block the binding of TNFα to TNFR1 and TNFR2. While inhibiting pathological signals, they also disrupt the normal physiological function of TNFR2, potentially interfering with TNFR2-related immune regulation, tissue repair, and protective signaling, leading to adverse reactions such as increased infection risk and decreased tissue repair capacity. Therefore, selectively inhibiting TNFR1 while preserving TNFR2 function as much as possible is an important direction in the development of TNF axis drugs.

[0004] While selective antibodies, single-domain antibodies, and small molecule regulatory strategies for TNFR1 have been reported, several limitations remain. For example, traditional monoclonal antibodies have large molecular weights and limited tissue penetration; some downstream small molecule inhibitors only block necroptosis or specific downstream nodes and cannot simultaneously block inflammatory and cell death signals at the receptor level; and reported TNFR1 nanobodies also suffer from insufficient affinity and short in vivo half-life, which limits their clinical application. Summary of the Invention

[0005] This invention provides a selectively binding anti-TNFR1 nanobody that can block TNFα-TNFR1 signaling at the receptor level, inhibit TNFR1-mediated NF-κB inflammatory signaling and RIPK1-RIPK3-MLKL necrotizing apoptosis signaling, and does not significantly bind to TNFR2 or DR5 under the test conditions, and does not exhibit significant ligand-independent TNFR1 agonist activity.

[0006] The technical solution of the present invention is as follows: In one aspect, the present invention provides an anti-TNFR1 nanobody, the nanobody comprising CDR1 with an amino acid sequence as shown in SEQ ID NO:1, CDR2 with an amino acid sequence as shown in SEQ ID NO:2, and CDR3 with an amino acid sequence as shown in SEQ ID NO:3, wherein the CDRs are defined according to the IMGT numbering scheme.

[0007] As one embodiment, the nanobody comprises the amino acid sequence shown in SEQ ID NO:4, or a variant that has at least 80% sequence identity with the conserved structural domains of the nanobody and retains TNFR1 binding activity.

[0008] In one aspect of the present invention, the above-mentioned nanobody is humanized, wherein the humanized nanobody comprises the VH framework region of human immunoglobulin.

[0009] As one embodiment, the humanized antibody comprises the amino acid sequence shown in SEQ ID NO:5.

[0010] As one implementation, the nanobody of the present invention is fused with a serum albumin binding domain, an Fc fragment, or polyethylene glycol to prolong its in vivo half-life.

[0011] As one embodiment, the nanobodies of the present invention are in monovalent, divalent, trivalent or tetravalent form, and the nanobodies are linked together by flexible linker peptides.

[0012] The present invention also provides an anti-TNFR1 nanobody-drug conjugate comprising the above-mentioned anti-TNFR1 nanobody and an effector molecule conjugated to the anti-TNFR1 nanobody, wherein the effector molecule is selected from cytotoxic drugs, detectable markers or immunomodulators.

[0013] The present invention also provides a biomaterial comprising isolated nucleic acid molecules, expression vectors or host cells, wherein the nucleic acid molecules encode the aforementioned nanobody, and the expression vectors or host cells contain the nucleic acid molecules.

[0014] As one embodiment, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:6 or SEQ ID NO:8. The nucleic acid molecule provides the genetic basis for the recombinant expression of the nanobody or its antigen-binding fragment, facilitating large-scale preparation via genetic engineering. The expression vector and the host cell can be used for the recombinant expression of the nanobody, achieving stable and efficient protein production.

[0015] The present invention also provides the use of the above-mentioned nanobodies, anti-TNFR1 nanobodies-drug conjugates, or the biomaterials described herein in the preparation of medicaments for detecting TNFR1 or for treating TNFR1-related diseases.

[0016] Compared with the prior art, the technical advantages of the present invention are as follows: This invention provides a high-affinity anti-TNFR1 nanobody. This anti-TNFR1 nanobody specifically binds to TNFR1 (KD value in the nanomolar range) and does not cross-react with homologous receptors such as TNFR2 and DR5, achieving precise receptor-level antagonism. The anti-TNFR1 nanobody exhibits a slower dissociation rate and stronger functional activity, simultaneously and potently inhibiting TNFα-induced NF-κB pathway activation and the transcription and secretion of pro-inflammatory cytokines (TNFα, IL-1β, IL-6, IL-8). Furthermore, in the HT-29 colonic epithelial cell necrosis-apoptosis model, it significantly reduces the phosphorylation levels of RIPK1, RIPK3, and MLKL, blocking necrotic cell death. Further, this invention modifies the anti-TNFR1 nanobody into a bivalent form. The bivalent anti-TNFR1 nanobody exhibits enhanced in vitro functional inhibitory effects, demonstrating excellent inhibitory efficacy in NF-κB reporter gene experiments and inflammatory cell models, while retaining strict TNFR1 selectivity.

[0017] This invention provides a TNFR1-specific humanized nanobody antagonist with dual-pathway inhibitory activity. It has a compact structure, strong tissue penetration, and low immunogenicity. It not only overcomes the limitations of existing treatment strategies, but also provides a novel candidate biological agent and structural basis for targeted therapy of TNFR1-related diseases (such as rheumatoid arthritis and inflammatory bowel disease). It can be used to prepare drugs for the treatment or prevention of TNFR1-mediated inflammation and necroptosis-related diseases. Attached Figure Description

[0018] Figure 1 This is a flowchart illustrating the screening and engineering process of this invention.

[0019] Figure 2To detect the blocking activity of human TNFR1-targeting nanobodies against TNF-TNFR1 binding. Using NR Nb (unrelated nanobodies) and Buffer as controls, the blocking effect of each nanobodies was evaluated by competitive ELISA. *** indicates a significant difference compared to the control group (P<0.001).

[0020] Figure 3 The amino acid sequences of the parental nanobody Nb1 and the humanized nanobody huNb1 were compared.

[0021] Figure 4 This is a schematic diagram of the huNb1-huNb1 bivalent structure.

[0022] Figure 5 Characterization and functional activity of nanobodies targeting TNFR1.

[0023] In this study, (AB) analyzed the binding kinetics of Nb1 (A), humanized Nb1 (huNb1, B), and TNFR1 using biolayer interferometry (BLI). The curves represent different concentrations of nanobodies (15.63 nM to 500 nM), including raw data curves and fitted curves. The equilibrium dissociation constant (KD) and goodness-of-fit (R²) are labeled for each nanobodies.

[0024] (C) The binding specificity of humanized nanobodies was assessed by BLI. The binding shifts of huNb1 with TNFR2 or DR5 were measured, and the results showed that they had no significant cross-reactivity with these homologous receptors.

[0025] (D) After incubation under specified conditions, the thermal stability and anti-aggregation properties of huNb1 and huNb1-huNb1 were determined by nano-differential scanning fluorescence spectroscopy (nanoDSF) and expressed as Tm values.

[0026] (E) Detection of ligand-independent agonistic activity of humanized nanobodies. Under TNFα-free conditions, the effects of different concentrations (10-20000 nM) of huNb1 and bivalent huNb1 (huNb1-huNb1) on luciferase activity in HeLa NF-κB reporter cells were investigated. PBS was used as a blank control, and the TNF-stimulated group was used as a positive control. The results showed that neither huNb1 nor bivalent huNb1 exhibited ligand-independent NF-κB pathway agonistic activity, demonstrating good safety.

[0027] (FG) Species-specific validation of humanized nanobody against TNF-induced NF-κB activation in mice. (F) Saturation curve of TNFα (mTNFα)-induced activation of L929-NF-κB reporter cells in mice, with calculated EC50. 50=17.59 nM, verifying the reliability of the mouse cell experimental system; (G) Under mTNFα stimulation, different concentrations (10-10000 nM) of huNb1, huNb21, bivalent huNb1 (huNb1-huNb1), and adalimumab failed to effectively inhibit mTNFα-induced signal transduction. With PBS as a blank control, the results showed that the huNb1 series nanobodies only recognize human TNFR1 and not mouse TNFR1, exhibiting strict species specificity.

[0028] Figure 6 This study analyzed the inhibitory activity of humanized nanobodies against TNFα-induced NF-κB pathway activation. (A) shows the dose-dependent inhibition curves of huNb1 and huNb21 on TNFα-induced NF-κB pathway activation. The degree of pathway activation is reflected by luciferase activity (RLU%), with the x-axis representing the logarithm of nanobody concentration (LgNb Concentration, nM). (B) shows the IC50 values ​​of huNb1 and huNb21. 50 The values ​​are compared in the bar chart. *** indicates a highly significant difference between the two groups (P<0.001), and the inhibitory efficacy of huNb1 is significantly better than that of huNb21.

[0029] Figure 7 This section compares the inhibitory activities of bivalent huNb1-huNb1 and adalimumab on the NF-κB pathway. (A) shows the dose-dependent inhibition curves of bivalent huNb1 (huNb1-huNb1) and the clinical drug adalimumab on TNF-induced NF-κB pathway activation. Luciferase activity (RLU%) reflects the degree of pathway activation, with the x-axis representing the logarithm of protein concentration (Lg Protein Concentration, nM). (B) shows the IC50 values ​​of bivalent huNb1 and adalimumab. 50 The bar chart shows the values, with ns indicating no significant difference between the two groups (P>0.05), indicating that the inhibitory efficacy of bivalent huNb1 is comparable to that of adalimumab.

