Bacterial alginate engineering bacteria, preparation method and high-efficiency alginate production method

Abstract

This invention provides a method for preparing alginate-engineered bacteria, specifically including the following steps: Step 1, retrieving alginate synthesis-related coding genes from the NCBI gene database. algG , algX , all The gene sequence, in which algG The gene sequence of algX is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:4. The gene sequence of algX is shown in SEQ ID NO:2, and the amino acid sequence is shown in SEQ ID NO:5. all The gene sequence is shown in SEQ ID NO:3, and the amino acid sequence is shown in SEQ ID NO:6; Step 2: Construct a gene... algG , algX , all Recombinant expression vector pBBR algae Step 3: The recombinant expression vector... pBBR algae Transformed into *Pseudomonas putida* to obtain pBBR algae Recombinant engineered bacteria.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to an alginate engineered bacterium, its preparation method, and a method for efficient production of bacterial alginate. Background Technology

[0002] Alginate is a natural polysaccharide widely used in the food, pharmaceutical, and environmental fields due to its efficient gelling ability. Its excellent biocompatibility and biodegradability further expand its applications in the biomedical field. However, since alginate is derived from algae, the inconsistency in its molecular weight and composition may limit its application performance. Therefore, the production of microbial alginate (MA) has attracted much attention because microorganisms have the potential to synthesize alginate molecules with stable properties. Microorganisms can synthesize alginate with specific chain lengths and molecular compositions, thus avoiding potential problems associated with alginate extracted from brown algae, such as lower purity and product consistency. *Pseudomonas* and *Azoobacterium* are efficient MA-producing strains, sharing similar core pathways and metabolic mechanisms for MA synthesis. However, differences in intracellular modification mechanisms result in each strain producing MA with unique structures and properties. Although microbial alginate production is costly and inefficient, advancements in genetic engineering have made it possible to construct engineered MA biosynthetic bacteria, becoming a significant driving force for technological innovation. Through genetic engineering, strains with specific functions can be constructed, exhibiting stronger environmental adaptability, higher MA production efficiency, and lower ecological risks. Genetic engineering technology is seen as a promising alternative to pure alginate, which can reduce the cost of alginate production and broaden the application prospects of alginate.

[0003] Biofilm technology is a highly efficient and energy-saving biological technology for wastewater treatment, boasting advantages such as high purification efficiency, rich microbial diversity, large surface area, low sludge bulking, and low operating costs. It is widely used in wastewater treatment in agriculture, industry, and urban areas. However, biofilm formation has always been a key concern in biofilm-based wastewater treatment. Research shows that the production of bacterial extracellular polymeric substances (EPS) is closely related to biofilm growth and community structure. Scientists have found that 90% of biofilms contain EPS, which is mainly composed of biofilm macromolecules such as proteins, polysaccharides, and nucleic acids. Therefore, constructing engineered bacteria that efficiently produce alginate can help accelerate the initial formation of biofilms in urban and industrial wastewater and significantly increase biofilm thickness and density.

[0004] To date, numerous methods have been studied to enhance the water treatment performance of biofilm reactors. Typical enhancement methods include optimizing process conditions, adding exogenous promoters, and inoculating functional bacteria. Extracellular polysaccharides (AHLs) possess diverse functions and, as major components of biofilms, play a crucial role in bacterial survival. Exogenous addition of alginate can promote biofilm formation and structural stability, thereby improving the water treatment performance of biofilm processes. However, the purification and extraction processes of naturally occurring microbial alginates are complex, and obtaining pure products is difficult, making large-scale application of exogenous AHLs to promote biofilm formation impractical and limiting the commercial development of exogenous microbial alginates. Summary of the Invention

[0005] The main objective of this invention is to provide an alginate engineered bacterium, a preparation method, and an efficient alginate production method, which can efficiently produce alginate.

