An ultrasonic-activated ATP-responsive long-afterglow nanoprobes, a preparation method and application thereof

Abstract

This invention discloses a long-persistence nanoprobe with an ultrasound-activated ATP response, its preparation method, and its applications. The method uses long-persistence nanoparticles as the core and metal nanoparticles as satellite quenching units. The surface of the long-persistence nanoparticles is linked to amino-modified DNA1 via an amide coupling reaction to obtain long-persistence nanoparticle-DNA1. The surface of the metal nanoparticles is modified with phosphorylated azide polyethylene glycol, which then undergoes a click chemistry reaction with alkyne-modified DNA2 to obtain metal nanoparticle-DNA2. The long-persistence nanoparticle-DNA1 and metal nanoparticle-DNA2 are coupled via D... NA hybridization assembles to form an ATP-responsive long-persistence nanoprobe; the ATP-responsive long-persistence nanoprobe is further formed by base complementarity pairing of nucleic acid fragments DNA3 and DNA1 to form an ultrasound-activated ATP-responsive long-persistence nanoprobe; DNA1 contains the ATP aptamer sequence, and DNA3 is used to block the ATP aptamer recognition site; under ultrasound, DNA3 detaches, exposing the ATP aptamer and allowing it to bind specifically to ATP, inducing a conformational change in nucleic acid and the detachment of metal nanoparticles, thereby relieving the quenching effect on the long-persistence nanoparticles and achieving enhanced output of the afterglow signal.

Description

Technical Field

[0001] This invention belongs to the field of biomedical imaging and nucleic acid molecular probe technology, specifically relating to an ultrasound-activated ATP-responsive long-persistence nanoprobe, its preparation method, and its application. Background Technology

[0002] Adenosine triphosphate (ATP) is an important energy metabolism molecule in living organisms, widely involved in the regulation of cell signal transduction, metabolism, and various pathological processes. Changes in ATP concentration are often closely related to the tumor microenvironment, cell viability, and the occurrence and development of various diseases. Therefore, developing nanoprobes capable of highly sensitive recognition and response to ATP is of great significance for biological detection, disease diagnosis, and molecular imaging analysis.

[0003] Currently, most ATP response systems are constructed based on DNA aptamers. DNA aptamers can bind to ATP through specific recognition and achieve signal transduction through conformational changes, and are widely used in fluorescence detection, electrochemical analysis, and biosensing. However, existing ATP aptamer probes mostly employ a single signal output mode, and generally suffer from strong background interference, limited signal gain, insufficient system stability, and decreased recognition efficiency in complex biological environments, which restricts their further application in high-sensitivity detection and in vivo imaging.

[0004] Long-afterglow nanomaterials, due to their continuous luminescence after excitation, can effectively avoid background interference caused by autofluorescence and continuous excitation light in biological systems, exhibiting significant advantages in improving the signal-to-noise ratio. However, these materials typically lack selective response capabilities to specific biomolecules, making it difficult to achieve specific recognition and regulation of small molecules such as ATP.

[0005] On the other hand, ultrasound imaging, as a widely used clinical imaging technology, has advantages such as high real-time performance, non-invasiveness, high safety, and low cost. Ultrasound waves transfer energy through mechanical vibration and have centimeter-level tissue penetration capability (typically exceeding 10 cm), effectively overcoming the penetration limitations of optical excitation in tissues. Therefore, introducing ultrasound as an external excitation or modulation method into long-persistence nanosystems has potential application value.

[0006] Furthermore, in complex biological environments, if ATP aptamers remain in an exposed or freely responsive state for extended periods, they are prone to non-specific reactions, background signal leakage, and structural instability. Therefore, effectively pre-treating or pre-activating the probe system before ATP response, transforming it from a stable state to a responsive state, and further triggering structural dissociation in the presence of ATP to achieve controllable signal release and amplification, has become a pressing technical problem in this field. Summary of the Invention

[0007] To address the shortcomings of existing technologies, the present invention aims to provide an ultrasound-activated ATP-responsive long-afterglow nanoprobe, its preparation method, and its application. This probe can first selectively remove the protective structure through external physical stimulation, enabling the probe to enter a responsive state. Subsequently, it recognizes ATP through an ATP aptamer and induces a conformational change in DNA, further triggering the detachment of the DNA strand linked to the metal nanoparticles. This relieves the quenching effect of the metal nanoparticles on the afterglow nanoparticles, thereby achieving enhanced output of the ATP-responsive afterglow signal.

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] This invention provides a long-persistence nanoprobe with an ultrasound-activated ATP response, using long-persistence nanoparticles as the core and metal nanoparticles as satellite quenching units;

[0010] The surface of the long-afterglow nanoparticles is linked to amino-modified DNA1 via an amide coupling reaction to obtain long-afterglow nanoparticles-DNA1.

[0011] The surface of the metal nanoparticles is modified with phosphorylated polyethylene glycol azide (p-PEG-N3), and then a click chemical reaction is carried out with alkynyl-modified DNA2 to obtain metal nanoparticle-DNA2.

