Alternating magnetic field reinforced culture equipment and culture method of corrosion-resistant bacteria agent for circulating water

Abstract

This invention discloses a cultivation device and method for an alternating magnetic field-enhanced circulating water preservative agent, relating to the field of water treatment technology. The device includes a cultivation tank containing a packed bed, an aeration unit, and a dissolved oxygen probe. An alternating magnetic field device is mounted on the outer wall of the tank. The tank exterior is equipped with a temperature control unit, an OD600 monitoring unit, and a qPCR monitoring unit, as well as a central control unit electrically connected to each of the aforementioned units. During cultivation, the compounded preservative agent is inoculated into the tank. The temperature control unit, aeration unit, and alternating magnetic field device are activated for constant-temperature cultivation. During the cultivation process, the central control unit receives feedback signals in real time from the dissolved oxygen probe, OD600 monitoring unit, and qPCR monitoring unit, and automatically adjusts the aeration flow rate and magnetic field strength in a closed-loop manner accordingly. This invention achieves efficient cultivation of the preservative agent through integrated equipment and online closed-loop feedback control, improving the activity and stability of the agent.

Description

Technical Field

[0001] This invention belongs to the field of water treatment technology, specifically relating to a cultivation device and method for an alternating magnetic field-enhanced circulating water preservative agent. Background Technology

[0002] The circulating water system of a power plant is a crucial component of thermal power plants, and its water quality stability directly impacts the safe and economical operation of the units. During long-term operation, carbon steel pipes and heat exchange equipment in the circulating water system face severe corrosion problems. Corrosion leads to thinning of equipment walls, shortened service life, and in severe cases, unplanned shutdowns or even major safety accidents. Currently, power plant circulating water systems commonly use chemical scale and corrosion inhibitors to suppress corrosion, with commonly used agents including chromates, phosphates, organophosphonates, and zinc salts. However, heavy metal agents such as chromates are bioaccumulative and highly toxic, posing a persistent risk to the aquatic ecosystem; long-term discharge of phosphorus-containing agents can easily lead to eutrophication of receiving water bodies, exacerbating ecological problems such as excessive algal blooms. With increasingly stringent national environmental regulations on industrial wastewater discharge standards, traditional chemical treatment methods are facing increasing environmental compliance pressures, necessitating the development of green and efficient alternative corrosion prevention technologies.

[0003] Microbial corrosion protection technology has gradually become a research hotspot in the field of corrosion protection for circulating water systems due to its environmental friendliness, long-lasting effect, and lack of secondary pollution. In recent years, some power plants have begun to try directly adding commercial microbial agents to their circulating water systems, achieving certain corrosion protection effects through the corrosion-inhibiting substances secreted by microorganisms. However, this model has revealed significant shortcomings in practice: First, power plants lack dedicated equipment for online cultivation of functional microbial communities tailored to their own circulating water quality characteristics. After direct addition of commercial agents, they exhibit poor adaptability, short survival time, and rapid decline in functional activity in the face of the high salinity, temperature fluctuations, and water quality volatility of power plant circulating water. Second, most existing commercial agents are freeze-dried powders, lacking on-site activation and propagation capabilities. After addition, they are difficult to form stable, high-density functional microbial communities within the system, often requiring frequent replenishment to maintain basic protective effects, resulting in heavy operating costs and manual maintenance burdens.

[0004] Currently, there is no integrated and intelligent online cultivation equipment for preservative agents in the industry. Most existing microbial cultivation devices only have basic temperature control and stirring functions. The cultivation process relies heavily on human experience for judgment and intervention, and has the following common defects: First, there is a lack of online status monitoring methods, making it impossible to know the dynamic changes in bacterial density and functional activity during the cultivation process in real time, and the cultivation endpoint is difficult to quantify objectively; Second, there is a lack of adaptive control mechanisms based on real-time data. Once key process parameters such as aeration rate and temperature are set, they remain fixed and cannot be dynamically optimized according to the growth status of the bacterial community; Third, there is a lack of targeted enhancement methods for microbial functional activity, and it is difficult to obtain highly active functional agents by relying solely on conventional cultivation conditions. Summary of the Invention

[0005] The purpose of this invention is to provide a cultivation device and method for circulating water preservative agents enhanced by alternating magnetic fields, so as to solve the technical problem that there is a lack of circulating water preservative agent cultivation devices and methods with integrated functions of online cultivation, activity enhancement and adaptive regulation in the prior art.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a cultivation device for an alternating magnetic field enhanced circulating water preservative agent, comprising a cultivation tank body, wherein a packing bed is fixedly arranged in the middle section of the inner side of the cultivation tank body, an aeration unit is arranged at the bottom of the cultivation tank body, a dissolved oxygen probe is arranged below the liquid surface inside the cultivation tank body, and alternating magnetic field devices are installed on the outer walls of both sides of the cultivation tank body. The culture tank is equipped with a temperature control unit, an OD600 monitoring unit, and a qPCR monitoring unit on its exterior. The temperature control unit is connected to the interior space of the culture tank. The OD600 monitoring unit extends into the interior of the culture tank through an insertable optical probe. The qPCR monitoring unit extends into the interior of the culture tank through an insertable sampling probe. The culture device also includes a central control unit, which is electrically connected to the temperature control unit, aeration unit, dissolved oxygen probe, alternating magnetic field device, OD600 monitoring unit and qPCR monitoring unit, respectively.

