A strain of Aspergillus oryzae that produces the natural product calcarisarbulide A with high anti-liver fibrosis activity and its application

Abstract

This invention discloses an engineered strain of Aspergillus oryzae capable of efficiently synthesizing the natural product calcarisarbulide A, which has anti-liver fibrosis activity, and its applications. The strain is Aspergillus oryzae. Aspergillus oryzae XM360, accession number CGMCC NO: 42352; prepared using Aspergillus oryzae RIB40 ΔpyrG The strain is the starting strain, through the synthesis of backbone genes calI Placed in a high-efficiency promoter ANIA_01036p Under control, and npgA Genes placed tef1p The strain was prepared by co-constructing a free plasmid under promoter-driven conditions. The strain of this invention can stably synthesize calcarisarbulide A through fermentation, achieving a yield of approximately 2755.7 mg / L in shake-flask fermentation, several times higher than the original yield. The strain is genetically stable, has high yield, and is easily scaled up industrially, making it suitable for large-scale green production of natural products for treating liver fibrosis.

Description

Technical Field

[0001] This invention belongs to the fields of microbial metabolic engineering, pharmaceutical biotechnology and natural product synthesis, and specifically relates to an engineered strain of Aspergillus oryzae that can produce calcarisarbulide A in high quantities and its application. Background Technology

[0002] Liver fibrosis is a common pathological process in various chronic liver injuries (including viral hepatitis, alcoholic liver disease, non-alcoholic steatohepatitis, and drug-induced liver injury), and a key link in the development of cirrhosis and liver cancer. Its pathological mechanism mainly involves the overactivation of hepatic stellate cells (HSCs), leading to a large accumulation of extracellular matrix (ECM). While entecavir, antioxidants, and investigational drugs targeting non-alcoholic steatohepatitis (NASH / MASH) are currently available clinically, drugs that directly, effectively, and safely reverse fibrosis are still very scarce. Therefore, the development of novel anti-fibrotic molecules derived from natural products is of great significance.

[0003] Fungal natural products, due to their structural diversity and significant biological activity, have become an important source of new drugs for treating liver fibrosis. Among them, those derived from *Gnaphalium affine* (… Calcarisporium arbuscula calcarisarbulide-like natural products (especially calcarisarbulide A, such as...) Figure 1 These fungi have been reported to have biological effects such as inhibiting hepatic stellate cell activation and reducing α-SMA and Col I expression, showing potential for research and development in the field of natural products for anti-liver fibrosis. However, these natural products typically have extremely low yields in the original fungi, long growth cycles, unstable fermentation, and host strains that do not meet industrial safety standards, which limits their pharmacological research, structural modification, and large-scale production.

[0004] In recent years, with the development of synthetic biology and fungal metabolic engineering, obtaining high-yield natural products through gene cluster mining, heterologous expression, and metabolic flux regulation has become a major technical route. The filamentous fungus *Aspergillus oryzae* (… Aspergillus oryzae As a GRAS (Generally Recognized as Safe) industrial microorganism, *Aspergillus oryzae* possesses advantages such as a mature gene-editing system, well-developed post-translational protein modification, high metabolic flux, and a solid foundation in fermentation industry. It is widely used in the heterologous synthesis of fungal secondary metabolites, such as ergot alkaloids, citrinins, and terpenoids. Therefore, constructing a highly efficient biosynthetic system for calcarisarbulide A in *Aspergillus oryzae* is an important strategy to overcome its low-yield limitations.