[0012] The long-afterglow nanoparticles-DNA1 and metal nanoparticles-DNA2 are assembled through DNA hybridization to form ATP-responsive long-afterglow nanoprobes.

[0013] The ATP-responsive long-afterglow nanoprobe further interacts with the nucleic acid fragment DNA3.

[0014] DNA1 undergoes base complementarity pairing to form the sonic-activated ATP-responsive long-afterglow nanoprobe.

[0015] The nucleotide sequence (3'-5') of the DNA1 is SEQ ID NO.1, that is:

[0016] AAAAGTCGTGGAAGGAGGCGTTATGAGGGGTCCA;

[0017] The nucleotide sequence (5'-3') of the DNA2 is SEQ ID NO.2, that is:

[0018] AAAACAGCACCTTCC;

[0019] The nucleotide sequence of DNA1 contains an aptamer sequence that specifically binds to ATP. DNA3 is used to block the recognition site of the ATP aptamer. Under the action of ultrasound, DNA3 detaches, exposing the ATP aptamer and allowing it to bind specifically to ATP. This induces the metal nanoparticle-DNA2 to detach, thereby relieving the quenching effect of the metal nanoparticle on the long-afterglow nanoparticle and enhancing the afterglow signal output.

[0020] In a preferred embodiment, the nucleotide sequence of DNA3 contains 8-12 bases, which are complementary to the last 8-12 bases in the nucleotide sequence of DNA1.

[0021] In a preferred embodiment, the long afterglow nanoparticles are covalently linked to DNA1 via CO-NH bonds.

[0022] In a preferred embodiment, the 3' modified amino group of the DNA1 has a nucleotide sequence that specifically binds to ATP in more than 70% of cases.

[0023] The 5' modified alkyne group of the DNA2.

[0024] In a preferred embodiment, the ultrasound-activated ATP-responsive long-afterglow nanoprobe has a core-shell satellite structure with a particle size of 70-230 nm; more preferably, it has a particle size of 100-180 nm.

[0025] In a preferred embodiment, the long afterglow nanoparticles include, but are not limited to, TA NPs, MEHPPV NPs, and PFODBTNPs;

[0026] Chemical structural formula of TA:

[0027]

[0028] Chemical structural formula of MEHPPV:

[0029]

[0030] Chemical structural formula of PFODBT:

[0031] .

[0032] In a preferred embodiment, the metal nanoparticles include, but are not limited to, FeO. x FeZnO x FeMnO x .

[0033] In a preferred embodiment, the metal nanoparticles have a uniform spherical structure with a particle size of 3~20 nm; more preferably, they have a particle size of 4~6 nm.

[0034] As a general inventive concept, the present invention also provides a method for preparing the aforementioned ultrasound-activated ATP-responsive long-persistence nanoprobe, comprising:

[0035] (1) Synthesis of long afterglow nanoparticles;

[0036] (2) Synthesis of long afterglow nanoparticles-DNA1: The long afterglow nanoparticles obtained in step (1) were mixed with amino-modified DNA1 in PBS buffer, and then EDC (1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride) was added. The mixture was reacted under stirring and then ultrafiltered to obtain long afterglow nanoparticles-DNA1.

[0037] (3) Synthesis of metal nanoparticles;

[0038] (4) Metal nanoparticles @PEG-N3: The metal nanoparticles obtained in step (3) are mixed with N,N-dimethylformamide (DMF), phosphorylated azide polyethylene glycol (p-PEG-N3), 2-bromo-2-methylpropionic acid (BMPA), and ascorbic acid (AA) are added to the reaction system. The mixture is shaken at a set temperature. After the reaction is completed, the product is precipitated and then purified and concentrated by centrifugation and filtration to obtain metal nanoparticles @PEG-N3.

[0039] (5) Metal nanoparticles-DNA2: CuSO4, tri-hydroxypropyltriazolamide (THPTA), ascorbic acid (AA), alkynyl-modified DNA2 and metal nanoparticles@PEG-N3 obtained in step (4) were mixed, purified and concentrated by ultrafiltration to obtain metal nanoparticles-DNA2, and then dispersed in ultrapure water for cold storage.

[0040] (6) Assembly: The long afterglow nanoparticles-DNA1 obtained in step (2) and the metal nanoparticles-DNA2 obtained in step (5) are mixed in PBS buffer containing Na ions and Mg ions to obtain ATP-responsive long afterglow nanoprobes.

[0041] (7) Hybridize DNA3 with the ATP-responsive long-persistence nanoprobe obtained in step (6) to form the ultrasound-activated ATP-responsive long-persistence nanoprobe.

[0042] Furthermore, in step (2), the molar ratio of long afterglow nanoparticles to DNA1 is (5~8):1, the pH value of PBS buffer is 7.4, the final concentration of EDC is 100~250 mM, the reaction time is 5~24 h, the ultrafiltration speed is 3000~6000 rpm, the ultrafiltration time is 5~10 min, and the purification cycle with PBS buffer is 3~5 times.

