Three-stage salt-reducing Japanese soy sauce fermentation process, special strain and soy sauce brewed by the same

Abstract

This invention discloses a three-stage reduced-salt Japanese soy sauce fermentation process, a specific strain of yeast, and the soy sauce produced, belonging to the field of microbial fermentation industrial technology. The process includes: raw material processing; inoculation with *Aspergillus oryzae* ZLCY-M508 for koji preparation and disc koji making; fermentation of the koji and brine in a three-layer multifunctional fermentation tank for 60 days, with the temperature at 15-18℃ for the first 15 days, then increasing to 30-32℃; using roasted wheat flour as raw material, adding *Aspergillus oryzae* to strengthen the koji, and inoculating with *Zygosacchariformis* ZLCY-S822 for independent alcoholic fermentation; transferring the soy sauce mash to an insulated double-layer tank and mixing it with fermented liquor mash, without adding salt, and allowing it to ferment naturally for 180 days; and post-processing. This invention, through three-stage sequential fermentation, tank adaptation, and the application of patented strains, achieves reduced salt content, improved equipment utilization, and increased alcohol and flavor substance content, solving the problems of excessively high salt concentration, low microbial metabolic efficiency, insufficient alcohol and ester flavor, and low equipment utilization in traditional processes.

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation technology, specifically to a three-stage low-sodium Japanese soy sauce fermentation process, a special strain of microorganisms, and the soy sauce produced therefrom. More specifically, it relates to a three-stage low-sodium Japanese soy sauce fermentation process with sequential coupling of strains and adaptation to separate fermentation tanks, along with two suitable microbial agents and the soy sauce product prepared by fermentation. Background Technology

[0002] Soy sauce is made primarily from soybeans and / or defatted soybeans, wheat and / or wheat flour and / or wheat bran, through a series of processes including raw material steaming, koji preparation, disc koji making, koji and brine fermentation, pressing, blending, sterilization, and filtration. As a fermented food that combines color, aroma, flavor, and texture, soy sauce is rich in various amino acids, peptides, polysaccharides, and flavor compounds such as alcohols and esters, making it an indispensable condiment in daily life. The brewing processes for soy sauce mainly include natural sun-drying fermentation, low-salt solid-state fermentation, and high-salt liquid-state fermentation. Among these, soy sauce brewed using the high-salt liquid-state fermentation method holds an important position in the market due to its rich flavor and excellent quality. However, its brewing process also has significant drawbacks: traditional soy sauce fermentation processes have a high salt content, generally around 16-18g / 100mL, posing health risks due to high salt intake; the fermentation process uses a single-tank model, with the fermentation tank, which combines temperature control and heating functions, occupying the entire process for 180 days, but precise temperature control is only required in the early stages, and heat preservation is sufficient in the later stages, leading to idle functions, low utilization rates, and high investment costs for expensive temperature control equipment; under the stress of a high-salt environment, the primary conversion of raw materials by amylase is incomplete, resulting in insufficient supply of usable fermentation sugars, and the ethanol metabolism pathway is inhibited, hindering the synthesis of ethanol precursors, ultimately leading to low alcohol yield; the process parameters such as temperature control and stirring are crude, lacking precise control strategies, resulting in large batch-to-batch variations and unstable flavor; at the same time, it is difficult to reduce costs and increase efficiency under the premise of long-cycle fermentation, restricting the industry's large-scale and high-quality development. Currently, there is no existing technology that can achieve synergistic control of equipment, process, strain, environment, and time sequence, and therefore cannot effectively solve the above-mentioned technical pain points. Summary of the Invention

[0003] In view of this, the purpose of this invention is to provide two functional microorganisms, Aspergillus oryzae ZLCY-M508 and ZLCY-S822, and a three-stage low-salt Japanese soy sauce fermentation process adapted to them, so as to solve the technical problems of high salt content, low equipment utilization, lack of alcohol and ester flavor and crude process in traditional processes.

[0004] To achieve the above objectives, the present invention adopts the following technical solution:

[0005] First, this invention also provides two functional microbial products:

[0006] One strain is Aspergillus oryzae ZLCY-M508, which is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M2026366.

[0007] The other strain is Zygosaccharomyces rouxii ZLCY-S822, which is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M2026365.

[0008] This invention also provides a three-stage reduced-salt Japanese soy sauce fermentation process using the above two strains, comprising the following steps:

[0009] (1) Raw material processing: defatted soybeans are moistened, steamed and cooled; wheat is roasted and ground to obtain roasted wheat flour;

[0010] (2) Preparation of starter culture and disc fermentation: using wheat bran as raw material, after steaming and sterilization, it is inoculated with Aspergillus oryzae ZLCY-M508 to prepare starter culture; the defatted soybeans after steaming are mixed evenly with roasted wheat flour, and the starter culture is inoculated, and the finished starter culture is obtained by disc fermentation.

[0011] (3) Fermentation of sauce mash: Mix the koji with cold brine and send it into a three-layer multi-functional fermentation tank to start the early fermentation of sauce mash and complete the initial enzymatic hydrolysis of the material;

[0012] (4) Independent alcoholic fermentation: Roasted wheat flour is sent into an alcohol tank, Aspergillus oryzae is added to strengthen the Daqu for saccharification, and then Zygosaccharomyces rouxii ZLCY-S822 bacterial solution is inoculated at 1% (based on the volume of mash) for alcoholic fermentation to obtain mature mash.

[0013] (5) After merging and fermentation: Transfer the fermented mash after 60 days of fermentation in step (3) to a double-walled insulated tank and mix it with the mature mash obtained in step (4). No more salt is added after mixing. Ferment naturally until the total cycle is 180 days to obtain mature mash.

[0014] (6) Post-processing: After pressing and sterilizing the mature soy sauce mash, let it stand to settle and obtain crude soy sauce.

[0015] Among them, Aspergillus oryzae ZLCY-M508 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M2026366; Zygosaccharomyces rouxii ZLCY-S822 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M2026365.

[0016] Preferably, the moistening process in step (1) uses hot water at ≥85°C at 0.95~1.10 times the weight of defatted soybeans, and the cooking process is carried out at a temperature of 132~135°C for 4~5 minutes; the cooked material is cooled to below 40°C for later use.

[0017] The roasting process is carried out at a temperature of 310~370℃ until the wheat grains turn light brown and have a wheat aroma. After roasting, the grains should be immediately cooled to below 40℃. After pulverizing, the roasted wheat flour is obtained by passing it through a 32-mesh sieve.