[0007] A further improvement of the present invention is that the packing bed is filled with magnetite particles and / or maghemite particles.

[0008] A further improvement of the present invention is that the filling amount of the packing bed is 50~200mg / L corresponding to the effective volume of the culture tank, the height of the packing bed is 1 / 6~1 / 4 of the effective height of the culture tank, and the particle size of the magnetite particles or maghemite particles is 2~5mm.

[0009] A further improvement of the present invention is that the alternating magnetic field device includes two sets of electromagnet cores symmetrically arranged on the outer walls of the left and right sides of the culture tank, each set of electromagnet cores is connected to a programmable excitation power supply, and the magnetic field strength applied by the alternating magnetic field device is continuously adjustable in the range of 5~60mT.

[0010] Secondly, the present invention also provides a method for cultivating a circulating water preservative agent enhanced by an alternating magnetic field, using the above-mentioned cultivation equipment, and comprising the following steps: S1, the compound preservative agent is inoculated into the culture tank; S2, start the temperature control unit, aeration unit and alternating magnetic field device, and carry out constant temperature cultivation under the control of the temperature control unit. The aeration unit supplies gas to the tank and maintains the dissolved oxygen concentration in the tank according to the monitoring signal of the dissolved oxygen probe. The alternating magnetic field device applies an alternating magnetic field to the tank. S3. During the cultivation process, the central control unit receives the dissolved oxygen concentration signal fed back by the dissolved oxygen probe, the OD600 value signal fed back by the OD600 monitoring unit, and the target gene copy number signal fed back by the qPCR monitoring unit in real time, and automatically adjusts the aeration flow rate of the aeration unit and the magnetic field strength of the alternating magnetic field device in a closed loop according to the preset feedback control logic. S4. After the culture is completed, the sludge precipitate in the solution inside the culture tank is collected to obtain the alternating magnetic field enhanced circulating water preservative agent.

[0011] A further improvement of the present invention is that the preset feedback control logic includes: When the dissolved oxygen probe detects a dissolved oxygen concentration below 0.5 mg / L, the central control unit increases the aeration flow rate of the aeration unit; when the dissolved oxygen concentration is above 4.0 mg / L, the central control unit decreases or stops the aeration flow rate of the aeration unit. When the OD600 monitoring unit detects that the OD600 value is lower than 0.02, the central control unit increases the magnetic field strength of the alternating magnetic field device; When the qPCR monitoring unit detects that the target gene copy number of the functional microorganism is less than 10 6 When copies / μL, the central control unit enhances the magnetic field strength of the alternating magnetic field device.

[0012] A further improvement of the present invention is that when the central control unit enhances the magnetic field strength of the alternating magnetic field device, it increases it by 5mT each time, and the magnetic field strength after the increase does not exceed 60mT.

[0013] A further improvement of the present invention is that, in S2, the culture temperature is 25~40℃ and the culture time is 7~14 days.

[0014] A further improvement of the present invention is that the compound preservative agent comprises, by weight parts: 2-10 parts of Burkholderia, 5-8 parts of Pyriformis, 5-8 parts of Plankton, 1-5 parts of Lactobacillus plantarum, 1-5 parts of Saccharomyces cerevisiae, 1-3 parts of Bacillus cereus, and 1-3 parts of Bacillus subtilis.

[0015] A further improvement of the present invention is that, during the cultivation process, a nutrient solution is added to the culture tank daily. The nutrient solution comprises, by mass parts: 1-3 parts anhydrous sodium acetate, 1-2 parts glucose, 1-2 parts ammonium citrate, 1-2 parts ammonium sulfate, 1-2 parts sodium chloride, 0.8-1.2 parts potassium dihydrogen phosphate, 0.5-1 parts manganese sulfate heptahydrate, and 0.4-0.6 parts beef extract.