[0030] Figure 8 This study investigated the dose-dependent inhibition of IL-6 mRNA expression in THP-1 cells by nanobodies. THP-1 cells were treated with specified concentrations of huNb1, huNb21, huNb1-huNb1, or adalimumab, and the relative expression levels of IL-6 mRNA were detected by qPCR. Dose-response curves were fitted to calculate the IC50. 50 Values. Data are the mean ± standard deviation of three independent experiments.

[0031] Figure 9This study investigated the use of TNFR1-specific nanobodies to inhibit the expression and secretion of pro-inflammatory cytokines in human monocytes. The results showed that (AD) relative mRNA levels of TNFα (A), IL-1β (B), IL-6 (C), and IL-8 (D) were determined after treatment with huNb1, huNb21, bivalent huNb1 (huNb1-huNb1), or adalimumab in THP-1-derived macrophages stimulated with TNFα and pre-activated with IFNγ, respectively. All nanobodies significantly inhibited cytokine transcription, with huNb1 and bivalent huNb1 showing stronger inhibitory effects on IL-1β and IL-8 than adalimumab. (EH) corresponds to the levels of secreted TNFα (E), IL-1β (F), IL-6 (G), and L-8 (H) proteins as detected by ELISA. Nanobody treatment significantly reduced cytokine release, with monovalent and bivalent huNb1 exhibiting similar inhibitory efficacy. Although adalimumab effectively attenuated the secretion of TNFα and IL-6, its inhibitory effect on IL-1β and IL-8 was weaker than that of nanobodies. Data are the mean ± standard deviation of three independent experiments. One-way ANOVA combined with multiple comparison correction was used to assess statistical significance (***P < 0.001; ns, no significant difference).

[0032] Figure 10 To protect human intestinal epithelial cells from TSZ-induced necrotizing apoptosis using TNFR1 nanobody. (AB) Representative bright-field / PI staining images of HT-29 cells treated with TSZ (TNFα + SM-164 + z-VAD-fmk) for 4 h (A) or 6 h (B) in the presence of a specified inhibitor. Red dotted signals represent PI-positive (impaired membrane integrity) cells. TSZ induces extensive cell death, while huNb1, bivalent huNb1, and adalimumab significantly reduce the PI positivity rate; huNb21 shows only a slight protective effect. Scale bar: 100 μm.

[0033] Figure 11 The TNFR1 nanobody was used to protect human intestinal epithelial cells from TSZ-induced necrotizing apoptosis. (AB) corresponds to... Figure 10 Quantitative analysis of PI-positive cells at 4 h and 6 h in samples A and B. Data are mean ± standard deviation, n=3; (C) Morphology of HT-29 cells after 6 hours of treatment with different nanobodies / adalimumab. Scale bar: 100 μm.

[0034] Figure 12Morphological observation of MEF cells treated with TSZ. (A) Morphology of MEF cells at 2 hours. Scale bar: 50 μm; (B) Morphology of MEF cells at 4 hours, including the control group and different treatment groups. Scale bar: 50 μm.

[0035] Figure 13 This study evaluated the protective activity and safety of TNFR1 nanobody against HT-29 cells. The (AC) cell viability assay was used to quantitatively assess the protective effects of huNb1, bivalent huNb1 (huNb1-huNb1), and adalimumab against TSZ-induced cell necrosis, and the EC50 was calculated. 50 The concentrations were 30.22 μM, 8.32 μM, and 6.643 μM, respectively, indicating that the protective activity of bivalent huNb1 and adalimumab was significantly better than that of monovalent huNb1; (D) Safety assay of HT-29 cells: Under TSZ-free conditions, after treatment with huNb1, bivalent huNb1, and adalimumab for 4 h, the cell morphology was not significantly different from that of the PBS control group, and there was no significant cytotoxicity. Scale bar: 100 μm.

[0036] Figure 14 This study investigated the inhibitory effect of TNFR1 nanobody on the TSZ-induced necroptosis pathway. Immunoblotting analysis of necroptosis markers was performed on HT-29 cells after 4 h of TSZ treatment. TSZ significantly induced phosphorylation of RIPK1 (S166), RIPK3 (S227), and MLKL (S358), while huNb1, bivalent huNb1, and adalimumab reduced these phosphorylation levels; total protein levels remained largely unchanged; GAPDH served as a control. Detailed Implementation

[0037] The present invention will be further described in detail below with reference to specific embodiments. The described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the protection scope of the present invention.

[0038] The term "nanobody" as used in this article refers to a single-domain antigen-binding protein (VHH) derived from camel heavy chain antibodies. It consists solely of the heavy chain variable region (12-15 kDa), containing four framework regions (FR1-FR4) and three complementarity-determining regions (CDRs), namely CDR1, CDR2, and CDR3. The CDR regions directly participate in antigen recognition and binding. Nanobodies possess advantages such as small molecular weight, high stability, strong tissue penetration, low immunogenicity, and ease of prokaryotic expression. They can be optimized through humanization, polymerization, or fusion modification, and are widely used in the fields of therapy, diagnostics, and biotechnology. Nanobodies are also called single-domain antibodies (sdAbs), and the two terms are used interchangeably.

[0039] This invention provides an anti-TNFR1 nanobody, named Nb1. The nanobody comprises CDR1 (amino acid sequence as shown in SEQ ID NO:1), CDR2 (amino acid sequence as shown in SEQ ID NO:2), and CDR3 (amino acid sequence as shown in SEQ ID NO:3), where the CDRs are defined according to the IMGT numbering scheme. The CDR regions of the anti-TNFR1 nanobody can specifically recognize different epitopes on TNFR1. Experiments show that mutations at W136, Q142, H134, C105, E108, and F144 significantly reduce the binding affinity of Nb1, with binding rates all <40%, indicating that these residues are important components of the Nb1 binding epitope. Among them, the W136A and C105A mutations have the most significant impact on Nb1 binding, reducing the binding rate to 12% and 15%, respectively, and are the core sites of the Nb1 binding epitope. Structural comparison with the TNFR1-TNFα complex further reveals that Nb1 occupies the highly overlapping binding surface of TNFR1 with TNFα through its CDR3 region, directly blocking the interaction between TNFα and TNFR1 through steric hindrance. This provides a direct structural basis for their antagonistic activity. The Nb1 nanobody exhibits strong TNFα blocking activity and does not cross-react with homologous receptors such as TNFR2 and DR5, achieving precise receptor-level antagonism.

[0040] This invention also provides the amino acid sequence of the aforementioned anti-TNFR1 nanobody, as shown in SEQ ID NO:4, or a variant having at least 80% sequence identity with the conserved structural domains of the nanobody and retaining TNFR1 binding activity. The conserved structural domains of nanobodies (Nb) mainly refer to framework regions (FRs), especially the FR2 region. The CDR region of the nanobody endows it with the ability to recognize hidden antigenic epitopes. The conserved structural domains of the nanobody (especially FR2) are key to its structural stability and functional specificity, and are also an important foundation for its use as a novel biotherapy and diagnostic tool. The conservation of the FR2 region also provides a key target for its humanization modification; by modifying the key amino acids in FR2 that differ from human VH, the immunogenicity of the nanobody can be reduced.

[0041] In some embodiments, the nanobody has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the conserved domains of the amino acid sequence shown in SEQ ID NO:4, and retains variants with TNFR1 binding activity.

[0042] As used herein, "humanized antibody" refers to a nanobody in which the variable frame region (FR region) is replaced with a human sequence while retaining the complementarity-determining region (CDR region) derived from a non-human species, thereby reducing the immunogenicity of the antibody. In one embodiment, the humanized antibody of the present invention retains the CDR sequence shown in SEQ ID NO:1-3 and replaces it with a human immunoglobulin frame region. In some embodiments, the frame region is selected from the IGHV3-23, IGHV1-2, or IGHV4-34 gene families. During the modification process, the core amino acid residues of the CDR region are strictly preserved, and no mutations affecting antigen recognition are introduced. At the same time, the immunogenicity-related characteristics of the molecule are optimized by the humanization of the frame region, ensuring that the binding specificity and affinity of the nanobody to TNFR1 are not affected.

[0043] In some embodiments, the humanized antibody is huNb1, with the amino acid sequence shown in SEQ ID NO:5 and the nucleotide sequence encoding huNb1 shown in SEQ ID NO:6. The expression yield and final product purity of the humanized antibody huNb1 are consistent with the parent nanobody, and no functionally related physicochemical properties are altered due to sequence modification. The humanized antibody huNb1 of this invention can bind to human TNFR1-ECD with nanomolar affinity, exhibiting slow dissociation and more stable binding kinetics. It shows a clear binding signal to human TNFR1-ECD, but no detectable binding signal to TNFR2-ECD or DR5-ECD, and no significant cross-reactivity is observed even in the micromolar concentration range.