[0018] Preferably, in step (2), during the preparation of the starter culture, wheat bran and water are mixed at a material-to-water ratio of 1:0.9~1.0, the moisture content of the material is controlled to 55%~60%, steamed at 118~121℃ for 30 minutes, and then inoculated with Aspergillus oryzae ZLCY-M508 at 0.3%~0.5% of the material weight and cultured at 28~34℃ for 60~65 hours to obtain the starter culture; the number of spores in the starter culture is ≥5.0×10⁻⁶. 9 CFU / g, acidic protease activity of 1300-1500 U / g, neutral protease activity of 2000-2300 U / g, and germination rate ≥90%.

[0019] Preferably, in step (2), during the disc koji making process, the defatted soybeans after steaming are mixed with roasted wheat flour at a mass ratio of 4.5 to 4.8:1, the moisture content of the material is controlled at 46% to 50%, and seed koji is inoculated at 0.25% to 0.30% of the material weight. Then, the mixture is sent to the disc for cultivation. The initial temperature of the product in the disc is not lower than 28°C, and the temperature is controlled below 35°C. The product is cultivated for 36 to 42 hours until the material turns yellow-green and there is no white material, thus obtaining the koji.

[0020] Preferably, the cold brine in step (3) has a mass concentration of 20% and a temperature of <10℃; the koji and cold brine are mixed at a mass ratio of 1:1.9~2.0, the initial pH of the material is 5.3~5.6, and the initial temperature should be ≤18℃. For the first 15 days after entering the tank, the temperature of the fermented mash is maintained at 15~18℃. From the 16th day, the temperature is gradually increased, and the daily temperature increase is controlled not to exceed 0.5℃. The temperature is maintained at 30~32℃ until 60 days of fermentation.

[0021] Preferably, the preparation method of Aspergillus oryzae-enhanced Daqu in step (4) is as follows: before pressing Daqu, Aspergillus oryzae seed koji is inoculated into the Daqu raw material at 0.5%~1% (based on the Daqu raw material), wherein the Daqu raw material is barley and peas mixed in a 7:3 ratio;

[0022] After the roasted wheat flour is put into the alcohol tank, hot water at 95°C or above is added at 300% of the material mass. The top tank door is sealed and kept warm for liquefaction for 1 to 1.5 hours. Then the temperature is lowered to 29 to 31°C, and 20% (based on the mass of roasted wheat flour) of Aspergillus oryzae is added to strengthen the saccharification of the starter culture.

[0023] After expansion, the cell count of ZLCY-S822 zygosaccharomyces rouxii was controlled to be ≥1.5×10⁻⁶. 8 cfu / mL;

[0024] Preferably, in step (4), the alcohol fermentation is carried out in the open for 3 days before fermentation, and the sterile aeration is turned on and stirred for 20 minutes in the morning and evening to ensure that the material is fully oxygenated and the temperature is controlled not to exceed 30°C. After 3 days, the container is sealed and the temperature of the mash is maintained at 25~28°C. Fermentation continues for 8 days to obtain mature mash.

[0025] Preferably, in step (5), after the fermented sauce mash and the mature fermented wine mash are mixed, the salt content of the mixed mash is 11-13g / 100mL; when fermented for 180 days, the amino acid nitrogen content of the mature fermented sauce mash is ≥1.0g / 100mL, the reducing sugar content is 2.00-3.50g / 100mL, the alcohol content is 2.8~3.50 %vol, and the pH is ≥4.8.

[0026] This invention also protects a soy sauce brewed using the three-stage reduced-salt Japanese soy sauce fermentation process described in any of the above claims.

[0027] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a three-stage reduced-salt Japanese soy sauce fermentation process, a special strain of bacteria, and the soy sauce brewed therefrom, which has the following beneficial effects:

[0028] This invention draws on traditional vinegar-making techniques to construct a three-stage independent fermentation system with distinct time sequences during the fermentation process of soy sauce mash: in the early stage, Aspergillus oryzae secretes enzymes to complete the efficient enzymatic hydrolysis of proteins and starches, while simultaneously carrying out independent alcoholic fermentation. Using vinegar-making koji and Rhus oryzae yeast as raw materials, roasted wheat flour is used for saccharification and alcohol production first. In the later stage, the mature mash is mixed with the soy sauce mash to enter the synergistic aroma-producing stage, ultimately forming a three-stage fermentation mode of "enzymatic hydrolysis first, then alcohol production, and finally aroma enhancement".

[0029] This invention employs a tank adaptation strategy, combining small tanks with large tanks and converting three-layer tanks to double-layer tanks. The three-layer tank combines heating and insulation functions, adapting to the fermentation requirements of Aspergillus oryzae enzymatic hydrolysis for rapid enrichment of peptides and amino acids during the first 60 days of fermentation in soy sauce mash. The double-layer tank retains only the insulation function, meeting the requirements of natural fermentation and aroma production after the mixing of soy sauce mash and liquor mash, without consuming additional energy at this stage. This approach, combining a three-stage fermentation mode and a tank adaptation strategy, changes the fixed production mode where a single multi-functional tank is occupied for a long time, effectively avoiding the waste of idle multi-functional equipment, significantly improving the turnover rate of the three-layer tank, saving 50% of energy consumption, and ensuring precise matching of process, functional strains, and equipment configuration, resulting in a more rational and efficient production layout.

[0030] This invention incorporates Aspergillus oryzae ZLCY-M508, a protease-rich fungus, into Daqu (a type of starter culture) to prepare enhanced Daqu, thus overcoming the deficiency of insufficient protease activity in traditional Daqu. Utilizing this in alcoholic fermentation, it effectively decomposes proteins in roasted wheat flour, avoiding the risk of excessive sedimentation in the later stages of fermentation. Furthermore, leveraging the high saccharification power and abundant microorganisms of Daqu, it promotes efficient saccharification of wheat starch, alcohol production, and the synthesis of more flavor precursors.

[0031] This invention fully utilizes the physiological characteristics of ZLCY-S822 *Zygosacchariformis* to achieve a dual-purpose microbial system: "first producing alcohol, then producing aroma" through segmented metabolism. In the independent alcoholic fermentation stage, this yeast can rapidly proliferate in a low-salt environment, efficiently producing alcohol by exclusively utilizing saccharified reducing sugars, providing ample alcohol precursors for the system and effectively increasing the ethanol content in the soy sauce mash. In the mixed fermentation stage, on the one hand, *Zygosacchariformis* enriches ethyl esters, acetate esters, and other substances through esterification reactions, enhancing the ethanol and ester aromas of the soy sauce; on the other hand, it maintains a stable microbial community structure under high-alcohol conditions, effectively preventing contamination and spoilage of the mash, thus achieving reduced-salt fermentation.

[0032] This invention adapts two patented strains to a specific three-stage fermentation process and fermentation tank, and adds them in sequence to achieve separate fermentation of different strains. The resulting fermented sauce mash is reddish-brown in color, has a unique soy sauce and wine aroma, no other off-flavors, and the fermented sauce mash filtrate is clear and bright with a rich umami flavor.

