Recombinant oncolytic influenza virus expressing interleukin 2 and applications thereof

Abstract

This invention discloses a recombinant oncolytic influenza virus expressing interleukin-2 and its applications, relating to the field of biomedical technology. The recombinant oncolytic influenza virus is an influenza virus expressing the IL-2 protein, whose PB2 gene has been modified into a recombinant gene PB2-IL-2; the amino acid sequence of the IL-2 protein is shown in SEQ ID NO: 1; the nucleotide sequence of the recombinant gene PB2-IL-2 is shown in SEQ ID NO: 2. The recombinant influenza virus can activate T cells and NK cells, and promote the infiltration of activated T cells into tumor tissue, improving the tumor immune microenvironment, thereby enhancing the anti-tumor therapeutic effect. The anti-tumor treatment of the recombinant influenza virus can be used for various tumors such as colorectal cancer and melanoma. The recombinant oncolytic influenza virus provided by this invention can selectively infect and kill tumor cells, exhibiting good oncolytic effects and can be used for tumor treatment.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and more specifically to the preparation of recombinant oncolytic influenza virus expressing interleukin-2 and its application in tumor treatment. Background Technology

[0002] Cancer is a malignant disease caused by abnormal cell proliferation, characterized by rapid onset, severe symptoms, long treatment cycles, and difficulty in cure, seriously threatening life and health. In recent years, with the increasing global population aging and rising cancer risk factors, it has become a global public health issue. Cancer immunotherapy has become a research hotspot in anti-tumor treatment in recent years. Compared with traditional surgery, radiotherapy, chemotherapy, and targeted therapy, its advantages are not only in overcoming traditional drug resistance but also in achieving significant breakthroughs in the treatment of solid tumors. Cancer immunotherapy reactivates the body's immune system through active or passive means, altering the immunosuppressive tumor microenvironment, thereby improving anti-tumor efficacy. Currently, cancer immunotherapy mainly includes immune checkpoint inhibitors, adoptive cells, cytokine therapy, tumor vaccines, and oncolytic virus therapy. Among these, oncolytic viruses have unique advantages compared to other treatment options and have become a research hotspot in the field of cancer immunotherapy.

[0003] Oncolytic viruses are a class of natural or genetically engineered viruses that selectively infect and lyse tumor cells, thereby activating the body's anti-tumor immune response while minimizing damage to normal tissue cells. Currently, commonly used oncolytic viruses include more than 10 viruses such as adenovirus, herpes simplex virus, vaccinia virus, vesicular stomatitis virus, reovirus, poliovirus, influenza virus, and Newcastle disease virus. Among them, influenza virus is an enveloped, single-stranded, segmented RNA virus whose tumor targeting is associated with defects in the interferon signaling pathway and abnormal activation of the Raf / MEK / ERK pathway in tumor cells. As one of the earliest viruses used in cancer treatment, influenza virus has advantages such as simple structure, well-understood viral replication mechanism, and no risk of viral gene integration into the host genome. These characteristics allow for the modification of novel viruses with higher oncolytic efficacy and fewer side effects. The oncolytic mechanism of influenza virus mainly includes three aspects: First, it possesses direct oncolysis, targeting and lysing tumor cells. Second, it can induce immunogenic cell death (ICD), exhibiting immunomodulatory capabilities. After lysing tumor cells, influenza virus releases a large number of tumor-associated antigens, pathogen-associated molecular patterns (such as viral nucleic acids, proteins, and capsid components), and danger signaling molecules (such as calreticulin, high-mobility group 1, and ATP), recruiting antigen-presenting cells to the tumor cell death site. Mature dendritic cells (DCs) recognize tumor antigens through pattern recognition receptors and process and present them to T cells, promoting T cell activation. Activated T cells migrate and infiltrate tumor tissue, thereby recognizing and killing tumor cells and inhibiting tumor growth. Simultaneously, it can induce the production of T lymphocytes with an immune memory phenotype, possessing long-term and systemic anti-tumor functions. Finally, it can express exogenous immunomodulatory genes, thereby synergistically enhancing the anti-tumor immune response. Using genetic engineering and reverse genetics techniques, exogenous immunomodulatory genes (such as cytokines, chemokines, tumor-associated antigens, and immune checkpoint inhibitors) can be inserted and expressed into the influenza virus genome, thereby constructing recombinant influenza viruses. These recombinant influenza viruses can express exogenous genes within host cells, recruiting and activating immune cells such as dendritic cells (DCs), NK cells, CD4+ cells, and CD8+ T cells to infiltrate the tumor microenvironment, thereby synergistically enhancing oncolytic effects.