[0044] This invention provides various nanobodies with extended half-lives to overcome the drawback of nanobodies being rapidly cleared by the kidneys due to their small molecular weight. In some embodiments, the nanobodies are fused with a serum albumin-binding domain, an Fc fragment, or polyethylene glycol. As one embodiment, an anti-TNFR1 nanobodies are fused with an anti-human serum albumin nanobodies via a flexible linker peptide (such as G4S)3 to form a bispecific molecule. This fusion protein reversibly binds to serum albumin, utilizing the long circulating half-life of albumin to extend the in vivo retention time of the nanobodies while maintaining high affinity for TNFR1 blocking. As another embodiment, an anti-TNFR1 nanobodies are fused with human IgG1 Fc (containing an LALA mutation to eliminate ADCC effects) to form a bivalent antibody-like structure. The Fc region extends the half-life to over 72 hours through an FcRn-mediated recycling mechanism, while simultaneously enhancing effector function. As one implementation method, site-directed PEGylation (such as C-terminal cysteine-specific modification) links 5-40 kDa PEG chains, increasing the hydrodynamic radius, reducing renal filtration rate, and extending the half-life to 24-48 hours. All of these modifications preserve the antigen-binding activity and stability of the nanobody, making it suitable for long-term drug delivery in chronic diseases.

[0045] This invention provides anti-TNFR1 nanobodies in various valence states, such as bivalent, trivalent, or tetravalent nanobodies, which are polymerized through flexible linker peptides to enhance binding affinity and biological effects. The bivalent nanobodies comprise a first nanobodiment specifically binding to a first antigen and a second nanobodiment specifically binding to a second antigen. The first antigen is TNFR1, and the second antigen may be the same as or different from the first antigen. The first and second nanobodies are linked by a linker peptide. In some embodiments, the linker peptide has the amino acid sequence GSGGSG, is 6 amino acids long, and is a Gly / Ser-rich flexible linker peptide with a theoretical molecular weight of approximately 420.4 Da. This linker is used to connect two huNb1 units to form a huNb1-linker-huNb1 bivalent construct. Specifically, the amino acid sequence of huNb1-huNb1 is shown in SEQ ID NO:7, and the nucleotide sequence encoding huNb1-huNb1 is shown in SEQ ID NO:8. After huNb1 is constructed into a bivalent form huNb1-huNb1, it exhibits higher structural stability, further enhancing the anti-inflammatory and anti-necrosis / apoptosis dual activities of the nanobody, while retaining its inherent advantages of small molecular weight and high receptor selectivity.

[0046] This invention provides an anti-TNFR1 nanobody-drug conjugate (NDC), utilizing the high tissue permeability of nanobodies and the upregulation of TNFR1 expression in the inflammatory microenvironment to achieve targeted delivery. The NDC comprises the aforementioned anti-TNFR1 nanobody and an effector molecule conjugated to it, wherein the effector molecule is selected from cytotoxic drugs, detectable markers, or immunomodulators. In some embodiments, the nanobody is conjugated to a microtubule inhibitor (such as aurestatin MMAE, metansine DM1) or a DNA damaging agent (such as chaziomycin, PBD dimer) via a cleavable linker (such as Val-Cit-PABC). Within target cells, cathepsin B cleaves the linker to release the cytotoxic drug, killing inflammatory cells or tumor cells overexpressing TNFR1 while reducing toxic side effects on normal tissues. As one embodiment, the detectable marker is one or more of horseradish peroxidase (HRP), alkaline phosphatase, luciferin, biotin, colloidal gold, or a radioactive isotope. The conjugate combines the antibody's specific recognition capability with a detectable signal, and can be directly used to establish various forms of immunoassay methods. In some embodiments, the nanobody is combined with a fluorescent label (such as Cy5, IRDye) or a radioactive isotope (such as... 64 Cu、 89 Zr is used for PET imaging, or 177Lu (used for targeted radiotherapy) or enzyme labeling (such as horseradish peroxidase) is conjugated for in vitro and in vivo detection and diagnosis of TNFR1-positive lesions. In some embodiments, nanobodies are conjugated to TLR agonists (such as CpG, imiquimod) or STING agonists to direct immune stimulation signals to inflammatory sites with high TNFR1 expression, thereby remodeling the local immune microenvironment.

[0047] This invention provides a biomaterial comprising isolated nucleic acid molecules, an expression vector, or a host cell. The nucleic acid molecules encode the anti-TNFR1 nanobody described herein, and the expression vector or host cell contains the nucleic acid molecules. In some embodiments, the nucleotide sequence of the nucleic acid molecules is as shown in SEQ ID NO:6 or SEQ ID NO:8. In some embodiments, the vector of this invention is, for example, a plasmid, a granulosome, or a bacteriophage. The term "host cell" as used herein refers to a cell used to express the antibody of this invention or its antigen-binding fragment, including but not limited to prokaryotic cells such as *Escherichia coli* cells, and eukaryotic cells such as yeast cells, insect cells, plant cells, and animal cells (such as mammalian cells, such as mouse cells, human cells, etc.). In a preferred embodiment, the host cell is *Pichia pastoris* X-33, *Escherichia coli*, or *Expi293F* cells.

[0048] The anti-TNFR1 nanobodies, anti-TNFR1 nanobodies-drug conjugates, and the aforementioned biomaterials of the present invention, when used in combination with pharmaceutically acceptable carriers and / or excipients, can be used to prepare pharmaceutical compositions for the detection or treatment of TNFR1-related diseases. The pharmaceutical compositions may also contain additional pharmaceutically active agents, which may be provided as separate components or as components in a mixture, and may be administered simultaneously, separately, or sequentially.

[0049] This invention relates to the use of the nanobodies, the anti-TNFR1 nanobodies-drug conjugates, or the biomaterials described herein in the preparation of reagents for detecting TNFR1 or drugs for treating TNFR1-related diseases. TNFR1-related diseases include, but are not limited to, autoimmune diseases, inflammatory bowel disease, ischemic diseases, liver diseases, and tumors. Autoimmune diseases include rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), and multiple sclerosis (MS); inflammatory bowel diseases include Crohn's disease (CD) and ulcerative colitis (UC); ischemic diseases include ischemia-reperfusion injury (IRI) and ischemic stroke; liver diseases include acute liver failure (ALF); and tumors include colorectal cancer. TNFR1-related diseases also include psoriasis, ankylosing spondylitis, diabetic nephropathy, and many other diseases.

[0050] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and should not be construed as limiting the scope of protection of the present invention.

[0051] Example 1: Screening of anti-human TNFR1 nanobodies This embodiment employs a three-step screening strategy to obtain specific candidate nanobodies: First, preliminary screening based on magnetic beads enriches nanobodies that can bind to the extracellular domain (ECD) of TNFR1 from the nanobodies library; then, a second round of magnetically activated cell sorting (MACS screening) combined with flow cytometry analysis is performed to further purify the candidate nanobodies and remove strains with weak binding ability; finally, fluorescence activated cell sorting (FACS) is used to obtain human TNFR1-ECD-targeting nanobodies with high specificity and high binding ability.

[0052] Preliminary screening based on magnetic beads: Yeast surface-displaying nanobody library (NbLib) frozen at -80°C was removed and thawed in a 30°C water bath. After complete thawing, an appropriate amount of bacterial culture was aspirated using a sterile pipette and inoculated into 1L SD / -Trp glucose medium (medium composition: 3.8g tryptophan-deficient synthetic mixed medium, 6.7g yeast nitrogen source basal medium, 20g D-(+)-glucose, 10 mL penicillin-streptomycin mixture, pH adjusted to 4.6). The inoculated medium was placed in a shaker at 30°C and 250 rpm for 12 hours to amplify the yeast library. After amplification, the OD600 value of the bacterial culture was measured, and the volume of the yeast library was estimated using a serial dilution plating method. The amplified bacterial culture was diluted to OD600 = 1 with SD / -Trp glucose medium and cultured until OD600 = 2-3. Then, it was transferred to SD / -Trp galactose medium (the composition of which was the same as SD / -Trp glucose medium, except that glucose was replaced with galactose and the pH was adjusted to 6.0) and induced at 25°C for 36 hours to allow the nanobodies to express on the yeast surface. In the first round of screening, yeast cell pellets corresponding to one OD600 value were collected and washed with pre-cooled screening buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 0.1% BSA, 5 mM maltose). After washing, Alexa Fluor® 488 anti-HA.11 antibody (BioLegend, catalog number #901509) was added, and the surface expression of the nanobodies was analyzed by flow cytometry. Typically, 10-15% of the cells were HA-positive. To remove non-specifically bound yeast cells, 500 OD600 units of induced yeast cells were pre-cleaned by incubation with 200 μL of His-tagged magnetic beads (Invitrogen, catalog number #10103D). The pre-cleaned yeast cells were then incubated with 1 μM recombinant human TNFR1-ECD. After incubation, fresh magnetic beads were added for positive selection. Yeast cells binding to the magnetic beads were identified as potential TNFR1-specific nanobody expression yeast cells. The yeast cells binding to the magnetic beads were recovered and resuspended in SD / -Trp glucose medium. A portion was plated onto SD / -Trp glucose agar plates, and the other portion was inoculated into liquid SD / -Trp glucose medium and cultured, named MACS-R1, for subsequent screening. The MACS-R1 culture was incubated at 30°C for 36 hours. After measuring the OD600 value, the cells were transferred to SD / -Trp galactose medium for re-induction, preparing for the next round of screening.