[0005] However, existing literature lacks reports on the high-yield heterologous synthesis of calcarisarbulide A in any microorganism, and there are no reported technical solutions for constructing high-yield engineered strains of calcarisarbulide A in Aspergillus oryzae. The main challenges include: (1) Calcarisarbulide A is a hybrid natural product of polyketide synthase and nonribosomal polypeptide synthase, and its backbone synthesis gene calI Large sequences are difficult to express; (2) PKS-NRPS enzymes usually require post-modification with 4'-phosphoubiotinyl thioethylamine transferase (PPTase). The activity of endogenous PPTase in the host is often insufficient, which leads to the incomplete activation of the expressed protein. (3) The high expression level of calcarisarbulide A must be obtained by a suitable and strong fungal promoter, but the regulatory ability of different promoters in Aspergillus oryzae varies significantly. (4) Integration sites, copy number, transcriptional regulation, etc. of heterologous metabolic pathways can all affect the synthesis efficiency of the target product. Existing technologies have not yet solved these problems. Summary of the Invention

[0006] The purpose and significance of this invention are to construct and obtain an engineered strain of *Aspergillus oryzae* (accession number CGMCC NO: 42352, XM360) capable of producing a high yield of the natural product calcarisarbulide A with anti-hepatic fibrosis activity, and to provide its construction method and application in the fermentation synthesis of calcarisarbulide A. This invention leverages the advantages of *Aspergillus oryzae* engineered strains in synthesizing calcarisarbulide A, such as a short culture cycle, significantly increased yield, and good genetic stability, to provide a feasible approach for the large-scale production of calcarisarbulide A and subsequent drug development, and has high industrial application value.

[0007] One of the problems this invention aims to solve is to construct an engineered strain capable of efficiently expressing genes related to the biosynthesis of calcarisarbulide A.

[0008] The second problem to be solved by this invention is to apply the constructed Aspergillus oryzae engineered strain to the fermentation production of calcarisarbulide A.

[0009] The problem to be solved by this invention is achieved through the following solution: I. An engineered strain of Aspergillus oryzae: The Aspergillus oryzae engineered strain is an engineered Aspergillus oryzae strain. Aspergillus oryzaeXM360 is held in the collection of CGMCC, with accession number CGMCC NO: 42352, and the accession date is December 9, 2025.

[0010] II. Application of a single engineered strain of Aspergillus oryzae: The engineered strain of *Aspergillus oryzae* carries a free plasmid that replicates stably within *Aspergillus oryzae*, and the plasmid contains a promoter. ANIA_01036p Driven calI Gene expression cassettes and promoters with high transcriptional activity tef1p Driven npgA The gene expression cassette enables the strain to efficiently synthesize calcarisarbulide A through expression mediated by a free plasmid.

[0011] Application in the high-yield fermentation synthesis of calcarisarbulide A, a natural product with anti-liver fibrosis activity.

[0012] The high yield and high efficiency mentioned in this invention refer to a yield of 2755.7 mg / L.

[0013] III. Preparation and construction method of a high-yield Aspergillus oryzae engineered strain producing calcarisarbulide A: The method includes the following steps: (1) Activation of the starting strain: The starting strain is Aspergillus oryzae. Aspergillus oryzae RIB40 ΔpyrG It is wild type A. oryzae RIB40 (Machida, Masayuki, et al. "Genome sequencing and analysis of Aspergillus oryzae " Nature. (2005. 438(7071): 1157-1161.) was constructed using this genetic background, through knockout... pyrG Genes were used to acquire the uridine / uracil auxotrophic phenotype. Aspergillus oryzae... Aspergillus oryzae RIB40 ΔpyrG The strain was inoculated onto PDA solid medium plates containing 10 mM uracil and 5 mM uridine and cultured for activation treatment; (2) Construction calI and npgA Gene expression module: The backbone gene was obtained by extracting and amplifying DNA from *Aspergillus nidus* and *Aspergillus nidus*, respectively. calI and npgA Genes, and then separately constructed to obtain calI Expression box and npgA Expression frames are then reconstructed to obtain recombinant expression vectors.calI and npgA Gene expression module; (3) Obtaining engineered strains: The recombinant expression vector pFC902- was transformed using a protoplast transformation method. gpdAp-afoA-1036p-calI- tef1p-npgA The Aspergillus oryzae obtained in step (1) is introduced into a free, non-genomically integrated form to drive the target gene. calI and npgA Expression; plasmid containing the uridine / uracil synthesis gene pyrG Positive transformants that have undergone plasmid recombinant synthesis regain the ability to synthesize uridine / uracil and can grow on PDA plates without the addition of uracil and uridine. After obtaining positive transformants carrying the target gene plasmid through uridine / uracil auxotrophic screening, single colonies were obtained by streaking on PDA solid medium plates. These single colonies were then picked and further streaked for purification, undergoing 3–5 consecutive purification cycles to obtain a stable engineered strain, which is the *Aspergillus oryzae* strain. Aspergillus oryzae XM360.