[0006] To achieve the above objectives, the technical solution adopted by this invention is: a method for preparing alginate engineered bacteria, specifically including the following steps: Step 1: Retrieve alginate synthesis-related coding genes from the NCBI gene database. algG , algX , algL The gene sequence, in which algG The gene sequence of algX is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:4. The gene sequence of algX is shown in SEQ ID NO:2, and the amino acid sequence is shown in SEQ ID NO:5. algL The gene sequence is shown in SEQ ID NO:3, and the amino acid sequence is shown in SEQ ID NO:6. Step 2: Construct a gene-containing structure algG , algX , algL Recombinant expression vector pBBR-alg ; Step 3: The recombinant expression vector pBBR-alg Transformed into *Pseudomonas putida* to obtain pBBR-alg Recombinant engineered bacteria.

[0007] Preferably, step two specifically includes the following steps: Step 21: Using the genomic DNA of Pseudomonas aeruginosa as a template, [the following steps are performed]. algG , algX , algL The gene fragment was amplified and purified by PCR. The PCR primer sequences are as follows: F-alg: CTCTAGAACTAGT GGATCCCCATGCCCGACATTTCCCTTTCGATCCC, R-alg:TCGACGGTATCGAT AAGCTT GACTTCCCCCTTCGCGGCTGAA, The underlined areas represent the BamH I and Hind III restriction sites, respectively. Step 22: The expression vector pBBR1-MCS2 was double-digested with restriction endonucleases BamHⅠ and HindⅢ, and the vector backbone was recovered. Step 23: The product obtained in Step 23 is ligated to the vector backbone from Step 24 using a seamless cloning method to obtain the recombinant expression vector. pBBR-alg .

[0008] Preferably, step three specifically includes the following steps: Step 31: Insert the recombinant expression vector pBBR-alg The cells were transferred into competent E. coli cells and cultured for a period of time. Step 32: Extract the recombinant expression vector from the cultured E. coli. pBBR-alg, Gene sequencing was performed, and the correctly validated recombinant expression vectors were preserved. pBBR-alg ; Step 33: The recombinant expression vector obtained in step 32 pBBR-alg The bacteria were transferred into competent cells of *Pseudomonas putida* and cultured for a period of time to obtain activated recombinant engineered bacteria. Step 35: Take an appropriate amount of the activated recombinant engineered bacterial culture and culture it for a period of time. Pick positive single clones for plasmid sequencing. The correct recombinant engineered bacteria are the alginate recombinant engineered bacteria, named *Pseudomonas putida*. pBBR-alg .

[0009] The present invention also provides an alginate recombinant engineered bacterium, prepared using the above method.

[0010] This invention also provides a method for preparing alginate, specifically comprising the following steps: Step 1) Prepare the nutrient culture medium; Step 2) Autoclave the nutrient culture medium and then transfer it to a shake flask; Step 3) Inoculate the alginate recombinant engineered bacteria in a shake flask and culture for a period of time, then add a certain amount of IPTG and α-lactose to induce fermentation for a period of time; Step 4) The product from Step 3) is centrifuged and filtered to obtain a sterile supernatant culture medium. The alginate engineered bacteria precipitate is reused for the next alginate production. The concentration of alginate in the sterile supernatant culture medium is determined by a modified carbazole colorimetric method. Step 5) Add a certain amount of Na2CO3 solution to the sterile supernatant culture medium obtained in Step 4) and digest it. Adjust the pH of the digested mixture to 6-7, then add a certain amount of calcium chloride to perform calcium precipitation. After centrifugation, obtain the precipitate and wash the precipitate multiple times. Step 6) Place the precipitate obtained in Step 5) into a certain amount of NaCl solution, then add a certain amount of sodium-type cation exchange resin to the NaCl solution, stir continuously to carry out ion exchange decalcification, and finally centrifuge to obtain a bacterial sodium alginate solution. Step 7) Add a certain amount of anhydrous ethanol to the bacterial sodium alginate solution obtained in Step 6), and centrifuge to obtain a flocculent precipitate. After drying the flocculent precipitate, the desired alginate solid can be obtained.