[0053] Second round of MACS screening and flow cytometry analysis: To evaluate the enrichment effect of MACS R1, one yeast cell with an OD600 unit was incubated with recombinant TNFR1-ECD, Alexa Fluor® 488 anti-HA.11 antibody (BioLegend, catalog number #901509), and APC anti-His-tagged antibody (BioLegend, catalog number #362605). The proportion of positive cells was analyzed by flow cytometry after incubation. For the second round of MACS screening, two yeast cells with an OD600 unit were washed with screening buffer and incubated with 100 μL of His-tagged magnetic beads to remove non-specifically bound yeast cells. The remaining yeast cells were incubated with 1 μM TNFR1-ECD, followed by the addition of fresh magnetic beads for positive selection, enriching yeast clones that specifically bind TNFR1. The enriched yeast clones were plated onto SD / -Trp glucose agar plates and named MACS R2. After incubation at 30°C for 36 hours, the colony count and fluorescence positivity rate were recorded. The remaining bacterial culture on the MACS R2 plates was amplified and preserved, and simultaneously transferred to SD / -Trp galactose medium for re-induction, to be used for further downstream screening.

[0054] Fluorescence-activated cell sorting (FACS): To further enrich high-affinity TNFR1-binding nanobodies, multiple rounds of fluorescence-activated cell sorting (FACS) were performed. All centrifuge tubes and buffers were pre-chilled. Yeast cells were collected from MACSR2 bacterial culture, and the culture concentration was adjusted to 10 OD600 units. Cells were washed with ice-chilled selection buffer. The washed yeast cells were incubated with 200 nM TNFR1-Fc fusion protein. After incubation, Alexa Fluor® 647 anti-HA.11 antibody (BioLegend, catalog number #682404) was added to detect nanobodies surface expression, and Alexa Fluor® 488 anti-human IgG Fc antibody (BioLegend, catalog number #410706) was added to detect antigen binding. Double-positive labeled yeast cells were sorted by FACS, and the sorted cells were plated on SD / -Trp glucose agar plates and incubated at 30°C for 36 hours. After culturing, the bacterial culture was preserved and transferred to SD / -Trp galactose medium for re-induction, ready for the next round of FACS screening. Subsequent FACS screenings employed a method of gradually decreasing the TNFR1 concentration to enhance screening rigor. In the second round of FACS (FACSR2), 10 yeast cells with an OD600 of 600 were incubated with 100 nM TNFR1-His, and the corresponding anti-His and anti-HA antibodies were added. Double-positive cells were sorted using dual-channel FACS, plated, and induced in culture as described above. The third and fourth rounds of FACS (FACS R3 and FACS R4) followed the same procedure, except that the TNFR1 concentration was reduced to 50 nM (using TNFR1-Fc), while maintaining consistent antibody labeling conditions. After each round of sorting, positive clones were cultured for 36 hours, the bacterial culture was preserved, and re-induced for subsequent experiments. After the final round of sorting, yeast cells were serially diluted and plated onto YPD agar plates supplemented with penicillin-streptomycin (CellorLab, catalog number #CB010) and incubated at 30°C. Single colonies were randomly picked and inoculated into selective liquid medium for amplification. To verify cloning correctness, 0.1 OD600 units of yeast cells were centrifuged at 12000xg for 1 minute, the supernatant was discarded, and the cells were resuspended in 20 μL of sterile water. The resuspended cells were placed in a metal bath and incubated at 99°C for 10 minutes to lyse the cells. After lysis, the cells were centrifuged, and the supernatant was used as a template for colony PCR amplification using primers pYDSF3 (5′-ACCACCATCGCTTCTATCGCTGCTAAG-3′) and pYDSF2 (5′-TACTGATGCTTCTGTAGAGGGTGAGG-3′). The amplified products were used for sequencing verification.

[0055] Amino acid sequence alignment confirmed that this embodiment ultimately yielded 7 TNFR1-ECD binding nanobody sequences. Competitive ELISA showed that at a concentration of 100 nM, Nb1 achieved an inhibition rate of over 92%, demonstrating a significant blocking effect of Nb1 on TNFα-TNFR1 binding. Therefore, Nb1 can serve as a core candidate nanobody for subsequent research. Figure 2 ).

[0056] The Nb1 parent contains CDR1 as shown in SEQ ID NO:1, CDR2 as shown in SEQ ID NO:2, and CDR3 as shown in SEQ ID NO:3, wherein the CDRs are defined according to the IMGT numbering scheme. The complete amino acid sequence of the Nb1 parent is shown in SEQ ID NO:4.

[0057] Example 2: Humanized design of Nb1 to obtain huNb1 This embodiment employs a CDR transplantation strategy, transplanting the complementarity-determining regions (CDRs) of the camel-derived nanobody Nb1 obtained in Example 1 onto a human immunoglobulin framework, named huNb1. The selected human framework (IGHV3-23*01) exhibits high germline homology, with over 88% homology to human immunoglobulins. This approach preserves the antigen recognition capability of the nanobody while minimizing its immunogenicity in the human body, thus avoiding immune rejection.

[0058] Sequence alignment results confirmed that humanization only replaced the framework region of the nanobody, while the amino acid sequence of the CDR region remained essentially unchanged. Figure 3 This ensured that the binding specificity and affinity of the nanobody to TNFR1 remained unaffected. The core amino acid residues of the CDR region were strictly preserved during the modification process, and no mutations affecting antigen recognition were introduced. Simultaneously, the immunogenicity-related characteristics of the molecule were optimized through humanization substitution of the framework region. The humanized nanobody (huNb1) and the parental nanobody (Nb1) were expressed and purified under the same conditions, using a consistent fermentation, induction, and purification system. Results showed that the expression yield and final product purity of huNb1 were consistent with the parental nanobody, and no functionally related physicochemical properties were altered due to sequence modification. The complementarity-determining region (CDR, boxed) remained conserved; framework region substitution reduced predicted immunogenicity while maintaining structural stability. The complete amino acid sequence of huNb1 is shown in SEQ ID NO:5, and the nucleotide sequence encoding huNb1 is shown in SEQ ID NO:6.

[0059] Example 3: Bivalent huNb1 construct In this embodiment, two monovalent huNb1 units are linked together using a flexible peptide linker to construct a bivalent huNb1 construct. The linker peptide has the amino acid sequence GSGGSG, is 6 amino acids in length, and belongs to the Gly / Ser-rich flexible linker peptide family. Its theoretical molecular weight is approximately 420.4 Da. This linker is used to connect two huNb1 units, forming a huNb1-linker-huNb1 bivalent construct.

[0060] The complete amino acid sequence of huNb1-huNb1 is shown in SEQ ID NO:7, and the nucleotide sequence encoding huNb1-huNb1 is shown in SEQ ID NO:8.

[0061] Example 4: In vitro preparation and purification of nanobodies and target proteins In this embodiment, different expression systems were used to express and purify the target proteins: monovalent nanobodies were expressed and purified in Pichia pastoris X-33, another batch of monovalent nanobodies were expressed and purified in Escherichia coli, and TNFR1-ECD, TNFR2-ECD, DR5-ECD and bivalent nanobodies were expressed and purified in Expi293F cells. By optimizing the purification conditions, high-purity and high-activity target proteins were obtained for subsequent experiments.

[0062] 1. Expression and purification in Pichia pastoris X-33: The validated nanobody sequence was cloned into the pPICZA vector, and the recombinant vector was linearized using SacI restriction endonuclease (Thermo Scientific, catalog number #ER1131). The linearized recombinant vector was transformed into Pichia pastoris X-33 competent cells via electroporation, with electroporation parameters set to 1.5 kV and 4 ms. After electroporation, the yeast cells were transferred to 1M sorbitol:YPD (volume ratio 1:1) medium and incubated at 30°C for 20 minutes for recovery, followed by shaking culture at 220 rpm and 30°C for 4 hours. After culture, the bacterial culture was plated onto YPDS agar plates containing 200-2000 μg / mL Zeocin antibiotic (Invitrogen, catalog number #R25001) and cultured at 30°C for 48-72 hours until single colonies appeared. For small-scale expression screening, four Zeocin-resistant monoclonal colonies were selected and inoculated into 5 mL of YPD medium containing 100 μg / mL Zeocin, and cultured at 30 °C and 220 rpm for 24 hours. The cultured bacterial solution was then transferred to BMGY medium (1% yeast extract, 2% peptone, 100 mM potassium phosphate buffer, 1.34% YNB, 0.00004% biotin, 1% glycerol), and cultured at 30 °C and 220 rpm for another 24 hours. Glycerol-containing bacteria were prepared and preserved, while the bacterial solution was transferred to BMMY medium (1% methanol instead of glycerol, other components the same as BMGY), and induced at 30 °C and 220 rpm for 72 hours, with 1% methanol added every 24 hours to maintain the induction effect. After induction, the supernatant was collected, and the expression level of the nanobodies was detected by SDS-PAGE electrophoresis, screening for clones with high expression levels. For large-scale production, the selected high-expression glycerol-containing bacteria were inoculated into 30 mL of YPD medium for amplification, and then transferred to 500 mL of BMGY medium and cultured at 30°C with shaking at 220 rpm for 24 hours. The bacterial culture in BMGY medium was then transferred to 500 mL of BMMY medium and induced under small-scale induction conditions for 72 hours. After induction, the culture was centrifuged at 4000 x g for 30 minutes, and the supernatant was collected. The recombinant nanobody was purified by Ni-NTA affinity chromatography. Impurities were washed with 10 mM imidazole, and the target protein was eluted with 300 mM imidazole. The eluted protein sample was further purified by Superdex 200 gel filtration chromatography. The column was equilibrated with PBS buffer, and the target protein peak was collected. Protein purity was verified by SDS-PAGE electrophoresis.