[0043] Furthermore, in step (4), the mass ratio of metal nanoparticles, phosphorylated azidopolyethylene glycol (p-PEG-N3), 2-bromo-2-methylpropionic acid (BMPA), and ascorbic acid (AA) is (5~10):5:(165~175):(27~43); the incubation temperature is 30~35 ℃, the shaking time is 15~24 h, the shaking speed is 160~170 rpm, the ultrafiltration speed is 3000~6000 rpm, the ultrafiltration time is 5~10 min, and the purification is carried out with PBS buffer for 3~5 cycles.

[0044] Furthermore, in step (5), the molar ratio of copper sulfate (CuSO4), tri-hydroxypropyltriazolamide (THPTA), and ascorbic acid (AA) is (1~1.5):4:10; the incubation temperature is 25~37 ℃, the shaking time is 4~12 h, the ultrafiltration speed is 3000~6000 rpm, the ultrafiltration time is 5~10 min, and the purification is carried out with PBS buffer for 3~5 cycles.

[0045] Furthermore, in step (6), the assembly mass ratio of long-afterglow nanoparticles-DNA1 and metal nanoparticles-DNA2 is (34~39):1; the concentrations of NaCl and MgCl2 are 25~50 mM and 1~2.5 mM, respectively; the incubation temperature is 15~37 ℃; the shaking time is 12~24 h; the ultrafiltration speed is 3000~6000 rpm; the ultrafiltration time is 5~10 min; and the product is purified 3~5 times with PBS buffer.

[0046] This invention also provides the application of the ultrasound-activated ATP-responsive long-persistence nanoprobe, which is used to prepare contrast agents for tumor imaging. Under ultrasound, DNA3 in the long-persistence nanoprobe that has hybridized with the ATP aptamer dissociates, exposing the ATP aptamer and allowing it to bind specifically to ATP. This induces the dissociation of DNA2 linked to the metal nanoparticles, relieving the quenching effect of the metal nanoparticles on the long-persistence nanoparticles, thereby achieving ATP-responsive persistence imaging.

[0047] The principle of this invention: Based on the programmable assembly of nucleic acids and the response mechanism of external field regulation, this invention constructs an ATP-responsive long-persistence nanoprobe system with spatiotemporal controllability of ultrasound. Long-persistence nanoparticles and functionalized metal nanoparticles serve as the luminescent and quenching units, respectively, and are assembled spatially close to each other through nucleic acid chain mediation. The ATP aptamer sequence (DNA1) serves as the recognition unit, forming a stable double-stranded structure with its complementary strand (DNA2). Simultaneously, a short protective strand is introduced into the key recognition region of the aptamer to block the ATP binding site, rendering the aptamer in an "inactive" state. In this assembly configuration, the metal nanoparticles approach the long-persistence nanoparticles, effectively quenching the long-persistence luminescence through energy transfer or electron transfer, resulting in a low-signal background state for the entire system. Under external ultrasound, the local mechanical disturbance and cavitation effect generated by ultrasound preferentially cause the protective strand to detach, thereby exposing the recognition region of the ATP aptamer and restoring its specific binding ability to ATP, achieving a transition from a "closed state" to a "responsive state." When the system is in an ATP-containing environment, the ATP aptamer undergoes conformational rearrangement and binds specifically to ATP, inducing further dissociation or reconstruction of the original nucleic acid double-stranded structure. This disrupts the spatial proximity between the long-afterglow nanoparticles and the metal nanoparticles, significantly weakening or eliminating the quenching effect. With the elimination of quenching, the luminescence signal of the long-afterglow nanoparticles is restored or even enhanced, thereby achieving a "dark to bright" signal transition in the ATP response.

[0048] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0049] (1) The ultrasound-controlled spatiotemporally responsive ATP-reactive long-persistence nanoprobe system provided by this invention introduces a protective chain structure in the ATP aptamer recognition region, which is inactive in the initial state and selectively unwinds under external ultrasound to expose the recognition site, thereby achieving "on-demand activation" of the probe. Compared with traditional aptamer probes that are always in an open state, this effectively avoids non-specific binding and background signals caused by low concentrations of ATP in the environment, thus improving the accuracy of imaging.

[0050] (2) The ultrasonic spatiotemporally controllable ATP-responsive long-persistence nanoprobe system provided by this invention spatially couples metal nanoparticles with long-persistence nanoparticles, utilizing their quenching effect on the luminescent unit to maintain a low signal output in the initial state; under ATP triggering, the nucleic acid structure dissociates, causing the two to separate spatially, the quenching effect is relieved, and the signal is switched from "off" to "on". This mechanism significantly improves signal contrast and detection sensitivity. (The process is as follows) Figure 1 (As shown).

[0051] (3) The present invention uses long-afterglow nanoparticles as signal output units, which can continue to emit light after the external excitation stops, avoiding interference from the autofluorescence of biological tissues and real-time excitation light. Compared with traditional fluorescent probes, it has a higher signal-to-noise ratio and deeper tissue penetration ability, and is suitable for imaging complex in vivo environments.