[0014] The plasmid contains the uridine / uracil synthesis gene. pyrG The positive transformants, after plasmid recompensation, regained the ability to synthesize uridine / uracil and were able to grow on PDA plates without the addition of 10 mM uracil and 5 mM uridine.

[0015] Aspergillus oryzae Aspergillus oryzae RIB40 ΔpyrG It is by Aspergillus oryzae Knockout of RIB40 strain pyrG Gene acquisition.

[0016] Aspergillus oryzae RIB40 is a commonly used engineered strain publicly available on NCBI. This study involved knocking out the strains used to synthesize uridine / uracil. pyrG Genetic Aspergillus oryzae Based on RIB40, a high-yield calcarisarbulide A was designed and implemented.

[0017] The specific step (1) involves applying Aspergillus oryzae to the mold. Aspergillus oryzae RIB40 ΔpyrG The strain was inoculated onto PDA solid medium plates supplemented with 10 mM uracil and 5 mM uridine, and incubated at 28°C for 3-5 days until the spores filled the plate. The plate refers to a PDA solid medium plate.

[0018] Step (2) specifically involves: (21) with *Gnaphalium argentea* Calcarisporium arbuscula Using genomic DNA as a template, PCR amplification was performed using primers calI-1-F and calI-1-R to obtain... cal Skeletal genes in gene clusters calI ; The skeletal gene calI Connected to the source afo promoters of gene clusters ANIA_01036p fungal universal terminator trpCt Between, build calI Expression box; (22) Aspergillus nidulans Aspergillus nidulans Using genomic DNA as a template, PCR amplification was performed using primers npgA-F and npgA-R to obtain... npgA Genes; the aforementioned npgA Genes are linked to constitutive strong promoters tef1p Under control, build npgA Expression box; (23) Using a seamless cloning method, the aforementioned calI Expression box and npgA The expression frame is sequentially assembled onto the expression vector pFC902, and simultaneously, a component from... gpdAp Promoter-driven transcriptional regulators afoA The expression module is used to obtain the recombinant expression vector pFC902- gpdAp-afoA-1036p-calI-tef1p-npgA .

[0019] The primers calI-1-F and calI-1-R are SEQ ID No. 1 and SEQ ID No. 2, respectively, which are 5'-ATGACGAAAAACGACATCGTCG-3' and 5'-ATAGCCGTCAGCGTAGCGAG-3'; The primers npgA-F and npgA-R are SEQ ID No. 33 and SEQ ID No. 4, respectively, which are 5'-AGCGCTAAGCTGATATAG-3' and 5'-ATGGTGCAAGACACATCAAG-3'.

[0020] IV. A method for high-yield fermentation synthesis of the anti-liver fibrosis natural product calcarisarbulide A from an engineered strain of Aspergillus oryzae with high calcarisarbulide A production, the method comprising the following steps: S1. Activation of the bacterial strain: The Aspergillus oryzae... Aspergillus oryzaeXM360 was inoculated onto potato dextrose culture (PDA) and cultured at 28°C for 3-5 days until it completely covered a 9 cm diameter plate, yielding a plate culture. The colonies were fluffy, with dense, white hyphae and a milky-white to pale yellow surface. The conidiophores were spherical, with short, thick conidiophores that enlarged at the apex. The conidia were spherical to elliptical with a rough surface. This engineered strain was genetically stable, and its ability to synthesize calcarisarbulide A did not significantly decrease after multiple generations.