[0033] The soy sauce fermentation process and system described in this invention retains the traditional 180-day fermentation cycle, balancing traditional flavor with modern production efficiency. Compared with existing technologies, it significantly improves the carbon source conversion rate of raw materials, achieves reduced-salt fermentation, and overcomes the shortcomings of traditional soy sauce such as insufficient alcohol content, weak ester aroma, and monotonous flavor. It effectively enriches the aroma layers and mellowness, breaks through the technical bottleneck in the soy sauce brewing industry, and forms a high-quality soy sauce brewing solution that can be promoted. Attached Figure Description

[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0035] Figure 1 This is a process flow diagram of the present invention.

[0036] Figure 2 The results of protease production by Aspergillus oryzae ZLCY-M508 as described in the embodiments of the present invention.

[0037] Figure 3 The results of amylase production detection by Aspergillus oryzae ZLCY-M508 as described in the embodiments of the present invention.

[0038] Figure 4 The results of salt tolerance assay for ZLCY-S822 *Zygosacchariformis* described in this embodiment of the invention are shown.

[0039] Figure 5 The results of acid-base tolerance testing of ZLCY-S822 *Zygosacchariformis* described in this embodiment of the invention are shown.

[0040] Figure 6 The results of esterase production assay of ZLCY-S822 *Zygosacchariformis* described in this embodiment of the invention are shown.

[0041] Figure 7 This is the colony morphology of ZLCY-S822 of *Zygosaccharomyces rouxii* as described in the embodiments of the present invention.

[0042] Figure 8 The image shows the cell morphology of ZLCY-S822 *Zygomyces rouxae* as described in this embodiment of the invention under a microscope.

[0043] Figure 9 This is the colony morphology of Aspergillus oryzae ZLCY-M508 as described in the embodiments of the present invention.

[0044] Figure 10 The image shows the spore morphology of Aspergillus oryzae ZLCY-M508 as described in this embodiment of the invention under a microscope.

[0045] Figure 11 The growth curve (OD600nm) of ZLCY-S822, a yeast strain of the present invention, in an expansion tank.

[0046] Figure 12 This is the growth curve (blood cell count method) of ZLCY-S822 *Zygosacchariformis* as described in this embodiment of the invention, cultured in an expansion tank. Detailed Implementation

[0047] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0048] Example 1: Isolation, screening, performance testing and identification of bacterial strains in high-salt dilute soy sauce mash

[0049] (I) Isolation and screening of bacterial strains in high-salt, dilute soy sauce mash

[0050] (1) Collection and processing of fermented soybean paste samples

[0051] Samples of fermented soy sauce mash were collected at 30, 60, 90 and 120 days of high-salt dilute state fermentation. Using the traditional dilution plate coating method, 5g of the mash sample was weighed into an Erlenmeyer flask containing 45mL of sterile water and cultured at 28℃ with shaking for 25-30min to prepare a bacterial suspension.

[0052] (2) Isolation and purification of strains

[0053] The prepared bacterial suspension was serially diluted to three appropriate concentrations, and Aspergillus oryzae and yeast in the above samples were isolated and purified using malt extract medium and Bengal red medium, respectively.

[0054] (3) Screening of high protease-producing Aspergillus oryzae

[0055] The clear zone method was used to screen high-protease-producing strains of mold purified from the fermented soybean paste samples. The culture medium was prepared as follows: 10g of casein was dissolved in distilled water at 60-70℃ in small, repeated additions while magnetically stirring to prevent clumping. A small amount of 0.1mol / L NaOH was added dropwise to accelerate dissolution until a completely homogeneous milky white liquid was formed. KH₂PO₄ and K₂HPO₄ were added at a ratio of 0.1%, stirred until dissolved, and then distilled water was added to a final volume of 1L. The pH was adjusted to approximately 7.0, and agar was added. The mixture was then sterilized at 121℃ for 20 minutes before use.

[0056] The initial screening results of high protease-producing strains are shown in Table 1. A total of three mold strains showed a clear zone around their colonies on casein plates. Among them, strain ZLCY-M508 exhibited the most prominent protease production capacity, and its protease production results are shown in [Table 1]. Figure 2 We selected strain ZLCY-M508 as the target strain for subsequent soy sauce brewing research.

[0057] Table 1. Results of protease activity assays in three Aspergillus oryzae strains.

[0058]

[0059] (4) Screening of high-yield alcohol-producing yeasts

[0060] High-alcohol-producing yeasts were screened from the purified yeast strains obtained at each stage of the fermentation process. The specific method was as follows: 1% of the cultured yeast seed solution was inoculated into a hypertonic soy sauce medium and cultured at 30℃ and 180 rpm for 24 h. After culture, the supernatant was collected by centrifugation at 8000 rpm, and the alcohol production of each strain was determined using a biosensor method.

[0061] The above-mentioned hypertonic soy sauce culture medium formula is as follows: soy sauce (V / V) 8%~10%, glucose (m / V) 5%~10%, salt (m / V) 8%~12% or saline (containing the corresponding mass of salt), and water added to the prepared volume.

[0062] The screening results of high-ethanol-producing strains are shown in Table 2.

[0063] Table 2 Results of alcohol production capacity determination of four yeast strains

[0064]

[0065] Table 2 shows that strain ZLCY-S822 exhibited the strongest ethanol production capacity compared to other yeast strains, at 1.763 vol%. Subsequently, the hypertonic soy sauce culture medium was adjusted to a salt concentration of approximately 15% and a pH of approximately 4.5, and cultured using the same method. The ethanol yields were measured to be 1.307 vol% and 1.351 vol%, respectively. This demonstrates that the strain still possesses strong ethanol production capacity under simulated soy sauce mash conditions, thus it can be applied to subsequent research in soy sauce brewing.

[0066] (II) Other performance tests of high protease-producing strain ZLCY-M508

[0067] (1) Determination of amylase production capacity

[0068] The ZLCY-M508 strain was inoculated onto amylase-producing medium using the clear zone method and incubated upside down at 30°C for 5 days. After incubation, the presence of a clear zone around the colony was observed. Enzyme production capacity was expressed as the enzyme activity index (EI). The results are shown below. Figure 3 The enzyme activity index was measured to be 1.43±0.12, indicating that strain ZLCY-M508 has a certain ability to produce amylase.

[0069] The formula for the above amylase-producing culture medium is as follows: soluble starch 5g / L, peptone 10g / L, beef extract 5g / L, sodium chloride 5g / L, pH 7.2~7.4.