[0052] (4) This invention achieves layer-by-layer screening of signal output through a multi-level response process of ultrasound triggering, ATP specific recognition, and structural dissociation. Compared with probes with a single response mechanism, it effectively reduces the probability of false response and improves the accuracy and reliability of detection results.

[0053] This invention achieves precise spatiotemporal control of probe response through a cascade response mechanism of ultrasound triggering, aptamer activation, ATP recognition, and quenching release. It has the advantages of low background, high signal-to-noise ratio, strong specificity, and high sensitivity, and can be used for the preparation of contrast agents for tumor imaging and for high-sensitivity afterglow imaging detection of ATP in complex biological environments. Attached Figure Description

[0054] Figure 1 A schematic diagram of the response process of the long-persistence nanoprobe for ATP response using ultrasonic spatiotemporal control in this invention;

[0055] Figure 2 The diagram shows the preparation process of the long-persistence nanoprobe for ATP response using long-sonic spatiotemporal control.

[0056] Figure 3 TEM image of the long-persistence nanoprobe for ATP response prepared in Example 1 using ultrasonic spatiotemporal control;

[0057] Figure 4 This refers to the afterglow quenching of long afterglow nanoparticles by metal nanoparticles in Example 1;

[0058] Figure 5 The image shows the afterglow response of the long-persistence nanoprobe used for ultrasonic spatiotemporal control in Example 2 before and after ultrasonication to the ATP response.

[0059] Figure 6 This is an example of the selective testing of ATP before and after ultrasound using a long-persistence nanoprobe for ATP response under ultrasonic spatiotemporal control in Example 2.

[0060] Figure 7 This refers to the afterglow response of the long-persistence nanoprobe used for ultrasonic spatiotemporal control in Example 2 to different concentrations of ATP before and after ultrasound.

[0061] Figure 8 The afterglow response of the long-afterglow nanoprobe with non-specific ATP response in Example 2 is shown to different concentrations of ATP. Detailed Implementation

[0062] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0063] The assembly process of ultrasound-activated ATP-responsive long-afterglow nanoprobes is as follows: Figure 2 As shown, it includes the following steps:

[0064] (1) Synthesis of long-afterglow nanoparticles: PSMA, F127, and long-afterglow polymers (such as the previously reported TA, MEHPPV, or PFODBT polymers) were dissolved in THF, rapidly introduced into ultrapure water, sonicated, and then rotary evaporated. The process was carried out in the dark. After ultrafiltration, the nanoparticles were stored at 4 °C.

[0065] (2) Synthesis of long-afterglow nanoparticles-DNA1: The long-afterglow nanoparticles prepared in step (1) were mixed with DNA1 in PBS buffer, briefly vortexed, and EDC was added. The mixture was stirred and then purified three times with PBS buffer.

[0066] (3) Synthesis of metal nanoparticles: FeCl3 and erucic acid were dissolved in methanol, and NaOH pre-dissolved in methanol was added dropwise under constant stirring to form ferric erucic acid; MnCl2 and oleic acid were mixed in methanol, and NaOH pre-dissolved in methanol was added dropwise under continuous stirring to synthesize manganese oleate. Manganese oleate, ferric erucic acid, oleyl alcohol and oleic acid were added to dibenzyl ether, heated under argon protection for a set time, and then acetone was added to induce the precipitation of nanoparticles. The solid was separated by centrifugation, and the obtained FeMnOx was dispersed in chloroform for storage;

[0067] (4) Metal nanoparticles @PEG-N3: The metal nanoparticles prepared in step (3) are mixed with N,N-dimethylformamide, p-PEG-N3, BMPA and AA are added to the reaction system, the mixture is shaken at the set temperature, and finally ice-cold diethyl ether is added to precipitate the metal nanoparticles @PEG-N3. After centrifugation and filtration purification, the mixture is dispersed in PBS buffer for storage.

[0068] (5) Metal nanoparticles-DNA2: Freshly prepared CuSO4, THTTA, AA, alkyne-modified DNA2 and metal nanoparticles@PEG-N3 prepared in step (4) were mixed, purified by ultrafiltration, and dispersed in PBS buffer.

[0069] (6) Assembly of ATP-responsive long-afterglow nanoprobes: The long-afterglow nanoparticles-DNA1 prepared in step (2) and the metal nanoparticles-DNA2 prepared in step (5) were mixed in PBS buffer containing Na and Mg ions to obtain ATP-responsive long-afterglow nanoprobes. The samples were purified by ultrafiltration using PBS buffer.

[0070] (7) Assembly of DNA3 control strand and ATP-responsive long-afterglow nanoprobe: The ATP-responsive long-afterglow nanoprobe prepared in step (6) was mixed with DNA3 in PBS buffer, briefly vortexed, and then the mixture was purified three times with PBS buffer.

[0071] When synthesizing the ATP-unresponsive control probe, DNA1 is modified to contain a sequence without the ATP aptamer; the other steps are similar to the preparation method of long afterglow / NMR nanoprobes.

[0072] The following description, through specific embodiments and accompanying drawings, provides further details.