[0011] Compared with the prior art, the present invention has the following beneficial effects: Compared with the prior art, the beneficial effects of the present invention are as follows: 1) The recombinant expression vector pBBR-alg constructed in this invention can efficiently express three key genes for alginate synthesis, algG, algX, and algL, in *Pseudomonas putida*. The three enzymes work synergistically to significantly improve the alginate synthesis efficiency of the engineered bacteria, increasing alginate yield by more than 50%. 2) The alginate extraction and purification process developed in this invention abandons the traditional strong acid and strong alkali treatment. It adopts a combination of Na2CO3 room temperature digestion, calcium precipitation, ion exchange decalcification and alcohol precipitation, which avoids the degradation of alginate molecules. The resulting product has good stability, high viscosity and purity of over 95%. At the same time, calcium chloride and sodium cation exchange resin can be recycled, further reducing extraction costs and eliminating the discharge of harmful waste liquid, which meets environmental protection requirements. Attached Figure Description

[0012] Figure 1 This describes the preparation process of the engineered bacteria of the present invention; Figure 2 It is an alginate-C5-mannan isomerase ( algG Three-dimensional structure; Figure 3 It is alginate synthase ( algX Three-dimensional structure; Figure 4 It is an alginate lyase ( algL Three-dimensional structure. Detailed Implementation

[0013] The following description is intended to disclose the invention and enable those skilled in the art to implement it. The preferred embodiments described below are merely examples, and other obvious variations will occur to those skilled in the art.

[0014] Example 1 A method for preparing alginate-engineered bacteria, specifically including the following steps: Step 1: Retrieve alginate synthesis-related coding genes from the NCBI gene database. algG , algX , algL The gene sequence, in which algG The gene sequence of algX is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:4. The gene sequence of algX is shown in SEQ ID NO:2, and the amino acid sequence is shown in SEQ ID NO:5. algL The gene sequence is shown in SEQ ID NO:3, and the amino acid sequence is shown in SEQ ID NO:6. Step 2: Construct a gene-containing structure algG , algX , algL Recombinant expression vector pBBR-alg ; Step 3: The recombinant expression vector pBBR-alg Transformed into *Pseudomonas putida* to obtain pBBR-alg Recombinant engineered bacteria.

[0015] Step two specifically includes the following steps: Step 21: Cultivate Pseudomonas aeruginosa: Inoculate Pseudomonas aeruginosa into ordinary LB medium and incubate overnight at 37°C; Step 22: Collect Pseudomonas aeruginosa by centrifugation from the culture medium obtained in Step 21; Step 23: Using the collected genomic DNA of *Pseudomonas aeruginosa* as a template, [the following steps are performed]. algG , algX , algL The gene fragment was amplified and purified by PCR. The PCR primer sequences are as follows: F-alg: CTCTAGAACTAGT GGATCC CCATGCCCGACATTTCCCTTTCGATCCC, R-alg:TCGACGGTATCGAT AAGCTT GACTTCCCCCTTCGCGGCTGAA, The underlined areas represent the BamH I and Hind III restriction sites, respectively. The PCR amplification program in step 23 is as follows: 95℃ pre-denaturation, 3 min, set 35 cycles: 95℃ denaturation, 45 s, 59℃ annealing, 90 s, 72℃ extension, 150 s, and finally 72℃ extension for 15 min, then end the program.

[0016] Step 24: The expression vector pBBR1-MCS2 was double-digested with restriction endonucleases BamHⅠ and HindⅢ, and the vector backbone was recovered. Step 25: The product obtained in Step 23 is ligated to the vector backbone from Step 24 using a seamless cloning method to obtain the recombinant expression vector. pBBR-alg .