[0063] 2. Expression and purification in *E. coli*: The nanobody sequence was cloned into the pET-21b (+) vector, which contains an N-terminal PelB signal peptide and a C-terminal His6 tag, to construct a recombinant expression vector. The recombinant expression vector was transformed into *E. coli* BL21(DE3) competent cells (Tsingke, catalog number #TSC-E01), plated on LB agar plates containing kanamycin (Shanghai Sangon Biotech Co., Ltd., catalog number #A100408), and incubated overnight at 37°C. Positive clones were screened. Single positive colonies were picked and inoculated into 5 mL of LB medium, and cultured overnight at 37°C with shaking at 220 rpm to obtain the seed culture. The next day, the seed culture was diluted 1:100 in Terrific Broth (TB) medium (composition: 1.2% tryptone, 2.4% yeast extract, 0.4% glycerol, 17 mM KH2PO4, 72 mM K2HPO4), and cultured at 37°C with shaking at 220 rpm until the OD600 reached 1.5-2.0. The culture was cooled to 17°C, and 200 μM IPTG was added for induction. The culture was then incubated at 17°C with shaking at 220 rpm for 16-18 hours. After induction, the culture was centrifuged at 4000 xg for 15 minutes, and the bacterial pellet was collected. The pellet was resuspended by adding 50 mL of SET buffer (200 mM Tris-HCl pH 8.0, 500 mM sucrose, 500 μM EDTA) per liter of bacterial culture. Add 2 volumes of cold sterile water, 5 mM MgCl2, and 1 μL Benzonase nuclease (Aladdin, catalog number #B401536) to the resuspension and stir at room temperature for 1 hour to lyse the bacteria and release intracellular proteins. Centrifuge at 12000 xg for 30 minutes, collect the supernatant, add NaCl to the supernatant to a final concentration of 100 mM, and centrifuge again at 12000 xg for 30 minutes to further remove contaminating proteins. Load the supernatant onto a Ni-NTA column (Thermo Fisher, catalog number #88223), wash the column with binding buffer, wash with 10 mM imidazole to remove contaminating proteins, and finally elute the target protein with 300 mM imidazole. Collect the eluent, combine the target protein peaks, concentrate, and further purify using a Superdex 200 Increase gel filtration chromatography column (Cytiva, catalog number #28990944). Verify protein purity by SDS-PAGE electrophoresis.

[0064] 3. Expression and purification of TNFR1-ECD, TNFR2-ECD, DR5-ECD and bivalent nanobodies in Expi293F cells: Expi293F cells (Union Biotech, catalog number #UP1003) were cultured in advance, maintaining a cell concentration of 3-5 × 10⁻⁶ cells / cells. 6Cells / mL, cell viability greater than 95%, ensuring good cell condition for transfection. Prepare the plasmid and PEI transfection reagent according to the ratio of 1 mg pcDNA3.1 recombinant plasmid per liter of cell culture system, with a plasmid to PEI mass ratio of 1:3 (1.3 mg plasmid corresponds to 3.9 mg PEI). Dilute the plasmid and PEI separately with 50 mL of cell culture medium, gently invert to mix, and incubate at room temperature for 5 minutes to allow the plasmid and PEI to fully dissolve. After 5 minutes of incubation, slowly add the diluted PEI to the diluted plasmid, gently invert to mix, and incubate at room temperature for 20 minutes to allow the plasmid and PEI to form a stable transfection complex. Slowly add the transfection complex to the Expi293F cell culture system, gently shake the culture flask to distribute the transfection complex evenly in the cell suspension. Cell culture flasks inoculated with the transfection complex were placed in a shaker at 37 °C, 5-8% CO2, and 120 rpm for 24 hours. Afterward, 6% fresh culture medium was added to the culture system to supplement nutrients and promote cell growth and protein expression. 72 hours after transfection, the cell culture supernatant was collected, centrifuged at 4000 xg for 30 minutes to remove cell debris, and the supernatant was clarified. The clarified supernatant was loaded onto a Ni-NTA affinity chromatography column. The column was first washed with equilibration buffer to remove contaminating proteins, followed by washing with 10 mM imidazole to further remove weakly bound contaminating proteins. The target protein (TNFR1-ECD, TNFR2-ECD, DR5-ECD, or bivalent nanobodies) bound to the column was eluted with 300 mM imidazole. The eluted fraction was collected, and protein expression was detected by SDS-PAGE electrophoresis. The elution fractions containing the target protein were combined and further purified by Superdex 200 gel filtration chromatography. The chromatography column was equilibrated with PBS buffer, the target protein peak was collected, and the protein purity was verified by SDS-PAGE electrophoresis. Once the purity was qualified, it was used for subsequent experiments.

[0065] After secondary purification by Ni-NTA affinity chromatography and SEC gel size exclusion chromatography, the nanobodies were identified by 12% SDS-PAGE electrophoresis. All nanobodies showed a single band with no obvious impurities, and the purity reached more than 95%, which met the requirements for subsequent functional experiments.

[0066] Example 5: Detection of Physicochemical Properties and Binding Ability of Nanobodies In this embodiment, the binding affinity between the nanobody and TNFR1-ECD was detected by biological layer interferometry (BLI), and the blocking effect of the nanobody on the binding of TNFα and TNFR1 was verified by BLI competition experiment. The thermal stability of the nanobody was detected by nano differential scanning fluorescence (nanoDSF) to clarify its physicochemical properties. The blocking efficacy of the nanobody on the binding of TNFα and TNFR1 was further verified by in vitro competition experiment based on ELISA.

[0067] 1. Biolayer Interferometry (BLI) Detection: The binding kinetics of nanobodies to TNFR1 were evaluated using an Octet RED96 biolayer interferometer (Sartorius). All samples were prepared in assay buffer (containing 25 mM phosphate, 150 mM NaCl, and 0.02% Tween 20, pH adjusted to 6.8). The super-streptavidin (SSA) biosensor (Sartorius, #18-5057) was equilibrated in assay buffer for 120 s before use. Biotinylated TNFR1-ECD (Shanghai Sangon Biotech Co., Ltd., catalog number #C100212) was diluted to 5 ng / μL with assay buffer and used as the immobilization ligand. The purified nanobody was serially diluted with assay buffer to final concentrations of 500, 250, 125, 62.5, 31.25 and 15.625 nM, with 3 replicates. A blank control (with only assay buffer added, without nanobody) was also set up.

[0068] For each measurement, 200 μL of ligand and analyte solutions were added to each well of a 96-well plate (Molecular Devices, #5085651). After sensor equilibration, TNFR1-ECD was loaded onto the SSA sensor for no more than 120 s, terminating when the binding signal reached approximately 1.5 nm. The sensor was then briefly returned to buffer to establish a baseline, followed by binding to the nanobody for 300 s and dissociation in buffer for 300 s.

[0069] Experimental data were analyzed using Octet Analysis Studio (version 13.0.2.46). The binding rate constant (kon), dissociation rate constant (koff), and equilibrium dissociation constant (KD = koff / kon) were calculated by fitting a reference subtraction curve using a 1:1 binding model to evaluate the binding kinetics of the nanobody to TNFR1. All BLI binding kinetics assays were performed at a constant temperature of 25 °C.

[0070] For Nb1 and huNb1, measurements were independently repeated three times, and the corresponding kinetic parameters from each experiment were summarized. BLI results showed that the KD values ​​of huNb1 in the three independent assays were approximately 19.65 nM, 18.28 nM, and 15.27 nM, respectively. The equilibrium dissociation constants of Nb1 and huNb1 with TNFR1 were almost identical, indicating that humanization had a limited impact on the binding of nanomolar TNFR1. huNb1 exhibited slower dissociation and more stable binding kinetics compared to other nanobodies.

[0071] Table 1. BLI analysis of TNFR1 and nanobodies (3 independent BLI experiments)

[0072] 2. BLI Competition Assay: The BLI competition assay was performed on an Octet RED96 system (Sartorius) using the same assay buffer (25 mM phosphate buffer, pH 6.8, 150 mM NaCl, 0.02% Tween 20). Biotin-labeled TNFR1-ECD was loaded onto an SA sensor (Sartorius, #18-5019), and loading was stopped when the signal reached approximately 1.5 nm.

[0073] Forward competition experiments: The sensor loaded with TNFR1-ECD was immersed in 500 nM Nb1 solution and incubated for 300 seconds to allow the nanobody to fully bind to TNFR1-ECD and reach saturation. Subsequently, the sensor was transferred to assay buffer containing the same concentration of nanobody and incubated for 60 seconds. Then, it was transferred to wells containing 500 nM competing nanobody and 500 nM initially bound nanobody for a second binding step, incubated for 300 seconds. Reverse competition experiments were conducted by reversing the incubation order of the nanobody. Injection of buffer-only samples served as a negative control. All BLI binding kinetic experiments were performed at a constant temperature of 25 °C.