[0073] Example 1

[0074] The assembly process of ultrasound-activated ATP-responsive long-afterglow nanoprobes includes the following steps:

[0075] (1) Synthesis of long afterglow nanoparticles: Under ultrasonic conditions, a solution containing TA (5 mg / mL), PSMA (poly(styrene-co-maleic anhydride), 15 mg / mL), and THF solution containing F127 (15 mg / mL) were mixed. The mixture was then rapidly injected into ultrapure water (6 mL), followed by rapid injection into Na2CO3 solution (1 mL). The mixture was ultrasonicated for 4 min, and the THF in the mixture was rotary evaporated at 40 °C.

[0076] (2) Synthesis of long-afterglow nanoparticles-DNA1: 80 μg mL -1 TA NP and 100 μM DNA1 were mixed in 2 mL of 1×PBS buffer, the mixture was briefly vortexed, EDC (pH 7.4) was added, and the reaction was carried out with stirring for 6 hours. Subsequently, the mixture was purified three times with ultrapure water using ultrafiltration (MWCO 100 kDa, 6000 rpm, 5 min per cycle).

[0077] (3) Synthesis of metal nanoparticles: 3.2 g FeCl3 and 10.2 g erucic acid were dissolved in 60 mL methanol, and then 1.2 g NaOH, which was pre-dissolved in 120 mL methanol, was added dropwise at 50 °C with constant stirring to form ferric erucic acid. Following the same procedure, 1.3 g MnCl2 and 6.0 g oleic acid were mixed in 58 mL methanol, and 0.8 g NaOH was added to 100 mL methanol at 50 °C with continuous stirring to form manganese oleate. 1.0 g manganese oleate, 3 g ferric erucic acid, 2 g oleyl alcohol, and 1 g oleic acid were completely added to 15 g dibenzyl ether, and then heated to 260-290 °C and maintained under argon protection for 40 min. 20 mL acetone was added to induce the precipitation of nanoparticles, and then the solid was separated by centrifugation. The obtained metal nanoparticles were redispersed in chloroform and stored at 4 °C.

[0078] (4) Synthesis of metal nanoparticles @PEG-N3: 8 mg of metal nanoparticles were dispersed in chloroform (8 mL) and N,N-dimethylformamide (8 mL) containing 10 mg of p-PEG-N3, 200 mg of BMPA, and 20 mg of AA. The reaction was carried out with shaking at 35 °C for 24 h. After completion, the modified metal nanoparticles @PEG-N3 product was precipitated by adding ice-cold diethyl ether, and then the final product was purified by centrifugation and filtration and redispersed in H2O and stored at 4 °C.

[0079] (5) Synthesis of metal nanoparticles-DNA2: 10 nmol of DNA2 was mixed with metal nanoparticles@PEG-N3 and a small volume of 200 μM CuSO4, 2 mM ascorbic acid (AA) and 800 μM THPTA mixture was added. The mixture was purified by ultrafiltration (MWCO 10 kDa, 6000 rpm, 5 min), then dispersed in PBS buffer and stored at 4 °C.

[0080] (6) Assembly of ATP-responsive long-afterglow nanoprobes: long-afterglow nanoparticles-DNA1 and metal nanoparticles-DNA2 (5 mg / mL) −1 The ATP-responsive long-afterglow nanoprobe was added to PBS buffer with 100 mM NaCl and 3 mM MgCl2, and purified by shaking at 25 °C for 24 h, followed by purification at 6000 rpm, MWCO 100 kDa, and 5 min. The purified ATP-responsive long-afterglow nanoprobe was then dispersed in PBS buffer for further use.

[0081] (7) Assembly of DNA3 control strand and ATP-responsive long-afterglow nanoprobe: The ATP-responsive long-afterglow nanoprobe prepared in step (6) was mixed with DNA3 (DNA1:DNA3 molar ratio = 1:1) in PBS buffer and purified by shaking at 15 °C for 12 h, 6000 rpm, MWCO 100 kDa, 5 min. The purified ATP-responsive long-afterglow nanoprobe was redispersed in PBS buffer for further use.

[0082] Example 2

[0083] 1. The afterglow response of a long-afterglow nanoprobe with ultrasound-activated ATP response before and after ATP response;

[0084] The ultrasound-activated ATP-responsive long-persistence nanoprobe prepared in Example 1 was used. Its final concentration was 5 μg / mL, and it was ultrasound-treated for 3 min at a duty cycle of 50% and a power of 1.0 W. After ultrasound treatment, ATP was added to bring the final ATP concentration to 5 mM. The reaction system was PBS buffer, with a total volume of 200 μL. Subsequently, long-persistence luminescence imaging after ultrasound was performed using the IVIS Lumina XR imaging system in bioluminescence mode. The imaging parameters were set as follows: open filter, acquisition time 60 s, and field of view C. The obtained long-persistence luminescence images were analyzed for regions of interest using Living Image 4.0 software. The results are as follows. Figure 5 As shown.