[0070] (III) Other performance tests of high-alcohol-producing strain ZLCY-S822

[0071] (1) Determination of environmental stress tolerance

[0072] Salt tolerance and pH tolerance of yeast ZLCY-S822 were determined. Specifically, a 1% inoculum of pre-cultured ZLCY-S822 seed culture was inoculated into YPD liquid medium supplemented with different NaCl concentrations (0, 2%, 4%, 6%, 8%, 10%, 12%, 14%, 16%, 18%, 20%) and different pH gradients (3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 7.0). After incubation at 30℃ and 120 rpm for 24 h, the OD600 nm value of the bacterial culture was measured. Tolerance results are shown below. Figure 4 , Figure 5 As shown in the figure, yeast ZLCY-S822 can still grow under the test concentration of 20% NaCl, and its growth is best at a salt concentration of 4%. It also has a wide pH range of adaptability, growing well under conditions of 3.0 to 7.0, indicating that this strain can fully adapt to the high-salt and weakly acidic environment in the soy sauce brewing process.

[0073] (2) Assay for esterase production capacity

[0074] The ZLCY-S822 strain was inoculated onto esterase-producing medium using the clear zone method. After incubation at 30°C with the medium inverted for 5 days, the enzyme production capacity was expressed as the ratio of the clear zone diameter to the colony diameter. The final test results are shown below. Figure 6 Its enzyme activity index was 1.94±0.17. In summary, the alcohol-producing, ester-producing, and stress-resistant properties of this strain can promote the accumulation of alcohol and ester flavor compounds during soy sauce brewing.

[0075] The preparation method of the above-mentioned esterase-producing medium is as follows:

[0076] PDA culture medium and prepared emulsion were mixed in a 9:1 ratio, sterilized under natural pH conditions, and then poured onto plates. The emulsion was prepared by mixing 3% polyvinyl alcohol solution and glyceryl tartrate in a 9:1 volume ratio.

[0077] (iv) Strain identification

[0078] (1) Identification of high protease-producing strain ZLCY-M508

[0079] The strain ZLCY-M508 was streaked onto malt extract agar and cultured. Its final morphological characteristics are as follows: Figure 7 As shown, the mycelium of this strain initially germinates and appears white in the early stages of culture, transforming into a yellowish, fluffy appearance in the middle stages. In the later stages of culture, a large number of spores are produced, and the colonies eventually turn yellowish-green. Microscopic observation of its final morphology reveals... Figure 8As shown, its green spores are densely distributed and oval in shape. Based on preliminary observation, this strain conforms to the typical characteristics of Aspergillus oryzae.

[0080] The ITS region sequence was amplified using amplification primers ITS1 / ITS4, where,

[0081] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3';

[0082] ITS4: 5'-TCCTCCGCTTATTGATATGC-3';

[0083] The PCR product, after confirming its fragment size, was submitted for testing. Its ITS sequence totaled 503 bp, as shown in SEQ ID NO.1, specifically: GCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTC CGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGG ACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCAGGGTTCATCTCGGATCA

[0084] The above sequences were uploaded to GenBank for comparison. The results showed that strain ZLCY-M508 had the highest similarity to Aspergillus oryzae NRRL 447, at 99.20%. Combined with morphological identification results, the strain was confirmed to belong to Aspergillus oryzae and named Aspergillus oryzae ZLCY-M508. It was deposited on March 3, 2026 at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC M2026366.

[0085] (2) Identification of high alcohol-producing strain ZLCY-S822

[0086] Strawberry strain ZLCY-S822 was streaked onto YPD solid medium and cultured. Its final morphological characteristics are as follows: Figure 9 As shown, single colonies of this strain are white, relatively regular and round, dense and opaque, and do not adhere tightly to the culture medium, making them easy to scrape off; their final morphology, observed under a microscope, is as follows... Figure 10 As shown, yeast cells are oval and exhibit budding and division characteristics, which are consistent with the typical characteristics of yeast.

[0087] The 26S rDNA D1 / D2 region sequence was amplified using amplification primers NL1 / NL4.

[0088] NL1: 5'-GCATATCAATAAGCGGAGGAAAAG-3'

[0089] NL4: 5'-GGTCCGTGTTTTCAAGACGG-3'

[0090] The PCR product, after confirming its fragment size, was submitted for testing. Its 26S rDNA D1 / D2 sequence totals 647 bp, as shown in SEQ ID NO.2, specifically:

[0091] AAAGAGATGTAAACTCTTAAGGGAGTTCTCTCAAAGTGTTGGAGGGGAAGGCCTGCGCTTAATTGCGCGGCTGTTTTTAATCTCCTCCGCCTTTGATACACACATTGGAGTTTCTACTTTTTTGTTCTCTTTGGGAGGGTTCTGCTCTCCCAGAGGTAAAC ACAAACAATCTTTTATTATACTATTAACACAGTCAAATGAATTTTAAAACAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAACTGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTT TGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACTTTACGTTTGGTAGTGAGCGATACTCTACTCTGGAGTTTGCTTGAAAATGGGAGGCCATAGGCGAAGCATTGCTTTCCAATCCTGCGGCCCTCT GCTTACTTCCCCTTGTGGGTTGTGGCAGGGGAAAGCGGGAGGCGCCTTGCCACGATAGTCGTATTAGGTTTTACCGACTCGGCGAAAGTGAAGAGGTTTGCTTTTAAAAAGAAGCAGGCAGCGTCTGGCTTGACAAAATTCTCAAAGTTTGACCTCAAATC

[0092] The above sequence was uploaded to GenBank for comparison. The results showed that the similarity between strain ZLCY-S822 and Zygosaccharomyces rouxii HBB541 reached 99.38%. Combined with the morphological identification results, it was confirmed that this strain belongs to Zygosaccharomyces rouxii and was named Zygosaccharomyces rouxii ZLCY-S822. It was deposited at the China Center for Type Culture Collection on March 3, 2026, at Wuhan University, Wuhan, China, with accession number CCTCC M2026365.

[0093] Example 2: Preparation of Aspergillus oryzae ZLCY-M508 seed culture and evaluation of protease activity

[0094] (1) Preparation of strain: Take the slant of the preserved Aspergillus oryzae ZLCY-M508 test tube, pick a loop of hyphae, streak it onto malt extract solid medium, incubate at 30℃ with the inverted incubation, and purify the culture twice for later use.

[0095] (2) Preparation before making koji: Mix the koji raw material wheat bran with water at a ratio of 1:0.9~1.0, stir thoroughly to make the wheat bran fully absorb water, put 20~25g of material into a small triangular bottle and 60~70g of material into a large triangular bottle, steam the material at 110℃~115℃ for 30min, shake the material while it is hot to prevent clumping, and then cool it to room temperature for later use.