[0021] S2. Preparation of fermentation medium: Czapek's liquid medium CD, with 100 mM of ʟ-aspartate sodium salt added, natural pH, autoclaved at 121℃ for 20 min to obtain liquid medium. S3, Shake-flask fermentation culture: The plate culture from step S1 and the liquid culture medium from step S2 are mixed and fermented. S4. Product detection: After fermentation, take 100 μL of the supernatant of the fermentation broth, add an equal volume of methanol and mix well. After filtration through a 0.22 μm filter membrane, use HPLC to detect and analyze the formation and yield of calcarisarbulide A.

[0022] 10. The method for fermenting and synthesizing calcarisarbulide A according to claim 9, characterized in that: Specifically, step S3 involves picking bacterial blocks from the plate culture of step S1, inoculating them into the liquid culture medium obtained in step S2, and fermenting them at 28°C and 180 rpm for 13 days to accumulate a large amount of calcarisarbulide A in the fermentation broth.

[0023] The fermentation yield of calcarisarbulide A was 2755.7 mg / L.

[0024] The engineered strain constructed in this invention was used for fermentation culture. Under the fermentation conditions described in this embodiment, the yield of calcarisarbulide A reached approximately 2755.7 mg / L. Previous studies have reported a fermentation titer of approximately 34.48 mg / L for calcarisarbulide A (Cheng, Jin-Tao, et al. "Discovery of a potential liver fibrosis inhibitor from a mushroom endophytic fungus by genome mining of asilent biosynthetic gene cluster." Journal of agricultural and foodchemistry. 2021. 69(38): 11303-11310.). The calcarisarbulide A yield obtained by the engineered strain of this invention is significantly higher than the levels reported in the literature above, indicating that the heterologous expression system constructed in this invention has good product synthesis capabilities and industrial application potential.

[0025] The strain of this invention is Aspergillus oryzae ( Aspergillus oryzae RIB40 ΔpyrG The strain was the starting strain, and the backbone synthesis genes in the calcarisarbulide A biosynthetic pathway were used. calI Placed in a high-efficiency promoter ANIA_ 01036p Under control, and npgA (ANIA_06140) The gene is placed in a region with high transcriptional activity. tef1p Driven by a promoter, they were co-constructed on a free plasmid that can stably replicate in Aspergillus oryzae, enabling... calI and npgA It can be effectively expressed in the host via plasmid-mediated expression, thereby increasing the level of phosphate pantothenic acid thioethylamine modification of CalI enzyme and significantly improving the synthesis efficiency of calcarisarbulide A.

[0026] The beneficial effects of this invention are as follows: This invention utilizes the engineered strain of Aspergillus oryzae XM360 to synthesize calcarisarbulide A through fermentation, and has the following advantages: (1) Short production cycle and easy-to-control fermentation conditions; (2) The yield of calcarisarbulide A was significantly increased, which can meet the needs of pharmacological research; (3) The strain has high safety and is suitable for industrial fermentation; (4) The engineered strains have good genetic stability and can be stored and used continuously for a long time; (5) It can realize large-scale green bio-manufacturing of calcarisarbulide A and has high application value.

[0027] The strain of this invention can stably synthesize calcarisarbulide A through fermentation, achieving a yield of approximately 2755.7 mg / L in shake-flask fermentation, compared to the original fungus. Calcarisporium arbuscula The yield of calcarisarbulide A was increased several times from 34.5 mg / L. This invention also discloses a method for synthesizing calcarisarbulide A using the engineered strain. The strain of this invention is genetically stable, has high yield, and is easily scaled up industrially, making it suitable for large-scale, green production of natural products for treating liver fibrosis. Attached Figure Description

[0028] Figure 1 This is the chemical structure diagram of calcarisarbulide A; Figure 2 This is a graph showing the relationship between fermentation time and yield of calcarisarbulide A; Figure 3 This is a liquid phase diagram of the calcarisarbulide A fermentation broth and the standard sample. Detailed Implementation

[0029] The present invention will be further described below with reference to the accompanying drawings and specific embodiments.