[0004] A / Puerto Rico / 8 / 1934 (H1N1), as one of the earliest influenza A viruses used in influenza vaccine development, has been widely used by various countries as a backbone strain for preparing inactivated influenza vaccines due to its high adaptability to chicken embryos. Therefore, it can also serve as a vector suitable for oncolytic viruses in research on tumor immunotherapy.

[0005] Interleukin-2 (IL-2), the first cytokine used in cancer treatment, is mainly secreted by activated CD4+ T cells and a small number of CD8+ T cells. It possesses a wide range of biological activities, including promoting the proliferation and differentiation of activated T cells and participating in maintaining immune homeostasis. IL-2 exerts its function by binding to the IL-2 receptor (IL-2R) on the cell surface and activating downstream signaling pathways. IL-2R is composed of three subunits: α (CD25), β (CD122), and γ (CD132), which can form receptor forms with different affinities: low-affinity IL-2Rα, medium-affinity IL-2Rβγ, and high-affinity IL-2Rαβγ. The affinity of IL-2 for the trimer IL-2Rαβγ is approximately 100 times higher than that for IL-2Rβγ. Within the tumor microenvironment, IL-2 exerts multiple anti-tumor effects through the IL-2 / IL-2R biological axis: First, it activates and promotes the expansion of cytotoxic CD8+ T cells and NK cells, enhancing their ability to kill tumor cells; second, it promotes the generation of immune memory T cells to maintain durable anti-tumor immunity; and third, it can induce immune cells to secrete key cytokines such as interferon-γ (IFN-γ), indirectly inhibiting tumor angiogenesis and directly inhibiting tumor cell proliferation, thereby synergistically killing tumor cells. Although oncolytic influenza virus can enhance the immunomodulatory capacity against tumors, it still cannot break through the immunosuppressive microenvironment.

[0006] Therefore, providing an influenza virus that uses IL-2 gene recombination to specifically activate and amplify CD8+ T cells and NK cells, promote the secretion of anti-tumor cytokines, and enhance anti-tumor immune responses is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0007] In view of this, the present invention provides a recombinant oncolytic influenza virus expressing interleukin 2 and its applications.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A recombinant oncolytic influenza virus, wherein the recombinant oncolytic influenza virus is an influenza virus expressing IL-2 protein, and its PB2 gene has been modified into a recombinant gene PB2-IL-2; The amino acid sequence of the IL-2 protein is shown in SEQ ID NO: 1; The nucleotide sequence of the recombinant gene PB2-IL-2 is shown in SEQ ID NO: 2.

[0010] Furthermore, the genome of the recombinant oncolytic influenza virus consists of eight single-stranded, segmented negative-strand RNAs. The negative-strand RNA of the recombinant oncolytic influenza virus is transcribed into a set of positive-strand RNAs complementary to the negative-strand RNAs. The set of positive-strand RNAs includes PB2-IL-2-RNA, PB1-RNA, NP-RNA, HA-RNA, NA-RNA, PA-RNA, M-RNA, and NS-RNA. The PB2-IL-2-RNA is a positive-sense RNA encoding the recombinant gene PB2-IL-2-RNA of claim 1; The PB1-RNA is a positive-sense RNA encoding the PB1 gene in the influenza virus strain. The NP-RNA is a positive-sense RNA encoding the NP gene in the influenza virus strain; The HA-RNA is a positive-sense RNA encoding the HA gene in the influenza virus strain. The NA-RNA is a positive-sense RNA encoding the NA gene in the influenza virus strain; The PA-RNA is a positive-sense RNA encoding the PA gene in the influenza virus strain. The M-RNA is a positive-sense RNA encoding the M gene in the influenza virus strain; The NS-RNA is a positive-sense RNA encoding the NS gene in the influenza virus strain.