[0074] Data were analyzed using Octet Analysis Studio (v13.0.2.46). The minimal increase in signal after a second injection indicates the presence of partially competing and overlapping epitopes.

[0075] Binding of huNb1 and huNb21 to recombinant TNFR2-ECD or death receptor 5 (DR5) was detected using nanobody concentration gradients (15.63-500 nM) and BLI technique, under experimental conditions consistent with TNFR1 binding detection. Even at micromolar concentrations, neither nanobody exhibited a detectable binding signal (binding rate < 5%). Figure 5 The presence of C indicates that it has strict selectivity for TNFR1 and does not cross-react with TNFR2 or DR5.

[0076] 3. Nanodiagnostic scanning fluorescence spectrometry (nanoDSF): The thermal stability of the nanobodies was assessed using differential scanning fluorescence spectrometry on a Prometheus NT.48 system. The nanobodies were diluted to 1 mg / mL. -1 (PBS buffer, pH 7.4), load 10 μL of sample into a capillary tube. Incubate at 1℃ for 1 min. -1The sample was heated from 20 °C to 95 °C at a rate of [missing information], and the intrinsic fluorescence at 330 nm and 350 nm was recorded (Table 2).

[0077] Data were analyzed using PR.Therm Control (x64) software. The melting temperature (Tm) and aggregation temperature (Tagg) were determined based on the fluorescence ratio (F350 / F330) and light scattering signal, respectively, to analyze the thermal stability of the nanobodies.

[0078] Table 2. Thermal stability of humanized TNFR1 nanobodies determined by nanoscale differential scanning fluorescence method.

[0079] The results showed that, using samples stored at -80 ℃ for a long period as a control, the melting temperature (Tm) of the nanobodies did not decrease significantly after incubation at 4 ℃ for 1 day and at 37 ℃ for 7 days, respectively. Figure 5 (D in the text). Among them, the bivalent huNb1-huNb1 maintained the highest Tm value (approximately 77-79 °C) under all conditions, followed by the monovalent huNb1, without any obvious structural instability or aggregation. This result indicates that under simulated storage, transportation, and physiological temperature stress conditions, the nanobody of this invention can still maintain a highly stable three-dimensional structure without the risk of irreversible denaturation or loss of activity, providing a reliable structural basis for its application in different scenarios.

[0080] 4. Competitive Assay of Nanobodies Based on In Vitro ELISA: The ability of nanobodies to block the binding of TNF-α to TNFR1 was evaluated using a competitive ELISA. High-binding 96-well plates (Corning, #3590) were used, with each well coated with 200 ng of recombinant human TNFR1 and incubated overnight at 4°C. The plates were washed five times with TBST (TBS containing 0.1% Tween 20) and then blocked with 5% (w / v) nonfat dry milk powder at room temperature for 1 h. Biotin-labeled TNF-α (Novoprotein, #DC008) was serially diluted and added to triplet wells. After 1 h of incubation, the plates were washed and streptavidin-HRP (Genscript, #M00091) was added and incubated for 30 min. TMB substrate (Sangon, #E661007-0050) was added, and the plates were incubated at 37°C for 10 min for color development. The reaction was then terminated with 1 M H2SO4. Absorbance was read at 450 nm and corrected against a 595 nm background.

[0081] The IC50 of nanobodies was calculated using the GraphPad Prism software via a nonlinear regression method. 50 The value was used to evaluate the ability of nanobodies to block the binding of TNFα-TNFR1.

[0082] The results showed that TNFα binds to TNFR1-ECD in EC 50 Approximately 0.34 nM; Nb1 significantly reduces TNFα-TNFR1 binding signal ( Figure 2 ).

[0083] Example 6: Exploring the Mechanism of Action of Nanobodies This embodiment uses an in vivo competition experiment based on ELISA (detection of NF-κB luciferase reporter gene in HeLa cells and L929 cells) to verify the intervention effect of nanobodies on the TNFα / TNFR1 signaling pathway at the cellular level.

[0084] NF-κB luciferase reporter gene assay based on cells: HeLa cells stably expressing the NF-κB-driven luciferase reporter gene were seeded in white 96-well plates, 6 × 10⁶ cells per well. 4 Cells were cultured overnight. Cells were stimulated at 37°C for 2 hours with serial dilutions of recombinant human TNFα; PBS was added to blank wells as a negative control. After stimulation, cells were washed with PBS, and 100 μL of luciferase lysis buffer (Beyotime, #RG005) was added for lysis, followed by incubation at room temperature for 10 minutes. The lysis buffer was clarified by centrifugation at 12,000 rpm for 3 minutes, and 100 μL of the supernatant was transferred to a white 96-well plate containing 100 μL of room temperature luciferase substrate. Efficacy was recorded using a Tecan Spark microplate reader. The EC50 of TNFα was calculated using GraphPad Prism. 50 .

[0085] To evaluate the efficacy of the nanobodies, cells were pretreated with serially diluted nanobodies for 2 hours before TNFα stimulation. Luminescence values ​​were measured as described above, and the IC50 was determined using nonlinear regression in GraphPad Prism. 50 value.

[0086] For the assay using L929 mouse cells, L929 cells stably expressing the NF-κB-driven luciferase reporter gene were seeded into white 96-well plates, 5 × 10⁶ cells per well. 4 Cells were cultured overnight. Cells were stimulated with serial dilutions of recombinant mouse TNFα; all subsequent washing, lysis, and chemiluminescence assays were performed strictly according to the description for HeLa cells.

[0087] In this embodiment, to determine whether these biochemical properties translate into cellular antagonism, a HeLa cell line stably carrying the NF-κB luciferase reporter gene was used. Tumor necrosis factor (TNF) stimulation induced significant, dose-dependent activation of NF-κB, with its half-maximal effective concentration (EC50) reaching [a specific value]. 50The value was 0.21 nM, confirming that the system can sensitively reflect the activation level of TNFR1 signaling. Nanobody pretreatment results showed significant functional differences between huNb1 and other nanobodies. Although both inhibited TNF-driven NF-κB activation in a concentration-dependent manner, huNb1 produced a steep inhibition curve at lower concentrations, while other nanobodies required higher doses to achieve comparable inhibitory effects. The bivalent huNb1 and monovalent huNb1 showed similar inhibitory efficacy, both exhibiting clear concentration-dependent blocking characteristics in the NF-κB reporter gene system established in this embodiment. Quantitative analysis confirmed that the half-maximal inhibitory concentration (IC50) of huNb1... 50 The half-maximal inhibitory concentration (IC50) of huNb1 was 101.20 nM, significantly lower than the 2114 nM of other nanobodies. The inhibitory efficacy of huNb1 was 20.9 times that of other nanobodies. Figure 6 The half-maximal inhibitory concentration (IC50) of huNb1-huNb1 in this invention. 50 The value was 140.08 nM, and the half-maximal inhibitory concentration (IC50) of adalimumab was... 50 The value was 90.51 nM, and statistical analysis showed no significant difference (P>0.05). Figure 7 This indicates that the slower dissociation kinetics of huNb1 directly translates into a stronger functional blocking effect, consistent with its high kinetic stability observed in BLI experiments.

[0088] Since bivalent TNFR1-targeting molecules may exhibit residual agonistic activity under certain conditions, this study further evaluated whether huNb1-huNb1 could activate the TNFR1 signaling pathway in the absence of a ligand. Using the same NF-κB luciferase reporter system, luciferase activity was measured after 24 hours of culture in the absence of TNFα, with untreated cells serving as a blank control. Three replicates were set for each concentration. Regardless of the test concentration range, neither huNb1 nor huNb1-huNb1 induced detectable reporter gene activation. There was no significant difference in luciferase activity between the treatment groups and the blank control group (P>0.05), and no significant increase in luciferase activity was detected, even at a huNb1-huNb1 concentration of 20 μM. Figure 5 The results indicate that the bivalent construct did not exhibit detectable agonistic activity under the test conditions. These results suggest that valence engineering can enhance the activity of nanobodies in this experimental system while retaining their inherent advantages of small molecular weight and high receptor selectivity. In the mouse reporter system, huNb1 and huNb1-huNb1 had no significant inhibitory effect on mTNFα-induced activation within the test concentration range. Figure 5 (F and G in the text).

[0089] Example 7: Verification of the anti-inflammatory activity of nanobodies Given the clinical success of tumor necrosis factor (TNF)-TNFR1 axis blockade in autoimmune diseases such as rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE), this embodiment evaluates the inhibitory effect of nanobodies on the expression of TNFα / TNFR1-mediated pro-inflammatory cytokines (TNFα, IL-6, etc.) by THP-1-derived macrophage stimulation experiments, combined with real-time quantitative PCR analysis and ELISA quantitative detection, and verifies its anti-inflammatory activity.

[0090] 1. THP-1-derived macrophage stimulation: THP-1 monocytes were introduced at a density of 1 × 10⁶ cells per well. 6 Cells were seeded in 6-well plates and treated with 25 ng / mL phorbol 12-myristate 13-acetate (PMA; MedChemExpress, HY-18739) for 24 hours to induce adhesion. After removing the supernatant, the cells were washed four times with PBS and replaced with fresh culture medium. Subsequently, the cells were stimulated for an additional 24 hours with 100 ng / mL lipopolysaccharide (LPS; MedChemExpress, HY-D1056) and 20 ng / mL interferon-γ (IFN-γ; MedChemExpress, HY-P7025A) to promote M1-like polarization, pre-activating the cells and making them more closely resemble the in vivo inflammatory microenvironment. After pretreatment, TNFα stimulation was added, along with various nanobodies or adalimumab.