[0017] Step three specifically includes the following steps: Step 31: Take 100 μL of competent E. coli cells ( DH5α Dissolve on ice and add 10 μL of recombinant expression vector. pBBR-alg Mix gently, let stand on ice for 30 min, then incubate in a 42°C water bath for 90 s, then immediately let stand on ice for 3 min, then add 800 μL of sterile SOC culture medium and activate by shaking at 120 rpm in a 37°C incubator for 1 h. Step 32: Take an appropriate amount of the activated recombinant bacterial solution and spread it onto a substrate containing X-Gal (20 mg / mL). -1 ), Kan (30mg / mL) -1 Incubate in solid LB medium containing 0.1 mM IPTG and 0.1 mM at 37°C for 24 h, then pick positive single colonies (white plaques) for further culture. Step 33: Extract the recombinant expression vector from the cultured E. coli. pBBR-alg, Gene sequencing was performed, and the correctly validated recombinant expression vectors were preserved. pBBR-alg ; Step 34: Dissolve 100 μL of competent *Pseudomonas putida* cells on ice, and add 10 μL of the recombinant expression vector obtained in step 33. pBBR-alg Gently mix, let stand on ice for 30 min, then incubate in a 42℃ water bath for 90 s, then immediately let stand on ice for 3 min, then add 800 μL of sterile SOC culture medium and activate by shaking at 120 rpm in a 37℃ incubator for 1 h to obtain the activated recombinant engineered bacteria; The competent cells of *Pseudomonas putida* were prepared using the CaCl2 method.

[0018] Step 35: Take an appropriate amount of the activated recombinant engineered bacterial solution and spread it onto a substrate containing X-Gal (20 mg / mL). -1 ), Kan (30mg / mL) -1 In a solid LB medium containing 0.1 mM IPTG and 0.1 mM, the bacteria were cultured at 37°C for 24 h. Positive single clones (white plaques) were picked for plasmid sequencing. The correctly verified recombinant engineered bacteria were identified as alginate recombinant engineered bacteria and named *Pseudomonas putida*. pBBR-alg .

[0019] Example 2 This embodiment describes a method for preparing microbially synthesized alginate (MA) using the alginate-engineered bacteria obtained in Example 1, specifically including the following steps: Step 1) Prepare the nutrient culture medium using distilled water: The main components of the culture medium include (g / L): peptone (5.0), beef extract (5.0), yeast extract (5.0), glucose (5.0), sucrose (5.0), magnesium sulfate (2.0), dipotassium hydrogen phosphate (2.0), diammonium hydrogen citrate (2.0), Kan (0.1mM), sodium chloride (5.0), D-mannuronic acid (5.0), fructose-6-phosphate (5.0); Step 2) Autoclave the culture medium and then transfer it to a shake flask; Step 3) Inoculate with alginate engineered bacteria and culture in a shake flask at 37℃ and 120 rpm for 24 h. Then add IPTG (0.2 mM) and α-lactose (5.0 g / L) and induce fermentation at 25℃ and 120 rpm for 24 h. Step 4) The product from Step 3) is centrifuged and filtered to obtain a sterile supernatant culture medium. The alginate engineered bacteria precipitate is used for MA production. The alginate concentration in the sterile supernatant culture medium is determined by a modified carbazole colorimetric method. Step 5) Add 0.1 mol / L Na2CO3 solution to the sterile supernatant culture medium obtained in Step 4) and digest at 25℃ for 6-8 h. Adjust the pH of the digested mixture to 6-7, then add 10% ω% calcium chloride for calcium precipitation. After centrifugation, MA precipitate is obtained, and the obtained MA precipitate is washed multiple times. Step 6) Place the 1g MA precipitate obtained in Step 5) into 100mL of NaCl (10%, ω) solution, then add 20g of sodium cation exchange resin to the NaCl solution, stir continuously to carry out ion exchange decalcification, and finally centrifuge at 10000rpm to obtain bacterial sodium alginate solution. Step 7) Add 100 mL of anhydrous ethanol to the bacterial sodium alginate solution from Step 6), and centrifuge at 10,000 rpm to obtain a flocculent precipitate. Dry the flocculent precipitate at 65°C to obtain the desired MA solid.