[0011] Furthermore, the recombinant gene PB2-IL-2-RNA sequence is obtained by inserting the hydrolyzable linker peptide P2A nucleotide sequence, the IL-2 signal peptide nucleotide sequence, the IL-2 nucleotide sequence, and the PB2 gene 5'NCR terminal packaging signal sequence nucleotide sequence sequentially from 5' to 3' before the stop codon at the 5'NCR end of the PB2 gene in the influenza virus strain, while keeping other nucleotides unchanged. The nucleotide sequence of the hydrolyzable linker peptide P2A is shown as the nucleotide sequence of positions 2305-2370 in SEQ ID NO: 2; The IL-2 signal peptide nucleotide sequence is shown as nucleotides 2371-2430 in SEQ ID NO: 2; The IL-2 nucleotide sequence is shown as nucleotides 2431-2877 in SEQ ID NO: 2; The nucleotide sequence of the 5'NCR end packaging signal sequence of the PB2 gene is shown as nucleotides 2878-2976 in SEQ ID NO: 2; The recombinant gene can be obtained by inserting the IL-2 gene into the influenza virus gene PB2, or by inserting the IL-2 gene into other genes on the influenza virus genome.

[0012] A method for constructing and rescuing recombinant oncolytic influenza virus involves co-introducing a recombinant vector containing a DNA molecule encoding PB2-IL-2-RNA, a recombinant vector containing a DNA molecule encoding PB1-RNA, a recombinant vector containing a DNA molecule encoding NP-RNA, a recombinant vector containing a DNA molecule encoding HA-RNA, a recombinant vector containing a DNA molecule encoding NA-RNA, a recombinant vector containing a DNA molecule encoding PA-RNA, a recombinant vector containing a DNA molecule encoding M-RNA, and a recombinant vector containing a DNA molecule encoding NS-RNA into packaging cells to obtain recombinant oncolytic influenza virus. The vector includes the pHW2000 plasmid.

[0013] A drug for treating colorectal cancer, wherein the active ingredient of the drug is the recombinant oncolytic influenza virus.

[0014] The use of recombinant oncolytic influenza virus as any of the following products, said products including: (1) The genome of the recombinant oncolytic influenza virus; (2) A complete set of vectors for treating tumors, i.e., a vector containing the encoding gene of IL-2; (3) A complete expression cassette for treating tumors, i.e., an expression cassette containing the gene encoding IL-2; (4) A complete set of genes for treating tumors, namely the gene encoding IL-2; (5) A set of proteins for the treatment of tumors, namely the IL-2 protein.

[0015] Recombinant oncolytic influenza virus-related biomaterials, wherein the biomaterials are any of the following products: (1) A set of DNA molecules encoding the set of positive-sense RNAs of the recombinant oncolytic influenza virus; the set of DNA molecules consists of DNA molecules encoding the PB2-IL-2-RNA, DNA molecules encoding the PB1-RNA, DNA molecules encoding the NP-RNA, DNA molecules encoding the HA-RNA, DNA molecules encoding the NA-RNA, DNA molecules encoding the PA-RNA, DNA molecules encoding the M-RNA and DNA molecules encoding the NS-RNA; (2) A set of recombinant vectors; the set of recombinant vectors consists of a recombinant vector containing a DNA molecule encoding the PB2-IL-2-RNA, a recombinant vector containing a DNA molecule encoding the PB1-RNA, a recombinant vector containing a DNA molecule encoding the NP-RNA, a recombinant vector containing a DNA molecule encoding the HA-RNA, a recombinant vector containing a DNA molecule encoding the NA-RNA, a recombinant vector containing a DNA molecule encoding the PA-RNA, a recombinant vector containing a DNA molecule encoding the M-RNA, and a recombinant vector containing a DNA molecule encoding the NS-RNA; (3) Microorganisms containing the recombinant oncolytic influenza virus; (4) Animal cells containing the recombinant oncolytic influenza virus; (5) Animal tissues containing the recombinant oncolytic influenza virus; (6) Animal organs containing the recombinant oncolytic influenza virus; Of the above-mentioned biological materials, the animal cells, animal tissues, and animal organs do not include reproductive materials; In the above-mentioned biological materials, the microorganisms, animal cells, animal tissues, and animal organs can all serve as hosts for recombinant oncolytic viruses.