[0096] (3) Preparation of small triangular flask starter: Use an inoculation loop to scrape 2 loops on the cultured Aspergillus oryzae plate and inoculate it into the small triangular bran that has been cooked and cooled. Shake the flask thoroughly to ensure even distribution of the inoculum. In the early stage of cultivation, pile the bran starter at the bottom of the flask to keep it moist. Incubate at 30-32℃. Shake once every 4-5 hours and then pile it together again. When white spots appear slightly on the bran after 8-10 hours of cultivation, shake it thoroughly again. After 18-20 hours of cultivation, cover the flask and continue cultivation. After 68-72 hours of cultivation, the small triangular flask starter is obtained.

[0097] (4) Preparation of large triangular flask starter: Inoculate the small triangular starter prepared in step (3) into the cooled large triangular bran at a ratio of 5% (based on the mass of the starter material), shake well, and cultivate under the same environmental conditions for 60-65 hours to obtain the large triangular flask starter.

[0098] (5) Preparation of soy sauce starter: Spread the mixed wheat bran material on a plate to a thickness of 1-2 cm, and put it into a starter machine to steam at 118-121℃ for 30 min. Inoculate the Erlenmeyer flask with Aspergillus oryzae starter at a ratio of 0.3%-0.5% (based on the mass of the starter material). Incubate at a constant temperature of 28-34℃. Observe the mycelial growth every 12 h during the incubation period. After 60-65 h of incubation, the surface of the wheat bran turns yellow-green to obtain the soy sauce starter.

[0099] (6) Determination of the activity of acidic and neutral proteases in ZLCY-M508 soy sauce koji.

[0100] The acidic and neutral protease activities of ZLCY-M508 soy sauce starter were determined according to SB / T 10317-1999 "Determination of Protease Activity - Folin Method". One unit of acidic protease activity (U / g) was defined as the production of 1 µg of tyrosine per minute from casein hydrolysis by 1 g of starter at 40℃ and pH 3.0; one unit of neutral protease activity (U / g) was defined as the production of 1 µg of tyrosine per minute from casein hydrolysis by 1 g of starter at 40℃ and pH 7.2. The results are shown in Table 3. The acidic protease activity of ZLCY-M508 soy sauce starter was 1453±142 U / g, and the neutral protease activity reached 2268±174 U / g. Both indicators meet the internal control requirements for soy sauce brewing production.

[0101] Table 3. Determination of neutral and acidic protease activity in ZLCY-M508 soy sauce starter.

[0102]

[0103] Example 3: Determination of the growth curve of ZLCY-S822 zygosaccharizoi in a propagation tank

[0104] Starting from the inoculation of the cultured yeast seed culture in the expansion tank, a suitable sample was collected every 4 hours from the sampling port. The changes in yeast cell count during the expansion tank culture were tracked using two methods: spectrophotometry to measure the OD600nm absorbance and hemocytosis (HSC) counting. Growth curves were plotted, as shown below. Figure 11 , Figure 12 .

[0105] As shown in the figure, the OD600 value consistently increased from 0h to 42h during the culture process. The rate of increase slowed from 0h to 22h, and from 22h onwards, the increase at each node was less than 0.1, indicating a stable period. Cell plate counting results showed that the cell count reached the hundreds of millions level at 18h of culture and peaked at 2.365 x 10⁻⁶ cells / year at 22h. 8 The bacterial count decreased to CFU / mL, followed by a fluctuating downward trend. Furthermore, in multiple batches, differences in the initial inoculation amount only slightly affected the time to reach peak bacterial count, but the deviation in the growth cycle was not significant. Based on the plotted growth curves, the optimal culture time for yeast in the expansion tank was determined to be 22-23 hours, with a maximum of 24 hours.

[0106] Example 4: Application of high-protease-producing Aspergillus oryzae ZLCY-M508 and high-alcohol-producing ZLCY-S822 in the process of reducing salt in Japanese soy sauce

[0107] The three-stage reduced-salt Japanese soy sauce fermentation process includes the following steps: (1) raw material inspection and warehousing, (2) raw material steaming, (3) roasting wheat, (4) koji preparation, (5) disc koji making, (6) soy sauce mash fermentation, (7) yeast strain preparation, (8) alcoholic fermentation, (9) soy sauce mash transfer to tank, combined fermentation and pressing of wine mash, and sterilization of raw oil.

[0108] Among them, the raw material inspection and warehousing step includes:

[0109] 1.1 The main raw materials include defatted soybeans and wheat;

[0110] Furthermore, the quality requirements for defatted soybeans are: protein content ≥46% (on a wet basis), moisture content ≤12%, ash content ≤7.5%, impurities ≤0.1%, and no clumping or mold.

[0111] The quality requirements for wheat are as follows: starch content ≥60% (on a wet basis), protein ≥11.5% (on a dry basis), moisture ≤12.5%, test weight ≥750 g / L, plump grains, imperfect grains ≤8.0%, and no impurities, mold, or sprouted wheat.

[0112] The raw material cooking step includes the following procedures:

[0113] 2.1 Feeding: Defatted soybeans are fed into the moistening tank through a conveying pipe;

[0114] 2.2. Moistening: Add hot water above 85℃ at 0.95~1.10 times the weight of defatted soybeans to moisten the material, ensuring that the material fully absorbs water, can be rubbed by hand, and has no dry core inside;

[0115] 2.3 Cooking: Preheat the continuous steaming equipment to 130℃~132℃. After the moistened material is placed in, control the temperature to rise to 132~135℃ and the pressure to 0.18~0.22MPa, and cook for 4~5 minutes.

[0116] 2.4 Cooling: Quickly cool the cooked material to below 40°C. During the cooling process, the material should be stirred appropriately to prevent clumping. After cooling, the moisture content of the cooked material should be controlled within the range of 48% to 52%.

[0117] The roasting of wheat includes the following steps:

[0118] 3.1 Roasting: The wheat in the storage bin is fed into the roasting machine at a uniform speed through the conveying pipeline. The roasting temperature is slightly adjusted according to different seasons. In spring, summer and autumn, it is maintained at 310~320℃. In winter, the roasting temperature needs to be increased and controlled at 340~370℃ to ensure uniform heating.

[0119] 3.2 Cooling: Roasted wheat grains should be immediately cooled to below 40°C to prevent residual heat from causing the grains to spoil.

[0120] 3.3 Crushing: After cooling, the material is crushed in a crusher with a screen mesh size of 32. After crushing, the material is sieved to ensure that the amount of material passing through the screen is ≤28%~32%.

[0121] 3.4 Temporary storage: Roasted wheat flour can be stored in a sealed wheat flour silo, which should be kept dry (humidity ≤55%). Clumped wheat flour needs to be crushed and sieved again.

[0122] Furthermore, the sensory requirements for the roasted wheat are that the grains are light brown, have a wheat aroma, and are free of burnt grains; the puffing degree should be at least >1.4% in summer and >1.5% in winter.

[0123] The seed koji preparation steps include the following procedures:

[0124] 4.1 Ingredients: Add water to wheat bran at a ratio of 1:0.9~1.0 and mix for 20~25 minutes. The moisture content of the material should be 55%~60%.