[0020] Experimental Example 1 The purpose of this experiment was to verify the fermentation performance of the recombinant engineered strain Pseudomonas putida pBBR-alg under a specific nutrient medium, and the feasibility of using a Na2CO3 digestion-calcification-ion exchange process to extract high-purity alginate.

[0021] Experimental materials Bacterial strain: Pseudomonas putida pBBR-alg (constructed from Example 1).

[0022] Culture medium: Nutrient medium (prepared according to the document: peptone 5.0 g / L, beef extract 5.0 g / L, yeast extract 5.0 g / L, glucose 5.0 g / L, sucrose 5.0 g / L, magnesium sulfate 2.0 g / L, dipotassium hydrogen phosphate 2.0 g / L, diammonium hydrogen citrate 2.0 g / L, sodium chloride 5.0 g / L, D-mannuronic acid 5.0 g / L, fructose-6-phosphate 5.0 g / L), add 0.1 mM Kan before sterilization.

[0023] Reagents: IPTG (0.2 mM), α-lactose (5.0 g / L), 0.1 mol / L Na2CO3 solution, 10% (w / v) calcium chloride solution, 10% (w / v) NaCl solution, sodium cation exchange resin, anhydrous ethanol.

[0024] Experimental steps Fermentation culture: Activated *Pseudomonas putida* pBBR-alg was inoculated into a 1 L shake flask containing 500 mL of nutrient medium. The mixture was incubated at 37°C and 120 rpm with shaking for 24 hours. Induction of expression: IPTG was added to the culture medium to a final concentration of 0.2 mM and α-lactose to a final concentration of 5.0 g / L. The temperature was adjusted to 25℃, and fermentation was continued at 120 rpm for 24 hours. Separation and collection: After induction, the fermentation broth was centrifuged at 4℃ and 8000 rpm for 20 minutes to separate sterile supernatant and bacterial precipitate. The concentration of alginate in the supernatant was determined to be 4.15 g / L. Digestion and Calcification: 1) Add 0.1 mol / L Na2CO3 solution to the sterile supernatant and digest at 25℃ for 7 hours; 2) After digestion, adjust the pH of the mixture to 6.5 precisely using 1 M HCl.

[0025] 3) Add 10% (w / v) calcium chloride solution to the system to carry out the calcium precipitation reaction. After the reaction is complete, centrifuge at 4000 rpm for 15 minutes to collect the calcium alginate precipitate. Wash the precipitate three times with deionized water.

[0026] Ion exchange decalcification: 1) Place the washed calcium alginate precipitate (approximately 2.5 g) into 250 mL of 10% (w / v) NaCl solution; 2) Add 50 g of sodium-type cation exchange resin and stir continuously at room temperature for 2 hours to carry out ion exchange decalcification; 3) After the exchange is completed, centrifuge at 10,000 rpm for 10 minutes to obtain a bacterial sodium alginate solution.

[0027] Precipitation and drying: 1) Add 250 mL of anhydrous ethanol to the bacterial sodium alginate solution; 2) Centrifuge at 10,000 rpm for 10 minutes and collect the flocculent precipitate; 3) The precipitate was dried in an oven at 65°C until constant weight was obtained to obtain alginate solid powder.

[0028] Experimental results: 1) Yield and recovery rate: The final yield of alginate solids was 2.18 g; based on 500 mL of supernatant, the theoretical yield of the fermentation broth was calculated to be approximately 2.08 g, and the actual extraction recovery rate was 94.3%.

[0029] 2) Product purity: HPLC analysis showed that the alginate purity of the obtained product was 96.8% and the ash content was 0.78%.

[0030] 3) Physicochemical properties: The product appears as a white to off-white fibrous powder, and its viscosity as a 1% aqueous solution at 25°C is 980 mPa·s.

[0031] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention. The scope of protection claimed by the appended claims and their equivalents is defined.