[0030] This invention uses Aspergillus oryzae Aspergillus oryzae RIB40 ΔpyrG The strain was the starting strain, and the backbone synthesis genes in the calcarisarbulide A biosynthetic pathway were used. calI Placed in a high-efficiency promoter ANIA_01036p Under control, and npgA Genes are co-constructed in a free plasmid (e.g., *Aspergillus oryzae*) driven by a promoter with high transcriptional activity, allowing for stable replication in *Aspergillus oryzae*. Figure 2 On, make calI and npgA It can be effectively expressed in the host via plasmid-mediated expression, thereby enhancing the phosphate pantothenic acid thioethylamine modification level of PKS-NRPS enzyme and significantly improving the synthesis efficiency of calcarisarbulide A.

[0031] The embodiments of the present invention are as follows: Example 1 1. Culture medium preparation and specific culture conditions: (1) Potato glucose agar medium (PDA medium, BD): 4 g potato starch (made from impregnation solution), 20 g glucose, 15 g agar powder, add distilled water to 1000 mL, natural pH value, autoclave at 121℃ for 20 min. (2) Czapek's liquid fermentation medium (CD medium, BD): 30 g sucrose, 3 g sodium nitrate, 1 g dipotassium hydrogen phosphate, 0.5 g magnesium sulfate, 0.5 g potassium chloride, 0.01 g ferrous sulfate, 15.5 g ʟ-aspartate sodium salt, add distilled water to 1000 mL, natural pH, autoclave at 121℃ for 20 min; (3) Aseptic operating conditions: All utensils and equipment must be sterilized at 121℃ for 20 min. The isolation and inoculation of bacterial strains are all carried out in a clean bench. (4) Culture conditions: ① Plate culture: The mycelium blocks are placed in the center of the petri dish for plate culture and cultured at a constant temperature of 28℃ for 7 days. ② Liquid fermentation culture: The mycelium blocks are inoculated into liquid fermentation medium, the rotation speed is 180 r / min, the culture temperature is 28℃, and the culture time is 13 days.

[0032] 2. Biological characteristics of the strain: The engineered strain, when cultured on PDA medium at 28°C for approximately 3-5 days, can completely cover a 9 cm diameter Petri dish. Colonies are fluffy, with dense, white hyphae and a milky-white to pale yellow surface. Conidiophores are spherical, with short, thick conidiophores that enlarge at the apex; conidia are spherical to elliptical with a rough surface. This engineered strain is genetically stable, and its ability to synthesize calcarisarbulide A does not significantly decrease after multiple generations.

[0033] 3. The application of engineered strain XM360 in the synthesis of calcarisarbulide A includes the following steps: (1) Activation of the strain: The engineered strain XM360 was inoculated onto potato dextrose agar (PDA) and cultured at 28°C for 3-5 days until it covered a 9 cm diameter plate. The colonies were fluffy, with dense white hyphae and a milky white to pale yellow surface. The conidiophores were spherical, the conidiophores were short and thick with enlarged tips, and the conidia were spherical to elliptical with a rough surface. This engineered strain was genetically stable, and its ability to synthesize calcarisarbulide A did not decrease significantly after multiple generations.

[0034] (2) Preparation of fermentation medium: Czapek's liquid medium CD, with 100 mM of ʟ-aspartate sodium salt added, natural pH, autoclaved at 121℃ for 20 min to obtain liquid medium; (3) Shake flask fermentation culture: pick out the bacterial blocks from the plate culture in step (1), inoculate them into the liquid culture medium obtained in step (2), and ferment them at 28℃ and 180 rpm for 13 days. A large amount of calcarisarbulide A accumulates in the fermentation broth. (4) Product detection: After fermentation, 100 μL of the supernatant of the fermentation broth was taken, and an equal volume of methanol was added and mixed. After filtration through a 0.22 μm filter membrane, the product was detected by HPLC to analyze the formation and yield of calcarisarbulide A.