[0091] The experimental groups were as follows: control group (no treatment), TNFα stimulation group (10 ng / mL TNFα only), TNFα stimulation + monovalent Nb1 treatment group (10 ng / mL TNFα + 100 nM monovalent Nb1), TNFα stimulation + monovalent Nb21 treatment group (10 ng / mL TNFα + 100 nM monovalent Nb21), and TNFα stimulation + bivalent Nb1 treatment group (10 ng / mL TNFα + 100 nM bivalent Nb1). Adalimumab (100 nM) was used as a positive control. After culturing for another 6 hours, cells and cell culture supernatant were collected for qRT-PCR and ELISA detection, respectively.

[0092] 2. Quantitative PCR analysis of cytokine expression in THP-1 cells: Total RNA was extracted from polarized THP-1 cells using TRIzol reagent (Thermo Fisher Scientific, No. #15596018CN). After complete lysis and homogenization, 200 μL of nucleic acid extraction reagent (G-CLONE, No. #EX0100) was added to each sample, vortexed, and incubated at room temperature for 15 min to achieve phase separation. The samples were centrifuged at 12,000 rpm for 15 min at 4°C, and the supernatant was transferred to a fresh test tube. An equal volume of isopropanol was added to precipitate the RNA, followed by centrifugation at 13,000 rpm for 10 min at 4°C. The precipitate was washed once with 1 mL of 100% ethanol, centrifuged at 7,500 rpm for 5 min, dried, and dissolved in 20 μL of water treated with diethyl pyrocarbonate.

[0093] RNA concentration and purity were determined spectrophotometrically. 1 μg of RNA from each sample was reverse transcribed into cDNA using a PrimeScript reverse transcription kit (Takara, catalog number #RR036A) and diluted to a final volume of 100 μL. Quantitative real-time PCR was performed on a Roche LightCycler 480 II system using SYBR Green Master Mix (Yasen, catalog number #11201ES08). Each 10 μL reaction volume contained 1 μL cDNA, 5 μL SYBR mixture, 0.2 μL each of forward and reverse primers (10 μM), and 3.6 μL nuclease-free water. All reactions were repeated three times, and data were normalized using GAPDH as an internal control.

[0094] The primers used are as follows: GAPDH: FW: ACAACTTTGGTATCGTGGAAGG; RV: GCCATCACGCCACAGTTTC.

[0095] TNF: FW: GAGGCCAAGCCCTGGTATG; RV: CGGGCCGATTGATCTCAGC.

[0096] IL-1β: FW: TTCGACACATGGGATAACGA; RV: TTTTTGCTGTGAGTCCCGGAG.

[0097] IL-6: FW: TTCGGCAAATGTAGCATG; RV: AATAGTGTCCTAACGCTCATAC.

[0098] IL-8: FW: CTCTCTTGGCAGCCTTCCT; RV: GGTCCACTCTCAATCACTCTCAG.

[0099] Quantitative analysis of IL-6 mRNA expression levels showed that the IC50 of nanobodies... 50 The distribution is consistent with the performance observed in the HeLa reporting system. Figure 8 This verified the consistency and reliability of the experimental results. Real-time quantitative PCR (qRT-PCR) results showed that TNFα stimulation significantly induced an increase in the mRNA expression levels of key pro-inflammatory cytokines (TNFα, IL-1β, IL-6, IL-8) in THP-1 cells, with expression levels increasing more than 10-fold compared to the control group (P<0.001); while treatment with each nanobody significantly reduced the mRNA expression of these cytokines. Figure 9 In the study of inflammatory mediators (AD), the expression levels of cytokines in the monovalent and bivalent Nb1 treatment groups decreased to less than 15% of those in the stimulation group. Furthermore, adalimumab showed relatively limited efficacy in inhibiting IL-1β and IL-8 expression, reducing IL-1β and IL-8 mRNA expression levels to only 40% and 35% of those in the stimulation group, respectively. Both forms of the two nanobodies, however, showed inhibitory effects on all four inflammatory mediators.

[0100] 3. Cytokine quantification by ELISA: THP-1 cells were stimulated and treated with nanobody according to the same protocol as the mRNA expression experiment. After 24 hours of continuous culture, the supernatant was collected for cytokine quantification by ELISA. TNF (INS Biological, #GNEH092HS), IL-1 (Inselisa, #INS-10351), IL-6 (UpingBio, #SYP-H0064), and IL-8 (UpingBio, #SYP-H0579) were detected using commercial kits. All reagents and components were equilibrated to room temperature and prepared according to the manufacturer's instructions before use.

[0101] Remove the ELISA plate from its foil packaging. Each well is designated for standards, sample dilution controls, blank controls, and test samples, respectively. Add 50 µL of standards at different concentrations to the calibration wells; add 50 µL of sample diluent to the dilution control wells; add 50 µL of each sample to the test wells; leave the blank wells empty. Except for the blank wells, add 100 µL of biotin-labeled detection antibody to each well. Seal the plate and incubate at 37°C in the dark for 60 minutes. After incubation, remove the seal, discard the liquid, and pat dry any remaining liquid in the wells with absorbent paper. Add washing buffer to each well, let stand for 1 minute, discard the washing buffer, and pat dry. Repeat this washing step five times.

[0102] Subsequently, 100 µL of HRP-labeled streptavidin was added to each well except for the blank well. The plate was resealed and incubated at 37°C in the dark for 20 minutes, followed by another wash. Next, 100 µL of TMB substrate solution was added to all wells, and the plates were incubated at 37°C in the dark for 15 minutes. Finally, 50 µL of stop solution was added to each well, and the absorbance was measured at 450 nm using a microplate reader within 15 minutes.

[0103] The protein levels of various inflammatory factors in the cell culture supernatant detected by ELISA were consistent with the mRNA expression patterns. All three nanobody forms significantly inhibited the secretion of TNFα, IL-6, IL-8, and IL-1β. Figure 9 In the EH group, there was no significant difference in inhibitory efficacy between monovalent and bivalent Nb1 (P>0.05). Although adalimumab effectively reduced TNFα and IL-6 levels, lowering their secretion to below 20% of the stimulation group, its inhibitory effect on IL-8 and IL-1β secretion was significantly weaker than that of nanobodies, with its IL-8 and IL-1β secretion levels only decreasing to 45% and 40% of the stimulation group, respectively.

[0104] In summary, adalimumab can neutralize soluble TNFα and simultaneously block the TNFR1 and TNFR2 signaling pathways; while the nanobody in this invention specifically binds to TNFR1, blocking only TNFR1-mediated signaling. The four cytokines detected (TNFα, IL-1β, IL-6, and IL-8) are mainly regulated by the TNFR1-dependent NF-κB signaling pathway, with limited contribution from TNFR2. Therefore, the nanobody can more specifically block the expression and secretion of these cytokines. Furthermore, adalimumab, as an anti-TNFα antibody, primarily targets soluble TNFα, with weak inhibitory effects on transmembrane TNFα on the cell membrane surface; while the nanobody of this invention binds to TNFR1, simultaneously blocking the binding of both soluble TNFα and transmembrane TNFα to TNFR1, thus exhibiting stronger inhibitory efficacy. Therefore, the specific antagonism mediated by the nanobody of this invention can selectively and effectively block TNFR1-driven inflammatory output without affecting TNFR2-related immunomodulatory functions, highlighting its potential therapeutic advantages over traditional pan-TNF inhibitors.

[0105] Example 8: Verification of the anti-programmed necrosis activity of nanobodies TNFR1-driven necroptosis is also considered a key pathological mechanism in many diseases, especially inflammatory bowel disease (IBD), such as Crohn's disease and ulcerative colitis. In this embodiment, TSZ-induced programmed necrosis models were constructed in HT-29 and MEF cells. Western blot analysis was used to detect the effect of nanobodies on the expression of programmed necrosis-related proteins, verifying their anti-programmed necrosis activity.

[0106] 1. TSZ-induced necroptosis models in HT-29 and MEF cells: Necrotosis models were established using human colon adenocarcinoma cells (HT-29) and primary mouse embryonic fibroblasts (MEFs). Cells were pretreated for 30 min with 20 μM z-VAD-fmk (APExBIO, #A1902) and 10 nM Smac mimic SM-164 (APExBIO, #A8815), and then injected with 20 ng / mL... -1TNF-α (Novoprotein, #DC008 / #CF09) stimulation for 8 h induced TNFR1-mediated necrotizing apoptosis (TSZ treatment). In the experimental groups, nanobodies or positive controls were co-incubated with z-VAD-fmk and SM-164, with PBS used as the control solvent. Cell viability was assessed using the CellTiter-Glo luciferase cell viability assay kit (Beyotime, Shanghai, China) according to the kit instructions. Loss of membrane integrity was confirmed by propidium iodide (PI) staining (Beyotime, #ST511). Luminescence or absorbance was recorded using a BioTek 312e microplate reader (BioTek Instruments, Winooski, VT). The IC50 of the nanobodies was calculated using GraphPad Prism software based on the dose-response curve. 50 value.