[0016] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a cultivation device for circulating water preservative agents enhanced by alternating magnetic fields. By integrating the cultivation tank body, a packing bed located in the middle section of the tank, an aeration unit at the bottom, a dissolved oxygen probe below the liquid surface, alternating magnetic field devices on both outer walls, and external temperature control, OD600 monitoring, and qPCR monitoring units, this invention creates, for the first time, an integrated equipment platform specifically designed for the cultivation of circulating water preservative agents, filling the technological gap in this field. Specifically, the alternating magnetic field device applies a controllable alternating magnetic field to the bacterial solution within the tank during cultivation, positively stimulating microbial metabolic activity; the packing bed, as a solid carrier for microbial attachment, provides a favorable growth interface for functional bacterial communities. The combination of these two elements effectively enhances the activity and stability of the preservative agent. Meanwhile, the dissolved oxygen probe, OD600 monitoring unit, and qPCR monitoring unit monitor the culture process in real time from three dimensions: dissolved oxygen concentration, total bacterial count, and functional gene copy number, respectively, achieving multi-parameter joint sensing of the culture status. The above-mentioned monitoring units, along with the temperature control unit, aeration unit, and alternating magnetic field device, are all electrically connected to the central control unit, forming a closed-loop feedback control system. This enables the equipment to automatically output adjustment commands based on real-time monitoring data without manual intervention, fundamentally solving the problems of culture condition mismatch and bacterial activity fluctuation caused by the lack of online sensing and self-regulation capabilities in traditional equipment. This provides reliable hardware support for the efficient and stable operation of the culture method.

[0017] This invention also provides a method for cultivating preservative-preserving agents in circulating water using an alternating magnetic field. The method involves inoculating the compound preservative-preserving agent into a tank and then conducting constant-temperature cultivation under the synergistic action of a temperature control unit, an aeration unit, and an alternating magnetic field device. Simultaneously, the dissolved oxygen concentration is dynamically maintained based on the monitoring signal from the dissolved oxygen probe, achieving precise control of the cultivation environment. Crucially, during the cultivation process, the central control unit receives real-time three-dimensional status signals from the dissolved oxygen probe, OD600 monitoring unit, and qPCR monitoring unit, and automatically adjusts the aeration flow rate and magnetic field strength in a closed-loop manner according to preset feedback control logic: automatically adjusting aeration when dissolved oxygen deviates from the suitable range, and automatically increasing the magnetic field strength in a stepwise manner when the OD600 value or functional gene copy number is below the threshold. This ensures that the cultivation conditions always match the actual growth needs of the bacterial community, breaking through the traditional mode of cultivation based on fixed parameters based on experience. By combining online diagnosis and adaptive control of the above-mentioned water quality indicators and bacterial agent indicators, this method effectively avoids the problem of control timeout caused by human response lag, ensures that the bacterial agent is always in the optimal growth state throughout the entire cultivation cycle, and finally obtains a high-density and highly active anti-corrosion bacterial agent, providing a reliable bacterial agent guarantee for the long-term stable corrosion protection of carbon steel pipelines in circulating water systems. Attached Figure Description

[0018] The accompanying drawings described herein are for illustrative purposes only and are not intended to limit the scope of the invention in any way. Furthermore, the shapes and proportions of the components in the drawings are merely illustrative to aid in understanding the invention and do not specifically limit the shapes and proportions of the components of the invention.

[0019] Figure 1 This is a diagram of the cultivation equipment for the alternating magnetic field enhanced circulating water preservative agent of the present invention.

[0020] The components include: 1. Culture tank body; 2. Temperature control unit; 3. Packing bed; 4. Aeration unit; 5. Dissolved oxygen probe; 6. Alternating magnetic field equipment; 7. OD600 monitoring unit; 8. qPCR monitoring unit; and 9. Central control unit. Detailed Implementation

[0021] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The components of the embodiments of the present invention described and shown in the accompanying drawings can generally be arranged and designed in various different configurations.

[0022] Therefore, the following detailed description of the embodiments of the invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the invention without inventive effort are within the scope of protection of the invention.

[0023] It should be noted that similar labels and letters in the following figures indicate similar items. Therefore, once an item is defined in one figure, it does not need to be further defined and explained in subsequent figures.

[0024] In the description of the embodiments of the present invention, it should be noted that if terms such as "upper," "lower," "horizontal," or "inner" indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings, or the orientation or positional relationship commonly used when the product of the invention is in use, they are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation, and therefore should not be construed as a limitation of the present invention. Furthermore, terms such as "first" and "second" are only used to distinguish descriptions and should not be construed as indicating or implying relative importance.

[0025] Furthermore, the use of the term "horizontal" does not imply that the component must be absolutely horizontal, but rather that it can be slightly tilted. For example, "horizontal" simply means that its direction is more horizontal than "vertical," and does not mean that the structure must be completely horizontal, but can be slightly tilted.

[0026] In the description of the embodiments of the present invention, it should also be noted that, unless otherwise explicitly specified and limited, the terms "set," "install," "connect," and "link" should be interpreted broadly. For example, they can refer to a fixed connection, a detachable connection, or an integral connection; they can refer to a mechanical connection or an electrical connection; they can refer to a direct connection or an indirect connection through an intermediate medium; and they can refer to the internal connection of two components. Those skilled in the art can understand the specific meaning of the above terms in the present invention according to the specific circumstances.