[0085] Depend on Figure 5 It can be seen that the long-afterglow signals of the control group, the ATP-only group, and the ultrasound-only group were all weak, and the differences among the three groups were small. This indicates that neither ultrasound alone nor ATP alone is sufficient to significantly activate the probe system. The reason is that when both ultrasound activation and ATP recognition are not simultaneously met, the probe as a whole maintains its original assembly state, and the metal nanoparticles remain close to the long-afterglow nanoparticles, continuously quenching the afterglow luminescence. Therefore, the system signal remains at a low level.

[0086] In the ultrasound-treated + ATP group, the long-afterglow signal was significantly enhanced, exceeding that of other groups. This result indicates that the probe system constructed in this invention exhibits a clear cascade response characteristic. Specifically, ultrasound treatment first induces the preferential dissociation of the DNA3 control strand, releasing its blocking effect on the ATP aptamer recognition site, thus transforming the ATP aptamer from an inactive state to a responsive state. Subsequently, in the presence of ATP, the exposed aptamer specifically binds to ATP and undergoes conformational rearrangement, further inducing the dissociation of the relevant nucleic acid hybridization structure in the probe. This causes the metal nanoparticles originally assembled adjacent to the long-afterglow nanoparticles to detach, thereby relieving their quenching effect on the long-afterglow luminescence, ultimately achieving the recovery and enhanced output of the afterglow signal.

[0087] The above results demonstrate that the ultrasound-activated ATP-responsive long-persistence nanoprobe described in this invention does not produce a significant response to a single stimulus. Instead, it requires prior ultrasound activation followed by further structural disassembly triggered in the presence of ATP to generate a significant signal enhancement effect. This proves that the probe system can achieve a cascade response mechanism of ultrasound triggering, aptamer activation, ATP recognition, and quenching release, exhibiting good spatiotemporal controllability, low background signal, and high ATP recognition specificity.

[0088] 2. Selectivity test of ATP before and after ultrasound with long-persistence nanoprobes for ultrasound-activated ATP response.

[0089] To investigate the ATP recognition selectivity of the ultrasound-activated ATP-responsive long-persistence nanoprobe described in this invention, and to further verify the regulatory effect of ultrasound activation on the probe's response behavior, the ultrasound-activated ATP-responsive long-persistence nanoprobe prepared in Example 1 was used to perform selectivity tests on ATP and other interfering substances before and after ultrasounding. The results are as follows: Figure 6 As shown. The prepared ultrasound-activated ATP-responsive long-persistence nanoprobes were incubated with ATP and other control molecules under the same conditions, with ultrasound-treated and untreated groups. After the reaction was complete, long-persistence emission images were acquired using an IVIS Lumina XR imaging system, and the regions of interest were quantitatively analyzed. Figure 6 As shown in the imaging results on the left and the bar chart on the right, without sonication, the probe only showed a weak long-afterglow signal for ATP and other test molecules. The overall signal level was low, and the differences between groups were small. This indicates that without activation by external physical stimuli, the DNA3 control strand in the probe still stably blocked the ATP aptamer recognition site, and the ATP aptamer was in an inactive state. Even if ATP was present in the system, it was difficult to induce significant structural changes and signal recovery.

[0090] After sonication, the probe showed a significant enhancement in the long-afterglow luminescence signal of the ATP group, which was significantly higher than that of the untreated ATP group and other interference groups treated with the same sonication. In contrast, other control molecules did not show significant signal enhancement before and after sonication, and remained at a low luminescence level. These results indicate that sonication itself does not directly lead to the recovery of non-specific signals from the probe. Instead, it promotes the preferential dissociation of the DNA3 control strand, exposing the ATP aptamer recognition site, thus transforming the probe from a closed and inactive state to a responsive state. Based on this, only ATP can specifically bind to the exposed aptamer and induce nucleic acid conformational rearrangement, further causing the DNA strand linked to the metal nanoparticles to dissociate, allowing the metal nanoparticles to detach from the surface of the long-afterglow nanoparticles, thereby relieving the quenching effect and restoring the long-afterglow luminescence signal.

[0091] 3. The afterglow response of ultrasound-activated ATP-responsive long-persistence nanoprobes and ATP-nonspecific long-persistence nanoprobes to different concentrations of ATP before and after ultrasound.

[0092] To further evaluate the response behavior of the long-afterglow nanoprobe based on ultrasound spatiotemporal control of ATP response described in this invention under different ATP concentration conditions, and to compare it with a long-afterglow nanoprobe with non-specific ATP response, the changes in afterglow luminescence of the two probes before and after ultrasounding for different concentrations of ATP were tested. The results are as follows: Figure 7 and Figure 8 As shown. Among them, Figure 7 This image shows the afterglow response of a long-persistence nanoprobe based on spatiotemporal ultrasound-controlled ATP response before and after ultrasounding under different ATP concentrations. Figure 7 As can be seen from the afterglow imaging on the left, without ultrasound treatment, although the probe signal changes to some extent with the increase of ATP concentration, the overall afterglow intensity remains at a low level with limited enhancement. However, after ultrasound treatment, the afterglow emission signal of the probe gradually increases with the increase of ATP concentration, achieving a significant enhancement effect in the range of higher ATP concentrations. Figure 7 The quantitative results on the right further indicate that the afterglow intensity of the ultrasonically treated experimental group was generally higher than that of the non-ultrasonic group at various ATP concentrations, and showed a more obvious upward trend with increasing ATP concentration.