[0125] 4.2 Sterilization of materials: The materials are placed on trays and spread evenly to a thickness of 1-2 cm, and then fed into a seed koji machine for steam cooking at 118-121℃ for 30 minutes;

[0126] 4.3 Inoculation: Inoculate the Erlenmeyer flask with Aspergillus oryzae at a concentration of 0.3%~0.5% of the material weight (spore count ≥ 5.0 × 10⁻⁶). 9 cfu / g (on a dry basis)), mix thoroughly;

[0127] 4.4. Cultivation: Incubate at a constant temperature of 28~34℃ for 60~65h, observing mycelial growth every 12h during this period. The mycelial germination is white, then fluffy in the middle stage, and finally turns yellowish-green.

[0128] Furthermore, the Aspergillus oryzae ZLCY-M508 exhibits a protease activity index (D / d) of 2.47±0.26 on casein plates, indicating strong proteolytic ability, and an enzyme activity index of 1.43±0.12 on starch plates, indicating a certain ability to produce amylase.

[0129] Furthermore, the number of spores in the *Aspergillus oryzae* inoculum should be ≥5.0 × 10⁻⁶ after cultivation. 9 CFU / g (on a dry basis), acidic protease activity can reach 1300~1500 U / g under low temperature conditions, neutral protease activity is 2000~2300 U / g, germination rate ≥90%, sensory appearance is yellow-green, with a smoky aroma, no off-odor, and no contamination by other microorganisms (total bacterial count ≤1×10⁻⁶). 7 cfu / g).

[0130] The disc-making process includes the following steps:

[0131] 5.1 Mixing: Mix the cooked defatted soybeans and roasted wheat flour in a ratio of 4.5~4.8:1, controlling the moisture content of the materials to 46%~50%;

[0132] 5.2 Inoculation: Inoculate with starter culture at 0.25%~0.30% of the material weight, and mix quickly to prevent clumping;

[0133] 5.3. Making koji: Send the koji material to the disc for cultivation. The initial temperature of the material should not be lower than 28℃. Monitor the temperature every hour. If it is consistently higher than 35℃, increase the turning operation or shorten the turning interval. After 36~42 hours of cultivation, the material is yellow-green and there is no white material, which means the koji is ready.

[0134] Furthermore, after the disc fermentation process is completed, the finished product has a yellow-green sensory appearance, a rich aroma, a moisture content of 24% to 32%, and an acidic protease activity of 1000 to 1300 U / g and a neutral protease activity of 1800 to 2200 U / g under low temperature conditions.

[0135] The fermentation process of the soy sauce mash includes the following steps:

[0136] 6.1 Salt dissolution: Weigh out salt precisely at 20% of the brine mass and dissolve it in the production water. Cool the prepared brine to below 10°C and keep it warm for later use.

[0137] 6.2. Putting into the tank: Mix the koji and cold brine at a ratio of 1:1.9~2.0 of the total mass of the raw materials and put them into a multi-functional fermentation tank (for holding, heating and keeping warm), also known as a three-layer tank. The initial pH of the fermented mash should be in the range of 5.3~5.6 and the initial temperature should be ≤18℃. In summer, it should be controlled below 15℃.

[0138] 6.3 Fermentation: For the first 15 days after fermentation, the temperature of the fermented mash should be maintained between 15 and 18°C. From the 16th day onwards, the temperature of the material should be gradually increased, steadily rising to 30-32°C by the 60th day of fermentation. The pH should drop to around 5.1, the salt content should be between 16.0 and 17.5 g / 100 mL, the amino acid nitrogen content ≥ 1.25 g / 100 mL, and the reducing sugar content approximately 2.2-3.2 g / 100 mL. At this time, the suitable temperature, pH environment, and salt concentration in the tank work synergistically, providing suitable conditions for the growth and reproduction of Aspergillus oryzae. During the first 60 days of fermentation, Aspergillus oryzae efficiently secretes proteases, peptidases, and other hydrolytic enzymes, which directionally degrade soybean protein and wheat protein to produce flavor amino acids such as glutamic acid and aspartic acid, significantly enhancing the umami intensity of the fermented mash. In addition, Aspergillus oryzae secretes amylase to hydrolyze starch into reducing sugars such as glucose and maltose. On the one hand, this gives soy sauce a mellow sweetness, and on the other hand, it provides carbon sources for other microorganisms such as yeast and lactic acid bacteria in the soy mash, generating flavor precursors such as alcohol and organic acids, thus laying the foundation for the formation of the complex flavor and rich taste of soy sauce.

[0139] The yeast strain preparation steps include the following procedures:

[0140] 7.1 Seed culture preparation: ZLCY-M508 *Zygosacchariformis* cultured on slant culture was streaked onto a PDA plate containing 5% NaCl. After two consecutive purifications, it was transferred to a hypertonic soy sauce culture medium and cultured at 30°C and 180 rpm for 48 hours with shaking. The hypertonic soy sauce culture medium was consistent with that described in Example 1.

[0141] 7.2 Secondary expansion culture: In the tertiary tank, first sterilize at 85℃ for 30 minutes, then add the soy sauce hypertonic culture medium and sterilize at 95℃ for 30 minutes. Cool to 30℃, inoculate with the above seed liquid at 6%, and culture at 28~32℃ for 22~23 hours.

[0142] 7.3. Tertiary propagation: The quaternary tank undergoes the same sterilization treatment. Inoculate with 2% of the above-mentioned secondary seed culture and incubate at 28-32℃ for 22-23 hours, controlling the cell count to ≥1.5×10⁻⁶. 8 After the cfu / mL value is qualified, the material is discharged into the fermentation tank for soy sauce mash.

[0143] Furthermore, the *Zygosaccharomyces rouxii* ZLCY-S822 strain can tolerate a salt concentration of 20%, with optimal growth at 4% salt concentration. This strain also exhibits a wide pH tolerance range, growing well between 3.0 and 7.0. Additionally, in a simulated soy sauce fermentation environment (15% salt concentration, pH=4.5), the strain produced 1.307 vol% and 1.351 vol% alcohols after 48 hours of cultivation, indicating that it retains strong alcohol production capacity even under high salt and acidic conditions.

[0144] The alcoholic fermentation step includes the following procedures:

[0145] 8.1 Preparation of enhanced Daqu: Before pressing Daqu, the prepared Aspergillus oryzae seed koji is inoculated into the raw materials at a ratio of 0.5% to 1%. The raw materials, barley and peas, are mixed in a ratio of 7:3. After pressing, fermentation, and storage for 3 months, Aspergillus oryzae enhanced Daqu is produced to make up for the deficiency of low protease activity in traditional Daqu.