[0016] The use of recombinant oncolytic influenza virus in the preparation of drugs for treating tumors, wherein the tumors include any one of colorectal cancer, lung cancer, breast cancer, liver cancer, melanoma, lymphoma, leukemia, ovarian cancer, cervical cancer, gastric cancer, kidney cancer, pancreatic cancer, prostate cancer, or glioma.

[0017] Recombinant oncolytic influenza virus, wherein the influenza virus strain includes influenza A virus or influenza B virus.

[0018] As can be seen from the above technical solution, compared with the prior art, the beneficial effects of the present invention are as follows: The recombinant oncolytic influenza virus (rFlu-PB2-IL-2) of this invention can effectively replicate in tumor cells and efficiently express the exogenous IL-2 gene. This recombinant oncolytic influenza virus can inhibit the growth and development of tumors in animals: after treatment of tumor-bearing animals with the recombinant oncolytic influenza virus, tumor growth was significantly inhibited, and even regression occurred, while mouse body weight was not significantly affected. The survival time of mice after treatment was significantly prolonged, indicating that it has good tumor-suppressing effects and safety, and can be used for tumor treatment. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0020] Figure 1 A schematic diagram of the recombinant gene PB2-IL-2 of the recombinant oncolytic influenza virus rFlu-PB2-IL-2; Figure 2 To identify the exogenous gene in the recombinant plasmid pHW2000-PB2-IL-2 by PCR. (M: DNA Marker 2000; 1: pHW2000-PB2; 2: pHW2000-PB2-IL-2). Figure 3 To detect the expression and secretion capacity of exogenous protein IL-2 after transfection of recombinant plasmid pHW2000-PB2-IL-2 into 293T cells using ELISA; Figure 4 To determine the HA hemagglutination titer of P1 generation recombinant oncolytic influenza virus rFlu-PB2-IL-2 using a hemagglutination assay; Figure 5 To identify exogenous genes in rFlu-PB2-IL-2 by RT-PCR. M: DNA Marker 5000; 1: rFlu-PB2-IL-2; 2: rFlu-PB2-IL-2; 3: wild-type PR8; 4: wild-type PR8; Figure 6 Gene sequencing confirmed that the target gene sequence matched the expected results; Figure 7 To detect the expression of the exogenous gene IL-2 of P1 generation recombinant oncolytic influenza virus rFlu-PB2-IL-2 in chicken embryos using ELISA. Figure 7 A: Standard curve for ELISA detection of IL-2 expression; Figure 7 B: IL-2 expression levels of rFlu-PB2-IL-2 and wild-type PR8 in chicken embryos; Figure 8 The hemagglutination assay was used to detect the HA titer of concentrated rFlu-PB2-IL-2 of P2 generation recombinant oncolytic influenza virus. Figure 9 For the hemagglutination assay to detect TCID of P2 generation recombinant oncolytic influenza virus rFlu-PB2-IL-2 concentrate. 50 ; Figure 10 The curves show the changes in tumor volume in each group after oncolytic therapy. Figure 11Images of tumor tissue at 11 days old; Figure 12 The weight of the tumor tissue after 11 days; Figure 13 The tumor suppression efficiency is represented by the oncolytic therapy group. Detailed Implementation

[0021] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0022] Example 1 Recombinant oncolytic influenza virus rescue This invention provides a recombinant oncolytic influenza virus named rFlu-PB2-IL-2, which expresses a protein named IL-2. IL-2 is a protein with the amino acid sequence SEQ ID NO: 1, encoded by nucleotides 2431-2877 in SEQ ID NO: 2.

[0023] The amino acid sequence (149 residues) of the IL-2 protein is shown in SEQ ID NO: 1: APTSSSTSSSTAEAQQQQQQQQQQQHLEQLLMDLQELLSRMENYRNLKLPRMTFKFYLPKQATELKDLQCLEDELGPLRHVLDLTQSKSFQLEDAENFISNIRVTVVKLKGSDNTFECQFDDESATVVDFLRRWIAFCQSIISTSPQ.