[0093] The above results demonstrate that the response of the probe system described in this invention exhibits a significant "ultrasonic pre-activation" dependence. This is because, without sonication, the DNA3 control strand remains complementary to the ATP aptamer recognition region in DNA1, and the ATP aptamer is in a closed, inactive state. ATP cannot fully bind and induce subsequent structural dissociation, thus signal recovery is limited even with increased ATP concentration. However, under sonication, the DNA3 control strand preferentially dissociates, exposing the ATP aptamer recognition site, allowing the probe to become responsive. Subsequently, as ATP concentration increases, the probability of ATP binding to the aptamer increases, inducing nucleic acid conformational rearrangement and further dissociation of related hybridization strands. This causes the metal nanoparticles to gradually detach from the surface of the long-afterglow nanoparticles, continuously weakening the quenching effect, thereby gradually enhancing the afterglow signal with increasing ATP concentration. These results indicate that the probe system constructed in this invention not only exhibits good ATP concentration dependence but also achieves pre-activation through sonication, significantly improving ATP response efficiency and signal output level.

[0094] Figure 8 This image shows the afterglow response of a long-persistent nanoprobe with a non-specific ATP response before and after sonication under different ATP concentrations. Figure 8 As can be seen, the probe exhibited only weak signal changes with ATP concentration under both non-sonication and sonication conditions, and the overall difference before and after sonication was small. No significant concentration-dependent enhancement trend was observed as seen in the probe of this invention. Quantitative results showed that the afterglow intensity changes were limited in both the sonicated and non-sonicated groups at different ATP concentrations, indicating that this non-specific response probe lacks a clear cascade response mechanism involving sonication activation, ATP recognition, and structural dissociation. (Comparison) Figure 7 and Figure 8 It can be seen that the long-persistence nanoprobe based on ultrasound spatiotemporal control of ATP response described in this invention exhibits a more significant concentration-dependent signal enhancement to ATP after ultrasound treatment, while the long-persistence nanoprobe with non-specific ATP response does not show the same degree of response difference. This indicates that the probe system constructed in this invention can achieve controllable blocking and release of ATP aptamer recognition sites through the DNA3 control chain, and achieve the transition of the probe from a quiescent state to a responsive state through ultrasound triggering; on this basis, the detachment of metal nanoparticles is induced by ATP-specific recognition, thereby relieving the quenching effect on the long-persistence nanoparticles and ultimately achieving enhanced output of the afterglow signal.

[0095] The above content is only a specific implementation example of the present invention, and not all application examples of the present invention. All schemes that follow the technical concept of the present invention or make modifications based on the technical concept of the present invention are within the protection scope of the claims of the present invention.

Claims

1. A long-persistence nanoprobe with ultrasound-activated ATP response, comprising long-persistence nanoparticles as the core and metal nanoparticles as satellite quenching units, characterized in that... ； The surface of the long-afterglow nanoparticles is linked to amino-modified DNA1 via an amide coupling reaction to obtain long-afterglow nanoparticles-DNA1. The surface of the metal nanoparticles is modified with phosphorylated polyethylene glycol azide (p-PEG-N3), and then a click chemical reaction is carried out with alkynyl-modified DNA2 to obtain metal nanoparticle-DNA2. The long-afterglow nanoparticles-DNA1 and metal nanoparticles-DNA2 are assembled through DNA hybridization to form ATP-responsive long-afterglow nanoprobes. The ATP-responsive long-afterglow nanoprobe further interacts with the nucleic acid fragment DNA3. DNA1 undergoes base complementarity pairing to form the sonic-activated ATP-responsive long-afterglow nanoprobe. The nucleotide sequence (3'-5') of the DNA1 is SEQ ID NO.1, that is: AAAAGTCGTGGAAGGAGGCGTTATGAGGGGTCCA; The nucleotide sequence (5'-3') of the DNA2 is SEQ ID NO.2, that is: AAAACAGCACCTTCC; The nucleotide sequence of DNA1 contains an aptamer sequence that specifically binds to ATP. DNA3 is used to block the recognition site of the ATP aptamer. Under the action of ultrasound, DNA3 detaches, exposing the ATP aptamer and allowing it to bind specifically to ATP. This induces the metal nanoparticle-DNA2 to detach, thereby relieving the quenching effect of the metal nanoparticle on the long-afterglow nanoparticle and enhancing the afterglow signal output.

2. The long-afterglow nanoprobe with ultrasound-activated ATP response according to claim 1, characterized in that, The nucleotide sequence of DNA3 contains 8-12 bases, which are complementary to the last 8-12 bases in the nucleotide sequence of DNA1.