[0146] 8.2 Feeding: Feed the roasted wheat flour into the alcohol tank through the conveying pipe, add hot water above 95℃ at 300% of the material mass, seal the top tank door, and keep it warm for 1 to 1.5 hours to fully liquefy the roasted wheat flour mash.

[0147] 8.3. Adding Daqu and Yeast: When the material temperature drops to 29~31℃, first add 20% (by weight of roasted wheat flour) of finely ground Daqu and saccharify for 30 minutes, then inoculate with the yeast liquid that has been expanded to the fourth stage, and stir the mash thoroughly; after mixing evenly, the initial salinity of the mash is about 0.25%~0.30%, and the amino acid nitrogen is about 0.030-0.032g / 100mL. The low salinity can effectively inhibit the growth of miscellaneous bacteria, and the amino acid nitrogen can provide a suitable nutritional environment for beneficial microorganisms;

[0148] 8.4 Alcoholic Fermentation: The first 3 days are the main fermentation process, requiring open fermentation. During this time, the Daqu (a type of starter culture) acts as the saccharifying and fermenting agent, while the brewing yeast and Ludwig's yeast rapidly multiply and consume sugars, marking the main alcohol production stage. During this process, aeration and stirring are performed twice a day, morning and evening, for 10-15 minutes each time, with an instantaneous aeration rate of 1.5 m³ / s.3 The fermentation rate is controlled at 30°C / min, providing oxygen for yeast reproduction and releasing CO2. During this stage, the material temperature rises slowly, requiring control of the fermentation rate; the temperature must not exceed 30°C. After 3 hours of fermentation, the container is sealed, entering the mash-nurturing stage. Other beneficial microorganisms in the koji (fermentation starter) utilize the sugars and alcohols accumulated during the main fermentation period to produce organic acids, esters, and other substances. The mash temperature initially remains stable and then slowly decreases, continuing fermentation for 8 days. During this stage, the mash temperature must be maintained at 25-28°C to ensure the activity of the *Gnaphalium affine* yeast, preparing for its subsequent merging with the soy sauce mash. *Aspergillus oryzae* in the koji is then used to fortify the proteins in the koji and wheat raw materials, converting them into amino acid nitrogen, ultimately yielding a mature mash with high ammonia nitrogen and high alcohol content, made from roasted wheat flour.

[0149] Furthermore, the Daqu (a type of starter culture) is Aspergillus oryzae-enhanced Daqu, and its quality requirements are as follows: bluish-white in appearance, grayish-yellow in skin thickness ≤3mm, no heartburn or off-odor, with a Daqu aroma or roasted pea aroma, moisture content ≤14%, acidic protease activity of 100~150U / g, saccharification power of 500~800 mg / g·h, and acidity ≤0.90g / 100g.

[0150] Furthermore, the quality requirements for the mature mash are as follows: reducing sugar content between 0.5 and 1 g / 100 mL, alcohol content between 8.5 and 9.0% vol, acidity ≤ 1.50 g / 100 mL, amino acid nitrogen ≥ 0.12 g / 100 mL, mash liquid pale yellow, and wine clear.

[0151] The step of merging the fermented mash in the transfer tank includes the following procedures:

[0152] 9.1 Transfer of fermented mash to tank: After 60 days of fermentation in the tank, the temperature of the fermented mash rises to 30~32℃ and the pH drops to 4.9~5.1. The fermented mash in the three-layer small tank is transferred to the double-layer large tank through the conveying pipeline. Subsequent fermentation mainly relies on biochemical reactions rather than continuous heating. Therefore, the double-layer tank only retains the heat preservation function and can maintain the temperature of the mash at 22~26℃ throughout the year.

[0153] 9.2. Combining the mash: The above-mentioned mature mash is piped to a double-walled tank and mixed with the sauce mash. No more salt is added to the mixed mash. At this time, the salt content is 11-13 g / 100mL. Under this environment, the yeast ZLCY-S822 can grow and metabolize normally, exerting its ester production and aroma-enhancing effects. Continue natural fermentation until the total cycle is 180 days, and finally obtain the fermented mature sauce mash.

[0154] Furthermore, the quality requirements for the mature fermented sauce are as follows: amino acid nitrogen content ≥1.0 g / 100mL, reducing sugar content 2.00-3.50 g / 100mL, alcohol content 2.8~3.50 %vol, pH ≥4.8.

[0155] The mature soy sauce mash, which has been fermented for 180 days, is pressed and sterilized, and then left to stand at a constant temperature for 7-10 days to settle, thus obtaining crude soy sauce.

[0156] Referring to GB / T 18186-2025 "General Rules for Soy Sauce Quality", conventional methods in the industry were used to test the physicochemical indicators of soy sauce crude oil, including ammonia nitrogen, total nitrogen, salt-free solids, salt content, and alcohol content, produced by the three-stage reduced-salt Japanese fermentation process of this invention and the traditional high-salt dilute-state fermentation process. The results are shown in Table 4.

[0157] Table 4. Test results of physicochemical properties of crude soy sauce.

[0158]

[0159] This invention provides a time-sequential, segmented, and controlled low-salt Japanese-style soy sauce brewing process. It employs a three-stage fermentation approach: enzymatic hydrolysis, followed by alcohol production, and then aroma enhancement. Through the synergistic control of equipment, process, strains, environment, and timing, it achieves efficient conversion and simultaneous quality improvement during the soy sauce fermentation process. As shown in Table 1, the crude soy sauce produced using this process exhibits physicochemical indicators such as amino acid nitrogen, total nitrogen, and soluble non-salt solids that are superior to the national standard limits for premium soy sauce. The ammonium salt / amino acid nitrogen ratio is only 19.23%, far below the standard limit of ≤28%. Furthermore, the segmented salt reduction scheme effectively alleviates the inhibitory effect of high-salt stress on yeast alcohol production, resulting in an alcohol content of 3.32 Vol% in the crude soy sauce, more than twice that of traditional processes. Meanwhile, this process stabilizes the reducing sugar content in crude soy sauce to the range of 2.00-3.50 g / 100mL, which is 52.67% lower than that of traditional processes, and the raw material conversion and utilization rate is significantly optimized.

[0160] As described above, the *Aspergillus oryzae* ZLCY-M508 strain obtained in this invention exhibits strong protease and amylase activities, while the accompanying *Zygosacchariformis* ZLCY-S822 strain combines salt tolerance, acid and alkali tolerance, high ethanol production, and esterase production. By coupling and adapting these two strains with a segmented low-salt Japanese soy sauce process and fermentation tanks, a system that balances low-salt fermentation, high flavor compound accumulation, and efficient raw material conversion is established. This effectively overcomes the shortcomings of traditional high-salt, diluted soy sauce, such as its thin alcohol and ester flavor and poor bacterial metabolic efficiency. A high-quality soy sauce fermentation system with precise synergy between equipment, process, and strains, and easy to promote, is thus constructed.