[0035] Fermentation using the engineered strain of the present invention yields approximately 2755.7 mg of calcarisarbulide A per liter of fermentation broth.

[0036] The engineered strain constructed in this invention was used for fermentation culture. Under the fermentation conditions described in this embodiment, the yield of calcarisarbulide A reached approximately 2755.7 mg / L. Previous studies have reported a fermentation titer of approximately 34.48 mg / L for calcarisarbulide A (Cheng, Jin-Tao, et al. "Discovery of a potential liver fibrosis inhibitor from a mushroom endophytic fungus by genome mining of asilent biosynthetic gene cluster." Journal of agricultural and foodchemistry. 2021 69(38): 11303-11310.). The calcarisarbulide A yield obtained by the engineered strain of this invention is significantly higher than the levels reported in the literature above, indicating that the heterologous expression system constructed in this invention has good product synthesis capabilities and industrial application potential. (e.g.) Figure 3 ).

[0037] The above specific embodiments are used to explain and illustrate the present invention, but not to limit the present invention. Any modifications and changes made to the present invention within the spirit and scope of the claims shall fall within the protection scope of the present invention.

[0038] The above description is only a preferred embodiment of the present invention. Therefore, all equivalent changes or modifications made to the structure, features and principles described in the claims of this patent application are included in the scope of this patent application.

[0039] The gene sequence involved in this invention is: SEQ ID No.1; Name: Primer calI-1-F DNA type: other DNA Biological origin: synthetic construct ATGACGAAAAACGACATCGTCG SEQ ID No.2; Name: Primer calI-1-R DNA type: other DNA Biological origin: synthetic construct ATAGCCGTCAGCGTAGCGAG SEQ ID No. 3; Name: Primers npgA-F DNA type: other DNA Biological origin: synthetic construct AGCGCTAAGCTGATATAG SEQ ID No.4; Name: Primer npgA-R DNA type: other DNA Biological origin: synthetic construct ATGGTGCAAGACACATCAAG.

Claims

1. A strain of Aspergillus oryzae, characterized in that: The Aspergillus strain is Aspergillus oryzae. Aspergillus oryzae XM360 is held in the collection of CGMCC, with accession number CGMCC NO: 42352, and the accession date is December 9, 2025.

2. The application of the Aspergillus oryzae strain according to claim 1, characterized in that: The Aspergillus oryzae strain carries a free plasmid that replicates within Aspergillus oryzae, and the plasmid contains a promoter. ANIA_ 01036p Driven calI Gene expression cassettes and promoters tef1p Driven npgA The gene expression cassette enables the strain to synthesize calcarisarbulide A through expression mediated by a free plasmid.

3. The application of the Aspergillus oryzae strain according to claim 1, characterized in that: Application in the fermentation synthesis of calcarisarbulide A.

4. The method for preparing and constructing a strain of Aspergillus oryzae according to claim 1, characterized in that: The method includes the following steps: (1) Activation of the starting strain: The starting strain is Aspergillus oryzae. Aspergillus oryzae RIB40 ΔpyrG Aspergillus oryzae Aspergillus oryzae RIB40 ΔpyrG The strain was inoculated onto PDA solid medium plates containing 10 mM uracil and 5 mM uridine and cultured for activation treatment; (2) Construction calI and npgA Gene expression module: The backbone gene was obtained by extracting and amplifying DNA from *Aspergillus nidus* and *Aspergillus nidus*, respectively. calI and npgA Genes, and then separately constructed to obtain calI Expression box and npgA The expression frame is then reconstructed to obtain a recombinant expression vector. (3) Obtaining engineered strains: The recombinant expression vector pFC902- was transformed using a protoplast transformation method. gpdAp-afoA-1036p-calI-tef1p- npgA The Aspergillus oryzae obtained in step (1) is introduced into a free, non-genomically integrated form to drive the target gene. calI and npgA Expression; the plasmid carries the uridine / uracil synthesis gene. pyrG Positive transformants that have undergone plasmid recombinant synthesis regain the ability to synthesize uridine / uracil and can grow on PDA plates without the addition of uracil and uridine. After obtaining positive transformants carrying the target gene plasmid through uridine / uracil auxotrophic screening, single colonies were obtained by streaking on PDA solid medium plates. These single colonies were then picked and further streaked for repeated purification to obtain the engineered strain, which is the *Aspergillus oryzae* strain. Aspergillus oryzae XM360.