Claims

1. A method for preparing alginate-engineered bacteria, characterized in that, Specifically, the steps include the following: Step 1: Retrieve alginate synthesis-related coding genes from the NCBI gene database. algG , algX , algL The gene sequence, in which algG The gene sequence of algX is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:

4. The gene sequence of algX is shown in SEQ ID NO:2, and the amino acid sequence is shown in SEQ ID NO:

5. algL The gene sequence is shown in SEQ ID NO:3, and the amino acid sequence is shown in SEQ ID NO:

6. Step 2: Construct a gene-containing structure algG , algX , algL Recombinant expression vector pBBR-alg ; Step 3: The recombinant expression vector pBBR-alg Transformed into *Pseudomonas putida* to obtain pBBR-alg Recombinant engineered bacteria.

2. The method for preparing an alginate engineered bacterium according to claim 1, characterized in that, Step two specifically includes the following steps: Step 21: Using the genomic DNA of Pseudomonas aeruginosa as a template, [the following steps are performed]. algG , algX , algL The gene fragment was amplified and purified by PCR. The PCR primer sequences are as follows: F-alg:CTCTAGAACTAGT GGATCC CCATGCCCGACATTTCCCTTTCGATCCC, R-alg: TCGACGGTATCGAT AAGCTT GACTTCCCCCTTCGCGGCTGAA , The underlined areas represent the BamH I and Hind III restriction sites, respectively. Step 22: The expression vector pBBR1-MCS2 was double-digested with restriction endonucleases BamHⅠ and HindⅢ, and the vector backbone was recovered. Step 23: The product obtained in Step 23 is ligated to the vector backbone from Step 24 using a seamless cloning method to obtain the recombinant expression vector. pBBR-alg .

3. The method for preparing an alginate engineered bacterium according to claim 1, characterized in that, Step three specifically includes the following steps: Step 31: Insert the recombinant expression vector pBBR-alg The cells were transferred into competent E. coli cells and cultured for a period of time. Step 32: Extract the recombinant expression vector from the cultured E. coli. pBBR-alg, Gene sequencing was performed, and the correctly validated recombinant expression vectors were preserved. pBBR-alg ; Step 33: The recombinant expression vector obtained in step 32 pBBR-alg The bacteria were transferred into competent cells of *Pseudomonas putida* and cultured for a period of time to obtain activated recombinant engineered bacteria. Step 35: Take an appropriate amount of the activated recombinant engineered bacterial culture and culture it for a period of time. Pick positive single clones for plasmid sequencing. The correct recombinant engineered bacteria are the alginate recombinant engineered bacteria, named *Pseudomonas putida*. pBBR-alg .

4. An alginate recombinant engineered bacterium, prepared using the preparation method of an alginate engineered bacterium as described in any one of claims 1-3.

5. A method for preparing alginate, specifically comprising the following steps: Step 1) Prepare the nutrient culture medium; Step 2) Autoclave the nutrient culture medium and then transfer it to a shake flask; Step 3) Inoculate the alginate recombinant engineered bacteria of claim 4 in a shake flask and culture for a period of time, then add a certain amount of IPTG and α-lactose to induce fermentation for a period of time; Step 4) The product from Step 3) is centrifuged and filtered to obtain a sterile supernatant culture medium. The alginate engineered bacteria precipitate is reused for the next alginate production. The concentration of alginate in the sterile supernatant culture medium is determined by a modified carbazole colorimetric method. Step 5) Add a certain amount of Na2CO3 solution to the sterile supernatant culture medium obtained in Step 4) and digest it. Adjust the pH of the digested mixture to 6-7, then add a certain amount of calcium chloride to perform calcium precipitation. After centrifugation, obtain the precipitate and wash the precipitate multiple times. Step 6) Place the precipitate obtained in Step 5) into a certain amount of NaCl solution, then add a certain amount of sodium-type cation exchange resin to the NaCl solution, stir continuously to carry out ion exchange decalcification, and finally centrifuge to obtain a bacterial sodium alginate solution. Step 7) Add a certain amount of anhydrous ethanol to the bacterial sodium alginate solution obtained in Step 6), and centrifuge to obtain a flocculent precipitate. After drying the flocculent precipitate, the desired alginate solid can be obtained.

Images