[0027] The present invention will now be described in further detail with reference to the accompanying drawings: like Figure 1As shown, this invention provides a cultivation device for circulating water preservative agents enhanced by alternating magnetic fields, comprising a cultivation tank 1, a packing bed 3 fixedly arranged in the middle section of the internal part of the cultivation tank 1, an aeration unit 4 arranged at the bottom of the cultivation tank 1, a dissolved oxygen probe 5 arranged below the liquid surface inside the cultivation tank 1, and alternating magnetic field devices 6 installed on both outer walls of the cultivation tank 1. A temperature control unit 2, an OD600 monitoring unit 7, and a qPCR monitoring unit 8 are arranged on the outside of the cultivation tank 1. The temperature control unit 2 is connected to the internal space of the cultivation tank 1 and is used to control the cultivation temperature; the OD600 monitoring unit 7 extends into the cultivation tank 1 through an insertable optical probe to monitor the OD600 value of the bacterial solution in real time; the qPCR monitoring unit 8 extends into the cultivation tank 1 through an insertable sampling probe to monitor the copy number of the target gene of the functional microorganism in real time. The culture device also includes a central control unit 9, which is electrically connected to the temperature control unit 2, the aeration unit 4, the dissolved oxygen probe 5, the alternating magnetic field device 6, the OD600 monitoring unit 7, and the qPCR monitoring unit 8, respectively, forming a closed-loop feedback control system.

[0028] The packing bed 3 is filled with magnetite particles and / or maghemite particles, serving as a solid carrier for microbial attachment. The packing density of the packing bed 3 is 50-200 mg / L corresponding to the effective volume of the culture tank 1, and the height of the packing bed 3 is 1 / 6 to 1 / 4 of the effective height of the culture tank 1. The particle size of the magnetite or maghemite particles is 2-5 mm. The alternating magnetic field device 6 includes two sets of electromagnet cores symmetrically arranged on the outer walls of the left and right sides of the culture tank 1. Each set of electromagnet cores is connected to a programmable excitation power supply, and the magnetic field strength applied by the alternating magnetic field device 6 is continuously adjustable within the range of 5-60 mT. During the cultivation process, the magnetic minerals in the packing bed, under the action of the applied alternating magnetic field, can enhance the attachment and growth of microorganisms and their extracellular electron transfer activity, significantly improving the metabolic function and community stability of the preservative agent.

[0029] This invention also provides a method for cultivating a circulating water preservative agent enhanced by an alternating magnetic field, using the above-mentioned cultivation equipment, and comprising the following steps: S1, the compound preservative agent is inoculated into the culture tank 1. The compound preservative agent comprises, by weight parts: 2-10 parts of Burkholderia, 5-8 parts of Pyriformis spp., 5-8 parts of Planktonic mold, 1-5 parts of Lactobacillus plantarum, 1-5 parts of Saccharomyces cerevisiae, 1-3 parts of Bacillus cereus, and 1-3 parts of Bacillus subtilis. The preferred inoculation volume ratio is 5% of the total volume of sludge sediment in the solution within the culture tank.

[0030] S2, the temperature control unit 2, aeration unit 4, and alternating magnetic field device 6 are activated. Under the control of the temperature control unit 2, a constant temperature culture is performed at 25~40℃. Gas is supplied to the tank through the aeration unit 4, and the dissolved oxygen concentration in the tank is maintained at 0.5~4.0 mg / L based on the monitoring signal from the dissolved oxygen probe 5. An alternating magnetic field with a strength of 5~60 mT is applied to the tank through the alternating magnetic field device 6. The culture time is 7~14 days. During the culture process, nutrients are added daily to the culture tank 1 through the feeding port. The nutrients, by mass, include: 1~3 parts anhydrous sodium acetate, glucose (C6H2O)... 12 The nutrient solution consists of 1-2 parts of O6, 1-2 parts of ammonium citrate, 1-2 parts of ammonium sulfate ((NH4)2SO4), 1-2 parts of sodium chloride, 0.8-1.2 parts of potassium dihydrogen phosphate (KH2PO4) (preferably 1 part), 0.5-1 part of manganese sulfate heptahydrate (MnSO4·7H2O), and 0.4-0.6 parts of beef extract (preferably 0.5 parts). Regular replenishment of the nutrient solution provides sufficient carbon, nitrogen, inorganic salts, and growth factors for the continuous and active growth of the microbial community, ensuring the high-density and stable proliferation of the functional microbial community.

[0031] S3. During the cultivation process, the central control unit 9 receives in real time the dissolved oxygen concentration signal from the dissolved oxygen probe 5, the OD600 value signal from the OD600 monitoring unit 7, and the target gene copy number signal from the qPCR monitoring unit 8. Based on preset feedback control logic, it automatically adjusts the aeration flow rate of the aeration unit 4 and the magnetic field strength of the alternating magnetic field device 6 in a closed loop. The preset feedback control logic includes: when the dissolved oxygen probe 5 detects a dissolved oxygen concentration below 0.5 mg / L, the central control unit 9 increases the aeration flow rate of the aeration unit 4; when the dissolved oxygen concentration is above 4.0 mg / L, the central control unit 9 decreases or stops the aeration flow rate of the aeration unit 4. When the OD600 monitoring unit 7 detects an OD600 value below 0.02, the central control unit 9 increases the magnetic field strength of the alternating magnetic field device 6; when the qPCR monitoring unit 8 detects a target gene copy number below 10... 6 When the number of copies / μL is reached, the central control unit 9 increases the magnetic field strength of the alternating magnetic field device 6. When the central control unit 9 increases the magnetic field strength of the alternating magnetic field device 6, it increases by 5 mT each time, and the increased magnetic field strength does not exceed 60 mT. Through the combined online diagnosis and closed-loop regulation of multiple indicators such as dissolved oxygen, total bacterial count, and functional gene copy number, this invention fundamentally solves the problem of bacterial activity fluctuations caused by human response lag in traditional methods, and realizes dynamic intelligent regulation of the entire bacterial culture process.