[0107] Cells were treated with TSZ (a combination of TNFα, Smac mimics, and z-VAD). z-VAD is a broad-spectrum caspase inhibitor that inhibits apoptosis pathways and prevents cell apoptosis. Smac mimics bind to and inhibit IAPs (inhibitory proteins of apoptosis), promoting the activation of necrosis-associated apoptosis proteins (RIPK1 and RIPK3). TNFα activates the TNFR1 signaling pathway, specifically activating the RIPK1-RIPK3-MLKL cascade, mimicking TNFR1-mediated necrosis-associated apoptosis signaling. The TSZ concentrations were: TNFα 10 ng / mL, Smac mimics 100 nM, and z-VAD 20 μM, for 4 hours and 6 hours, respectively. The efficacy of the nanobody was systematically evaluated by analyzing cell morphology, mortality rate, and the expression of key pathway markers: cell morphology was observed using an inverted microscope; mortality rate was detected by PI staining combined with flow cytometry; and the expression of key pathway markers (p-RIPK1, p-RIPK3, and p-MLKL) was detected by Western blot.

[0108] In HT-29 cells, TSZ treatment significantly induced cell death, with a cell death rate exceeding 65% after 4 hours of treatment. In contrast, the untreated control group showed intact cell morphology, good growth, and no significant cell death. The addition of equimolar concentrations (100 nM) of Nb1, Nb21, bivalent Nb1, and adalimumab (positive control) revealed significant differences in cell protective efficacy among the treatment groups: 4 hours after stimulation, Nb1, bivalent Nb1, and adalimumab significantly prevented cell death, reducing the cell death rate to below 20%, while Nb21 showed only a slight inhibitory effect, with the cell death rate remaining above 50%. Figure 10 A in Figure 11(A) Six hours after stimulation, TSZ treatment led to widespread cell death, with a mortality rate exceeding 85%. All nanobody and adalimumab treatment groups showed reduced cell death, with bivalent Nb1 and adalimumab exhibiting the strongest protective effects, reducing cell death to below 15%. Nb21 provided only partial protection, with the cell death rate remaining above 45%. Figure 10 B in Figure 11 (B) Inverted microscopy revealed that cells in the TSZ-treated group showed significant swelling and cell membrane rupture, while cells in the nanobody-treated group remained largely morphologically intact, with only a small number showing abnormalities, further confirming the protective effect of the nanobody. Notably, in the absence of TSZ stimulation, no morphological abnormalities or detectable cytotoxicity were observed after 6 hours of treatment with nanobody alone, and cell mortality was <5%, indicating that the nanobody has good safety. Figure 11 (C in the middle).

[0109] In mouse MEF cells treated with the same TSZ, neither Nb1 nor Nb21 showed a significant protective effect against necrosis and apoptosis, and the cell death rate was not significantly different from that of the TSZ-stimulated group (P>0.05). Figure 12 This further highlights their strict specificity for human TNFR1 and the fact that they do not cross-react with mouse TNFR1.

[0110] To further characterize the efficacy of nanobodies, dose-response analysis was performed on Nb1 and bivalent Nb1 in the HT-29 TSZ model, using adalimumab as a baseline. Nanobody concentration gradients (10-500 nM) were set, and cell death rates were measured 6 hours after treatment to plot dose-response curves. Both reagents exhibited S-shaped survival curves: the half-maximal effective concentration (EC50) of bivalent huNb1 was [data missing]. 50 The concentration was 8.32 μM, compared to the EC50 of adalimumab. 50 (6.643 μM) is close, while the EC of huNb1 is similar. 50 The efficiency is 30.22 μM, which is approximately 1 / 3 to 1 / 4 of that of the bivalent form. Figure 13 (AC in the middle). This indicates that the dose-dependent protective effect of bivalent huNb1 is more significant. In the toxicity test, 5 times IC50 was used. 50 After treating cells with nanobody concentrations for 4 hours, the cell death rate in all treatment groups was <6%, with no significant difference compared to the control group (P>0.05), further confirming the good safety profile of the nanobody. Figure 13 (D in the middle).

[0111] 2. Western blot analysis: After TSZ-induced necrosis and apoptosis, equal volumes of cells from the control and treatment groups were taken and lysed on ice with M2 lysis buffer (20 mM Tris, pH 7.0, 0.5% NP-40, 250 mM NaCl, 3 mM EDTA, 3 mM EGTA, 2 mM DTT, 0.5 mM PMSF, 20 mM sodium β-glycerophosphate, 1 mM sodium orthovanadate, and 1 μg / mL). -1 Lysis was performed using a soybean trypsin inhibitor for 30 minutes. The lysate was centrifuged at 12,000 rpm for 15 minutes at 4°C to clarify. The supernatant was mixed with 5×SDS loading buffer, denatured at 99°C for 10 minutes, and then subjected to SDS-PAGE electrophoresis.

[0112] Proteins were transferred to PVDF membranes and incubated overnight at 4°C with primary antibodies against human RIPK1 (BD Biosciences, #610458), phosphorylated RIPK1 (Cell Signaling Technology, #65746), RIPK3 (Cell Signaling Technology, #13526), ​​phosphorylated RIPK3 (Cell Signaling Technology, #93654), MLKL (Abcam, #ab184718), and phosphorylated MLKL (Abcam, #ab187091). All primary antibodies were diluted 1:1000. HRP-labeled secondary antibodies (anti-mouse, ABclonal #AS003; anti-rabbit, ABclonal #AS014) were incubated at room temperature for 1 hour and diluted 1:5000. Protein bands were detected using enhanced chemiluminescence (Tanon, #180-50) and imaged using a Tanon 5200CE imaging system. Density analysis was performed using ImageJ software.

[0113] The results showed that, compared with the PBS control group, all treatment groups significantly reduced the phosphorylation levels of these proteins (P<0.001), with bivalent huNb1 and adalimumab showing the strongest inhibitory effects, reducing phosphorylation levels to below 20% of the control group. Figure 14 While the total protein expression level remained largely unchanged, the nanobody inhibited necroptosis by suppressing the phosphorylation of key proteins and blocking the RIPK1-RIPK3-MLKL cascade. These findings suggest that nanobodies can effectively inhibit the activation of downstream necroptosis signaling pathways by targeting and blocking the TNFα-TNFR1 axis.

[0114] In summary, these results confirm that TNFR1-specific nanobodies (especially bivalent Nb1) have a potent inhibitory effect on TNFα-induced necrotizing apoptosis in human intestinal epithelial cells. Furthermore, they exhibit receptor specificity and species specificity, selectively blocking human TNFR1-mediated necrotizing apoptosis without affecting mouse TNFR1 signaling, highlighting their translational potential as a therapeutic agent for IBD and related inflammatory diseases. Compared to adalimumab, nanobodies offer advantages such as smaller molecular size and stronger tissue penetration, allowing them to more effectively reach intestinal mucosal sites of inflammation and exert therapeutic effects.

[0115] The above description is merely a preferred embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention's specification and drawings, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. An anti-TNFR1 nanobody, characterized in that, The nanobody comprises CDR1 with an amino acid sequence as shown in SEQ ID NO:1, CDR2 with an amino acid sequence as shown in SEQ ID NO:2, and CDR3 with an amino acid sequence as shown in SEQ ID NO:3, wherein the CDRs are defined according to the IMGT numbering scheme.

2. The nanobody according to claim 1, characterized in that, The nanobody comprises the amino acid sequence shown in SEQ ID NO:4, or a variant that has at least 80% sequence identity with the conserved structural domains of the nanobody and retains TNFR1 binding activity.

3. The nanobody according to claim 1 or 2, characterized in that, The nanobody is a humanized antibody, and the humanized nanobody contains the VH framework region of human immunoglobulin.

4. The nanobody according to claim 3, characterized in that, The humanized antibody contains the amino acid sequence shown in SEQ ID NO:

5.

5. The nanobody according to claim 1 or 2, characterized in that, The nanobody is fused with a serum albumin binding domain, an Fc fragment, or polyethylene glycol to prolong its in vivo half-life.

6. The nanobody according to claim 3, characterized in that, The nanobodies are in monovalent, divalent, trivalent, or tetravalent form, and the nanobodies are linked together by flexible linker peptides.

7. An anti-TNFR1 nanobody-drug conjugate, characterized in that, The invention comprises the anti-TNFR1 nanobody according to any one of claims 1-6, and an effector molecule conjugated to the anti-TNFR1 nanobody, wherein the effector molecule is selected from cytotoxic drugs, detectable markers, or immunomodulators.

8. A biomaterial, characterized in that, The biomaterial comprises isolated nucleic acid molecules, expression vectors, or host cells, wherein the nucleic acid molecules encode the nanobody according to any one of claims 1 to 7, and the expression vector or host cell contains the nucleic acid molecules.

9. The biomaterial according to claim 8, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:6 or SEQ ID NO:

8.

10. Use of the nanobody according to any one of claims 1 to 7, the anti-TNFR1 nanobody-drug conjugate according to claim 7, or the biomaterial according to claim 8 in the preparation of a medicament for detecting TNFR1 or for treating TNFR1-related diseases.

Images