5. The preparation and construction method according to claim 4, characterized in that: Aspergillus oryzae Aspergillus oryzae RIB40 ΔpyrG It is by Aspergillus oryzae Knockout of RIB40 strain pyrG Gene acquisition.

6. The preparation and construction method according to claim 4, characterized in that: The specific step (1) involves applying Aspergillus oryzae to the mold. Aspergillus oryzae RIB40 ΔpyrG The strain was inoculated onto PDA solid medium plates containing 10 mM uracil and 5 mM uridine and cultured at 28°C for 3-5 days until the spores filled the plate.

7. The preparation and construction method according to claim 4, characterized in that: Step (2) specifically involves: (21) with *Gnaphalium argentea* Calcisporium arbuscula Using genomic DNA as a template, PCR amplification was performed using primers calI-1-F and calI-1-R to obtain... cal Skeletal genes in gene clusters calI ; The skeletal gene calI Connected to the source afo promoters of gene clusters ANIA_01036p fungal universal terminator trpCt Between, build calI Expression box; (22) Aspergillus nidulans Aspergillus nidulans Using genomic DNA as a template, PCR amplification was performed using primers npgA-F and npgA-R to obtain... npgA Genes; the aforementioned npgA Genes are linked to constitutive strong promoters tef1p Under control, build npgA Expression box; (23) Using a seamless cloning method, the aforementioned calI Expression box and npgA The expression frame is sequentially assembled onto the expression vector pFC902, and simultaneously, a compound is introduced into the vector. gpdAp Promoter-driven transcriptional regulators afoA The expression module is used to obtain the recombinant expression vector pFC902- gpdAp-afoA-1036p-calI-tef1p-npgA .

8. The preparation and construction method according to claim 7, characterized in that: The primers calI-1-F and calI-1-R are SEQ ID No. 1 and SEQ ID No. 2, respectively, which are 5'-ATGACGAAAAACGACATCGTCG-3' and 5'-ATAGCCGTCAGCGTAGCGAG-3'; The primers npgA-F and npgA-R are SEQ ID No. 33 and SEQ ID No. 4, respectively, which are 5'-AGCGCTAAGCTGATATAG-3' and 5'-ATGGTGCAAGACACATCAAG-3'.

9. The method for fermenting and synthesizing calcarisarbulide A from a strain of Aspergillus oryzae according to claim 1, characterized in that: The method includes the following steps: S1. Activation of the bacterial strain: The Aspergillus oryzae... Aspergillus oryzae XM360 was inoculated onto potato glucose culture PDA and cultured at 28°C for 3-5 days to obtain plate cultures. S2. Preparation of fermentation medium: Czapek's liquid medium CD, with 100 mM of ʟ-aspartate sodium salt added, natural pH, autoclaved at 121℃ for 20 min to obtain liquid medium. S3, Shake-flask fermentation culture: The plate culture from step S1 and the liquid culture medium from step S2 are mixed and fermented. S4. Product detection: After fermentation, take 100 μL of the supernatant of the fermentation broth, add an equal volume of methanol and mix well. After filtration through a 0.22 μm filter membrane, perform HPLC detection to analyze the formation and yield of calcarisarbulide A.

10. The method for fermentation synthesis of calcarisarbulide A according to claim 9, characterized in that: Specifically, step S3 involves picking bacterial blocks from the plate culture of step S1, inoculating them into the liquid culture medium obtained in step S2, and fermenting them at 28°C and 180 rpm for 13 days to accumulate calcarisarbulide A in the fermentation broth.

Images