[0032] S4. After cultivation, collect the sludge precipitate from the solution in the cultivation tank 1 to obtain the alternating magnetic field enhanced circulating water preservative agent. The preferred criterion for determining the end of cultivation is: the OD600 value measured by the OD600 monitoring unit 7 remains stable between 1.2 and 1.5 for 24 consecutive hours, and the copy number of the functional microbial target gene measured by the qPCR monitoring unit 8 remains stable at 10 for 24 consecutive hours. 8 ~10 9 The criteria for determining the culture endpoint are copies / μL, and the fluctuation range of both indicators does not exceed ±10% of their respective set values. This standard breaks through the traditional, crude method of judging the culture endpoint based on experience, providing a scientific basis for the objective quantification of the culture endpoint and ensuring that the prepared microbial agent meets the requirements for industrial applications in terms of density and functional activity. The cultured high-efficiency preservative agent is added to the power plant's circulating water system at a dosage of 0.1%~1% of the total circulating water system volume. This agent can significantly delay the corrosion of carbon steel pipes and improve the reliability and safety of the circulating water system through the secretion of preservative substances via microbial metabolism.

[0033] The present invention will be further described in detail below with reference to specific embodiments: Example 1 This embodiment provides a cultivation device for circulating water preservative agents enhanced by alternating magnetic fields, the structure of which is as follows: Figure 1 As shown.

[0034] The culture tank is made of vertical cylindrical stainless steel with an effective volume of 200L. The bottom of the tank has a slightly conical structure, and four diagonal supports are installed at the bottom of the tank for grounding and base plate fixation. A magnetite / maghemite packing bed is fixed in the middle of the tank, with the packing bed height being 1 / 5 of the effective height of the tank. The packing bed contains magnetite particles with a particle size of 2~5mm, and the packing amount is 50mg / L (based on the effective volume of the tank).

[0035] A microporous aeration disc is installed at the bottom of the tank, connected to an air compressor via an external air inlet pipe, forming an aeration unit. Coils are arranged on the outer bottom of the tank wall, with both ends connected to an external temperature control unit, forming a temperature control unit. The temperature control unit is equipped with a heater and a cooler, with a temperature control accuracy of ±0.5℃. An electromagnet core is installed on each of the left and right sides of the tank's outer wall at the center, forming an alternating magnetic field device. The magnetic field strength can be continuously adjusted within the range of 5~60mT, with an adjustment accuracy of ±1mT.

[0036] A dissolved oxygen probe is horizontally inserted into the right side of the tank wall approximately 20 cm below the liquid surface. A polarographic dissolved oxygen electrode with a response time of less than 30 seconds is used. An OD600 probe is horizontally inserted into the bottom left of the tank and connected to an external OD600 monitoring unit. This unit uses a fiber optic online turbidity sensor with a detection wavelength of 600 nm and a measurement range of 0–5.0. A qPCR probe is horizontally inserted into the bottom right of the tank and connected to an external qPCR monitoring unit. This unit uses a microfluidic chip-based online qPCR detection module, which can quantitatively detect the copy number of characteristic genes of functional microorganisms in real time.

[0037] The dissolved oxygen probe, OD600 monitoring unit, qPCR monitoring unit, temperature control unit, aeration unit, and alternating magnetic field device are all connected to the central control unit via signal lines. The central control unit uses a programmable logic controller (PLC) as its core processor, with a built-in data acquisition module and control algorithm. It can display and record all online monitoring data in real time and automatically output control commands according to preset logic.

[0038] Example 2 This embodiment uses the culture equipment described in Example 1 to cultivate the circulating water preservative agent enhanced by alternating magnetic field.

[0039] Step 1: Inoculate the culture tank with the compound preservative agent at a volume ratio of 5%. The compound preservative agent, by weight, comprises: 10 parts Burkholderia, 5 parts *Pyrrosia lingua*, 5 parts *Plant mold*, 1 part *Lactobacillus plantarum*, 1 part *Saccharomyces cerevisiae*, 1 part *Bacillus cereus*, and 1 part *Bacillus subtilis*. Set the culture temperature to 25℃ using the temperature control unit and the initial aeration flow rate to 0.1 L / min using the aeration unit to maintain dissolved oxygen at 0.5 mg / L. Start the alternating magnetic field device and set the initial magnetic field strength to 5 mT.