3. The long-persistence nanoprobe with ultrasound-activated ATP response according to claim 1, characterized in that, The long afterglow nanoparticles are covalently linked to DNA1 via CO-NH bonds; The 3' modified amino group of the DNA1 has a nucleotide sequence that specifically binds to ATP in more than 70% of cases. The 5' modified alkyne group of the DNA2.

4. The long-afterglow nanoprobe with ultrasound-activated ATP response according to claim 1, characterized in that, The ultrasound-activated ATP-responsive long-afterglow nanoprobe has a core-shell satellite structure with a particle size of 70-230 nm.

5. The long-persistence nanoprobe with ultrasound-activated ATP response according to claim 1, characterized in that, The long afterglow nanoparticles include, but are not limited to, TA NPs, MEHPPV NPs, and PFODBT NPs.

6. The long-afterglow nanoprobe with ultrasound-activated ATP response according to claim 1, characterized in that, The metal nanoparticles include, but are not limited to, FeO. x FeZnO x FeMnO x ; The metal nanoparticles have a uniform spherical structure with a particle size of 3~20 nm.

7. The method for preparing the ultrasound-activated ATP-responsive long-afterglow nanoprobe according to any one of claims 1 to 6, characterized in that... include: (1) Synthesis of long afterglow nanoparticles; (2) Synthesis of long afterglow nanoparticles-DNA1: The long afterglow nanoparticles obtained in step (1) were mixed with amino-modified DNA1 in PBS buffer, and then EDC was added. The mixture was reacted under stirring and ultrafiltered to obtain long afterglow nanoparticles-DNA1. (3) Synthesis of metal nanoparticles; (4) Metal nanoparticles @PEG-N3: The metal nanoparticles obtained in step (3) are mixed with N,N-dimethylformamide (DMF), phosphorylated azide polyethylene glycol (p-PEG-N3), 2-bromo-2-methylpropionic acid (BMPA), and ascorbic acid (AA) are added to the reaction system. The mixture is shaken at a set temperature. After the reaction is completed, the product is precipitated and then purified and concentrated by centrifugation and filtration to obtain metal nanoparticles @PEG-N3. (5) Metal nanoparticles-DNA2: CuSO4, tri-hydroxypropyltriazolamide (THPTA), ascorbic acid (AA), alkynyl-modified DNA2 and metal nanoparticles@PEG-N3 obtained in step (4) were mixed, purified and concentrated by ultrafiltration to obtain metal nanoparticles-DNA2, and then dispersed in ultrapure water for cold storage. (6) Assembly: The long afterglow nanoparticles-DNA1 obtained in step (2) and the metal nanoparticles-DNA2 obtained in step (5) are mixed in PBS buffer containing Na ions and Mg ions to obtain ATP-responsive long afterglow nanoprobes. (7) Hybridize DNA3 with the ATP-responsive long-persistence nanoprobe obtained in step (6) to form the ultrasound-activated ATP-responsive long-persistence nanoprobe.

8. The method for preparing the ultrasound-activated ATP-responsive long-afterglow nanoprobe according to claim 7, characterized in that, In step (2), the molar ratio of long afterglow nanoparticles to DNA1 is (5~8):1, the pH value of PBS buffer is 7.4, the final concentration of EDC is 100~250 mM, the reaction time is 5~24 h, the ultrafiltration speed is 3000~6000 rpm, the ultrafiltration time is 5~10 min, and the purification cycle with PBS buffer is 3~5 times. In step (4), the mass ratio of metal nanoparticles, phosphorylated azidopolyethylene glycol (p-PEG-N3), 2-bromo-2-methylpropionic acid (BMPA), and ascorbic acid (AA) is (5~10):5:(165~175):(27~43); the incubation temperature is 30~35 ℃, the shaking time is 15~24 h, the shaking speed is 160~170 rpm, the ultrafiltration speed is 3000~6000 rpm, the ultrafiltration time is 5~10 min, and the purification is carried out with PBS buffer for 3~5 cycles.

9. The method for preparing the ultrasound-activated ATP-responsive long-afterglow nanoprobe according to claim 7, characterized in that, In step (5), the molar ratio of copper sulfate (CuSO4), tri-hydroxypropyltriazolamide (THPTA), and ascorbic acid (AA) is (1~1.5):4:10; the incubation temperature is 25~37 ℃, the shaking time is 4~12 h, the ultrafiltration speed is 3000~6000 rpm, the ultrafiltration time is 5~10 min, and the purification is carried out with PBS buffer for 3~5 cycles. In step (6), the assembly mass ratio of long-afterglow nanoparticles-DNA1 and metal nanoparticles-DNA2 is (34~39):1; the concentrations of NaCl and MgCl2 are 25~50 mM and 1~2.5 mM, respectively; the incubation temperature is 15~37 ℃; the shaking time is 12~24 h; the ultrafiltration speed is 3000~6000 rpm; the ultrafiltration time is 5~10 min; and the product is purified 3~5 times with PBS buffer.

10. The application of the long-persistence nanoprobe with ultrasound-activated ATP response according to any one of claims 1 to 6, characterized in that, It was used to prepare contrast agents for tumor imaging.

Images