[0161] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A strain of Aspergillus oryzae ZLCY-M508, characterized in that, The Aspergillus oryzae ZLCY-M508 strain is deposited at the China Center for Type Culture Collection, with accession number CCTCCM2026366.

2. A strain of Zygosaccharomyces rouxii ZLCY-S822, characterized in that, The Zygosaccharomyces rouxii ZLCY-S822 strain is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M2026365.

3. A three-stage reduced-salt Japanese soy sauce fermentation process, characterized in that, Includes the following steps: (1) Raw material processing: defatted soybeans are moistened, steamed and cooled; wheat is roasted and then ground to obtain roasted wheat flour; (2) Preparation of starter culture and disc fermentation: using wheat bran as raw material, sterilizing it and then inoculating it with Aspergillus oryzae ZLCY-M508 as described in claim 1 to prepare starter culture; after steaming and defatting soybeans and roasted wheat flour, the starter culture is inoculated into disc fermentation to obtain finished starter culture; (3) Fermentation of sauce mash: After mixing the koji with cold brine, it is sent to a three-layer fermentation tank for fermentation. The temperature of the sauce mash is maintained at 15~18℃ for the first 15 days. From the 16th day, the temperature is gradually increased, with a daily increase of no more than 0.5℃. When fermentation reaches 60 days, the temperature is maintained at 30~32℃ to complete the enzymatic hydrolysis of the sauce mash. (4) Independent alcoholic fermentation: Roasted wheat flour and hot water at 95°C or above are fed into an alcohol tank at a mass ratio of 1:3 and liquefied for 1 to 1.5 hours. When the temperature drops to 29 to 31°C, 20% of the mass of roasted wheat flour is added to strengthen the saccharification of Daqu for 30 minutes. Then, 1% of the volume of mash is inoculated with the cultured Zygosaccharomyces rouxii ZLCY-S822 bacterial solution as described in claim 2 and alcoholic fermentation is carried out for 11 days to obtain mature mash. (5) Combined fermentation: Transfer the fermented mash from step (3) for 60 days to a double-walled insulated tank and mix it evenly with the mature mash obtained in step (4). No more salt is added after mixing. Ferment naturally until the total cycle is 180 days to obtain the mature mash. (6) Post-processing: After pressing and sterilizing the mature soy sauce mash, let it stand to settle and obtain crude soy sauce.

4. The three-stage reduced-salt Japanese soy sauce fermentation process according to claim 3, characterized in that, In step (1), during the moistening and steaming processes, hot water at a temperature above 85°C is used at 0.95 to 1.10 times the weight of defatted soybeans. The steaming temperature is 132 to 135°C, the pressure is 0.18 to 0.22 MPa, and the time is 4 to 5 minutes. The material is then cooled to <40°C, and the moisture content of the cooked material after cooling is 48% to 52%. The roasting process is carried out at a temperature of 310~370℃. After roasting, the wheat is immediately cooled to <40℃. The roasted wheat is light brown, has a wheat aroma, and has no burnt grains. The puffing degree is >1.4% in summer and >1.5% in winter. After crushing, the material passing through a 32-mesh sieve is ≤28%~32%.

5. The three-stage reduced-salt Japanese soy sauce fermentation process according to claim 3, characterized in that, In step (2), when preparing the starter culture, adjust the moisture content of the wheat bran to 55%~60%, steam it at 118~121℃ for 30 minutes to sterilize it, inoculate it with Aspergillus oryzae ZLCY-M508 starter culture at 0.3%~0.5% of the material weight, and then incubate it at 28~34℃ for 60~65 hours to obtain the starter culture. The Aspergillus oryzae inoculum has a spore count ≥ 5.0 × 10⁻⁶. 9 CFU / g, acidic protease activity of 1300~1500 U / g, neutral protease activity of 2000~2300 U / g, and germination rate ≥90%.

6. The three-stage reduced-salt Japanese soy sauce fermentation process according to claim 3, characterized in that, In step (2), the defatted soybeans after steaming and cooking are mixed with roasted wheat flour at a mass ratio of 4.5~4.8:

1. The moisture content of the koji material is 46%~50%. Aspergillus oryzae seed koji is inoculated at 0.25%~0.30% of the material weight. Then it is sent to a disc for cultivation. The initial product temperature is not lower than 28℃, and the temperature is controlled <35℃. The koji is cultivated for 36~42h. When the material is yellow-green and there is no white material, it is considered as finished koji.

7. The three-stage reduced-salt Japanese soy sauce fermentation process according to claim 3, characterized in that, The cold brine in step (3) has a mass concentration of 20% and a temperature of <10℃; the koji and cold brine are mixed at a mass ratio of 1:1.9~2.0, and the initial pH of the mixed material is 5.3~5.6 and the initial temperature is ≤18℃.

8. The three-stage reduced-salt Japanese soy sauce fermentation process according to claim 3, characterized in that, The preparation method of Aspergillus oryzae-enhanced Daqu for alcoholic fermentation in step (4) is as follows: Before pressing Daqu, Aspergillus oryzae seed koji is inoculated into the Daqu raw materials at a ratio of 0.5% to 1% based on the mass of the Daqu raw materials. The Daqu raw materials are barley and peas mixed in a mass ratio of 7:

3. The amount of Aspergillus oryzae-enhanced Daqu used is 20% of the mass of roasted wheat flour.

9. The three-stage reduced-salt Japanese soy sauce fermentation process according to claim 3, characterized in that, In step (4), the alcoholic fermentation is carried out in an open environment for 3 days before fermentation, with aeration and stirring once in the morning and once in the evening, with a stirring time of 15 minutes and an instantaneous aeration rate of 1.5 m³. 3 The temperature is controlled at 30℃, and the yeast multiplies rapidly to produce wine. After 3 days, the mash is sealed and kept at 25-28℃ for 8 days to produce mature mash. The number of cells in the *Zygosaccharomyces rouxii* ZLCY-S822 added to the mash is ≥1.5 × 10⁻⁶. 8 cfu / mL.

10. The three-stage reduced-salt Japanese soy sauce fermentation process according to claim 3, characterized in that, In step (5), after the fermented sauce mash and the mature fermented wine mash are mixed, the salt content of the mixed mash is low, which is 11~13 g / 100mL; when the fermentation reaches a total cycle of 180 days, the amino acid nitrogen content of the mature fermented sauce mash is ≥1.0 g / 100mL, the reducing sugar content is 2.00~3.00 g / 100mL, the alcohol content is 2.8~3.0 %vol, and the pH is ≥4.

8.

11. A soy sauce brewed using the three-stage reduced-salt Japanese soy sauce fermentation process as described in any one of claims 3-10.

Images