[0040] Step 2: During the cultivation process, the central control unit continuously receives the following signals: dissolved oxygen concentration value from the dissolved oxygen probe; turbidity value of the bacterial culture from the OD600 monitoring unit; and real-time quantitative PCR detection results from the qPCR monitoring unit, targeting the genes amoA1F (GGGGTTTCTACTGGTGGT), amoA2R (CCCCTCKGSAAAGCCTTCTTC), Bsub5F (AAGTCGAGCGGACAGATGG), and Bsub3R (CCAGTTTCCAATGACCCTCCCC).

[0041] The central control unit performs automatic regulation according to the following logic: 1) When the dissolved oxygen concentration is below 0.5 mg / L, the aeration flow rate will be automatically increased by 0.05 L / min each time, with a maximum of 0.5 L / min; when the dissolved oxygen concentration is above 4.0 mg / L, the aeration flow rate will be automatically decreased by 0.05 L / min each time, with a minimum of 0.05 L / min. 2) When the OD600 value is below 0.02, the alternating magnetic field strength is automatically increased by 5mT each time, with a maximum of 60mT; 3) When qPCR detects that the copy number of the target gene in functional microorganisms is less than 10 6 When the number of copies / μL is reached, the alternating magnetic field strength is automatically increased by 5mT each time, with a maximum of 60mT.

[0042] Nutrients are added to the culture tank daily through the feeding port. The nutrient solution includes, by weight, 1 part anhydrous sodium acetate, 1 part glucose, 1 part ammonium citrate, 1 part ammonium sulfate, 1 part sodium chloride, 0.8 parts potassium dihydrogen phosphate, 0.5 parts manganese sulfate heptahydrate, and 0.4 parts beef extract.

[0043] Step 3: After 7 days of continuous culture, the OD600 value stabilized between 1.2 and 1.5, and the copy number of the target gene in the functional microorganism detected by qPCR stabilized at 10. 8 ~10 9 The culture was considered to have reached its endpoint when the dissolved oxygen concentration was stable within the range of 0.5~1.0 mg / L and the fluctuation of the above three indicators did not exceed ±10% of their respective set values ​​within 24 consecutive hours, thus obtaining the culture medium of the alternating magnetic field enhanced circulating water preservative agent.

[0044] The alternating magnetic field enhanced circulating water anticorrosive agent obtained in this embodiment is added to the power plant's circulating water system at a dosage of 0.1% based on the total volume of the circulating water system. It can effectively delay the corrosion of carbon steel through the secretion of anticorrosive substances by microbial metabolism.

[0045] Example 3 This embodiment uses the culture equipment described in Example 1 to cultivate the circulating water preservative agent enhanced by alternating magnetic field.

[0046] Step 1: Inoculate the culture tank with the compound preservative agent at a volume ratio of 5%. The compound preservative agent, by weight, comprises: 6 parts Burkholderia, 6.5 parts *Pyrrosia lingua*, 6.5 parts *Plant mold*, 3 parts *Lactobacillus plantarum*, 3 parts *Saccharomyces cerevisiae*, 2 parts *Bacillus cereus*, and 2 parts *Bacillus subtilis*. Set the culture temperature to 32℃ using the temperature control unit and the initial aeration flow rate to 0.25 L / min using the aeration unit to maintain dissolved oxygen at 2.0 mg / L. Start the alternating magnetic field device and set the initial magnetic field strength to 30 mT.

[0047] Step Two: During the cultivation process, the central control unit continuously receives the same signals as in Example 2 and performs automatic regulation according to the following logic: 1) When the dissolved oxygen concentration is below 0.5 mg / L, the aeration flow rate will be automatically increased by 0.05 L / min each time, with a maximum of 0.5 L / min; when the dissolved oxygen concentration is above 4.0 mg / L, the aeration flow rate will be automatically decreased by 0.05 L / min each time, with a minimum of 0.05 L / min. 2) When the OD600 value is below 0.02, the alternating magnetic field strength is automatically increased by 5mT each time, with a maximum of 60mT; 3) When qPCR detects that the copy number of the target gene in functional microorganisms is less than 10 6 When the number of copies / μL is reached, the alternating magnetic field strength is automatically increased by 5mT each time, with a maximum of 60mT.

[0048] Nutrients are added to the culture tank daily through the feeding port. The nutrients include, by weight, 2 parts anhydrous sodium acetate, 1.5 parts glucose, 1.5 parts ammonium citrate, 1.5 parts ammonium sulfate, 1.5 parts sodium chloride, 1.0 part potassium dihydrogen phosphate, 0.75 parts manganese sulfate heptahydrate, and 0.5 parts beef extract.

[0049] Step 3: After 10 days of continuous culture, the OD600 value stabilized between 1.2 and 1.5, and the copy number of the target gene in the functional microorganism detected by qPCR stabilized at 10. 8 ~10 9 The culture was considered to have reached its endpoint when the dissolved oxygen concentration was stable within the range of 2.0~2.5 mg / L and the fluctuation of the above three indicators did not exceed ±10% of their respective set values ​​within 24 consecutive hours, thus obtaining the culture medium of the alternating magnetic field enhanced circulating water preservative agent.

[0050] The alternating magnetic field enhanced circulating water anticorrosive agent obtained in this embodiment is added to the power plant's circulating water system at a dosage of 0.5% based on the total volume of the circulating water system. It can effectively delay the corrosion of carbon steel through the secretion of anticorrosive substances by microbial metabolism.

[0051] Example 4 This embodiment uses the culture equipment described in Example 1 to cultivate the circulating water preservative agent enhanced by alternating magnetic field.

[0052] Step 1: Inoculate the culture tank with the compound preservative agent at a volume ratio of 5%. The compound preservative agent, by weight, comprises: 2 parts Burkholderia, 8 parts *Pyrrosia lingua*, 8 parts *Plant mold*, 5 parts *Lactobacillus plantarum*, 5 parts *Saccharomyces cerevisiae*, 3 parts *Bacillus cereus*, and 3 parts *Bacillus subtilis*. Set the culture temperature to 40℃ using the temperature control unit and the initial aeration flow rate to 0.4 L / min using the aeration unit to maintain dissolved oxygen at 4.0 mg / L. Start the alternating magnetic field device and set the initial magnetic field strength to 60 mT.

[0053] Step Two: During the cultivation process, the central control unit continuously receives the same signals as in Example 2 and performs automatic regulation according to the following logic: 1) When the dissolved oxygen concentration is below 0.5 mg / L, the aeration flow rate will be automatically increased by 0.05 L / min each time, with a maximum of 0.5 L / min; when the dissolved oxygen concentration is above 4.0 mg / L, the aeration flow rate will be automatically decreased by 0.05 L / min each time, with a minimum of 0.05 L / min. 2) When the OD600 value is below 0.02, the alternating magnetic field strength is automatically increased by 5mT each time, with a maximum of 60mT; 3) When qPCR detects that the copy number of the target gene in functional microorganisms is less than 10 6 When the number of copies / μL is reached, the alternating magnetic field strength is automatically increased by 5mT each time, with a maximum of 60mT.

[0054] Nutrients are added to the culture tank daily through the feeding port. The nutrient solution includes, by weight, 3 parts anhydrous sodium acetate, 2 parts glucose, 2 parts ammonium citrate, 2 parts ammonium sulfate, 2 parts sodium chloride, 1.2 parts potassium dihydrogen phosphate, 1.0 part manganese sulfate heptahydrate, and 0.6 parts beef extract.

[0055] Step 3: After 14 days of continuous culture, the OD600 value stabilized between 1.2 and 1.5, and the copy number of the target gene in the functional microorganism detected by qPCR stabilized at 10. 8 ~10 9 The culture was considered to have reached its endpoint when the dissolved oxygen concentration was stable within the range of 3.5~4.0 mg / L and the fluctuation of the above three indicators did not exceed ±10% of their respective set values ​​within 24 consecutive hours, thus obtaining the culture medium of the alternating magnetic field enhanced circulating water preservative agent.

[0056] The alternating magnetic field enhanced circulating water anticorrosive agent obtained in this embodiment is added to the power plant's circulating water system. The addition amount is 1.0% based on the total volume of the circulating water system. It can effectively delay the corrosion of carbon steel through the secretion of anticorrosive substances by microbial metabolism.

[0057] Many embodiments and applications beyond the examples provided will be apparent to those skilled in the art upon reading the foregoing description. Therefore, the scope of this teaching should not be determined by reference to the foregoing description, but rather by reference to the foregoing claims and the full scope of their equivalents. For purposes of completeness, all articles and references, including patent applications and publications, are incorporated herein by reference. The omission of any aspect of the subject matter disclosed herein in the foregoing claims is not intended as a waiver of that subject matter, nor should it be construed as an indication that the applicant has not considered that subject matter as part of the disclosed inventive subject matter.

[0058] The above content provides a further detailed description of the present invention. It should not be construed that the specific embodiments of the present invention are limited to this. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection of the present invention as defined by the submitted claims.

Claims

1. A cultivation device for a circulating water preservative agent enhanced by an alternating magnetic field, characterized in that, The system includes a culture tank body (1), a packing bed (3) is fixedly installed in the middle section of the culture tank body (1), an aeration unit (4) is installed at the bottom of the culture tank body (1), a dissolved oxygen probe (5) is installed below the liquid surface inside the culture tank body (1), and alternating magnetic field devices (6) are installed on the outer walls of both sides of the culture tank body (1). The outside of the culture tank (1) is provided with a temperature control unit (2), an OD600 monitoring unit (7) and a qPCR monitoring unit (8). The temperature control unit (2) is connected to the internal space of the culture tank (1). The OD600 monitoring unit (7) extends into the inside of the culture tank (1) through an insertable optical probe. The qPCR monitoring unit (8) extends into the inside of the culture tank (1) through an insertable sampling probe. The culture device also includes a central control unit (9), which is electrically connected to the temperature control unit (2), the aeration unit (4), the dissolved oxygen probe (5), the alternating magnetic field device (6), the OD600 monitoring unit (7), and the qPCR monitoring unit (8), respectively.

2. The cultivation equipment for an alternating magnetic field-enhanced circulating water preservative agent according to claim 1, characterized in that, The packing bed (3) is filled with magnetite particles and / or maghematite particles.

3. The cultivation equipment for an alternating magnetic field-enhanced circulating water preservative agent according to claim 2, characterized in that, The filling amount of the packing bed (3) is 50~200mg / L corresponding to the effective volume of the culture tank body (1), the height of the packing bed (3) is 1 / 6~1 / 4 of the effective height of the culture tank body (1), and the particle size of the magnetite particles or hematite particles is 2~5mm.

4. The cultivation equipment for an alternating magnetic field-enhanced circulating water preservative agent according to claim 1, characterized in that, The alternating magnetic field device (6) includes two sets of electromagnet cores symmetrically arranged on the outer walls of the left and right sides of the culture tank (1). Each set of electromagnet cores is connected to a programmable excitation power supply. The magnetic field strength applied by the alternating magnetic field device (6) is continuously adjustable in the range of 5~60mT.

5. A method for cultivating a circulating water preservative agent enhanced by an alternating magnetic field, using the cultivation equipment described in any one of claims 1 to 4, characterized in that... Includes the following steps: S1, the compound preservative agent is inoculated into the culture tank (1); S2, start the temperature control unit (2), aeration unit (4) and alternating magnetic field device (6), carry out constant temperature culture under the control of the temperature control unit (2), supply gas to the tank through the aeration unit (4) and maintain the dissolved oxygen concentration in the tank according to the monitoring signal of the dissolved oxygen probe (5), and apply an alternating magnetic field to the tank through the alternating magnetic field device (6). S3. During the cultivation process, the central control unit (9) receives the dissolved oxygen concentration signal fed back by the dissolved oxygen probe (5), the OD600 value signal fed back by the OD600 monitoring unit (7), and the target gene copy number signal fed back by the qPCR monitoring unit (8) in real time, and automatically adjusts the aeration flow rate of the aeration unit (4) and the magnetic field strength of the alternating magnetic field device (6) in a closed loop according to the preset feedback control logic. S4. After the culture is completed, the sludge precipitate in the solution inside the culture tank (1) is collected to obtain the alternating magnetic field enhanced circulating water preservative agent.

6. The method for cultivating a circulating water preservative agent enhanced by an alternating magnetic field according to claim 5, characterized in that, The preset feedback control logic includes: When the dissolved oxygen probe (5) detects a dissolved oxygen concentration below 0.5 mg / L, the central control unit (9) increases the aeration flow rate of the aeration unit (4); when the dissolved oxygen concentration is above 4.0 mg / L, the central control unit (9) decreases or stops the aeration flow rate of the aeration unit (4). When the OD600 monitoring unit (7) detects that the OD600 value is lower than 0.02, the central control unit (9) increases the magnetic field strength of the alternating magnetic field device (6); When the qPCR monitoring unit (8) detects that the copy number of the target gene of the functional microorganism is less than 10 6 When copies / μL, the central control unit (9) enhances the magnetic field strength of the alternating magnetic field device (6).

7. The method for cultivating a circulating water preservative agent enhanced by alternating magnetic field according to claim 5, characterized in that, When the central control unit (9) enhances the magnetic field strength of the alternating magnetic field device (6), it increases the magnetic field strength by 5mT each time, and the increased magnetic field strength does not exceed 60mT.

8. The method for cultivating a circulating water preservative agent enhanced by an alternating magnetic field according to claim 5, characterized in that, In S2, the culture temperature is 25~40℃ and the culture time is 7~14 days.

9. The method for cultivating a circulating water preservative agent enhanced by an alternating magnetic field according to claim 5, characterized in that, The compound preservative agent comprises, by weight parts: 2-10 parts Burkholderia, 5-8 parts Pyridobacterium tumefaciens, 5-8 parts Plankton, 1-5 parts Lactobacillus plantarum, 1-5 parts Saccharomyces cerevisiae, 1-3 parts Bacillus cereus, and 1-3 parts Bacillus subtilis.

10. The method for cultivating a circulating water preservative agent enhanced by an alternating magnetic field according to claim 5, characterized in that, During the cultivation process, nutrients are added to the culture tank (1) daily. The nutrients include, by mass, 1-3 parts anhydrous sodium acetate, 1-2 parts glucose, 1-2 parts ammonium citrate, 1-2 parts ammonium sulfate, 1-2 parts sodium chloride, 0.8-1.2 parts potassium dihydrogen phosphate, 0.5-1 parts manganese sulfate heptahydrate, and 0.4-0.6 parts beef extract.

Images