[0024] The PB2-IL-2 recombinant gene (3013bp) is shown in SEQ ID NO: 2. GGATCTGGAGCCACGAACTTCT CTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCT (P2A) ATGTACAGCATGCAGCTCGCATCCTGT GTCACATTGACACTTGTGCTCCTTGTCAACAGCGCACCCACTTCAAGCTCCACTTCAAGTCCTACAGCGGAAGCAC AGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCACCTGGAGCAGCTGTTGATGGACCTACAGGAGCTCCTGAG CAGGATGGAGAATTACAGGAACCTGAAACTCCCCAGGATGCTCACCTTCAAATTTTACTTGCCCAAGCAGGCCACA GAATTGAAAGATCTTCAGTGCCTAGAAGATGAACTTGGACCTCTGCGGCATGTTCTGGATTTGACTCAAAGCAAAA GCTTTCAATTGGAAGATGCTGAGAATTTCATCAGCAATATCAGAGTAACTGTTGTAAAACTAAAGGGCTCTGACAA CACATTTGAGTGCCAATTCGATGATGAGTCAGCAACTGTGGTGGACTTTCTGAGGAGATGGATAGCCTTCTGTCAA AGCATCATCTCAACAAGCCCTCAA (IL2)GGGCAAGGAGACGTGGTGTTGGTAATGAAACGGAAACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAAT (Packaging signal of PB2, 99nt) TAG (Termination codon) TGTCGAATAGTTTAAAAACGACCTTGTTTCTACT (5'NCR).

[0025] (1) Construction of the recombinant vector pHW2000-PB2-IL-2: according to Figure 1 The structure of the recombinant gene fragment PB2-IL-2 and the gene sequence of SEQ ID NO: 2 are shown. The corresponding DNA molecule was artificially synthesized, and then the DNA molecule and the bicistronic vector pHW2000 were digested with enzymes to convert them into linear fragments. The recombinant gene fragment and the pHW2000 vector fragment were ligated using an InFusion kit to construct the recombinant vector pHW2000-PB2-IL-2. The target plasmid obtained through homologous recombination was transformed into *E. coli* DH-5α competent cells for plasmid amplification. The plasmid was then extracted using a plasmid extraction kit, and the plasmid concentration and purity were detected using a UV spectrophotometer. The results are shown in Table 1.

[0026] Table 1. Identification of the concentration and purity of the recombinant vector pHW2000-PB2-IL-2

[0027] (2) Identification of exogenous genes in recombinant plasmid pHW2000-PB2-IL-2 Using the recombinant vector pHW2000-PB2-IL-2 as a template, specific primers were used: F-1: 5'-CCTTGCGAAAGGAGAGAAGGCTAATG-3', as shown in SEQ ID NO: 3; R-1: 5'-TTGCCCTTGAGGGCTTGTTGAGA-3', as shown in SEQ ID NO: 4; The exogenous gene IL-2 was amplified by PCR, with a target fragment size of 712 bp. The PCR reaction volume was 20 μl, and the reaction program was as follows: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 30 s, 61℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 30 cycles; 72℃ extension for 10 min. Subsequently, the amplified products were detected by agarose gel electrophoresis, and the results are as follows. Figure 2 As shown.

[0028] The PCR amplification products were detected by agarose gel electrophoresis. The results showed that lane 1 (pHW2000-PB2) did not show a band of the expected size; lane 2 (pHW2000-PB2-IL-2) showed a specific band, and the band size was consistent with the expected result. These results confirm the successful construction of the recombinant plasmid pHW2000-PB2-IL-2.

[0029] (3) Identification of IL2 expression and secretion in cells by recombinant plasmid pHW2000-PB2-IL-2 293T cells were seeded in six-well plates at a density of 3 × 10⁶ cells per well. 5 Cells were transfected. When the cell confluence reached approximately 80%, the recombinant plasmid pHW2000-PB2-IL-2 was transfected into 293T cells according to the Polyfect transfection kit instructions, and the cells were cultured at 37°C for 72 h. The cell culture supernatant was then collected and centrifuged at 1000×g for 10 minutes to remove particles and polymers. The ELISA kit was used to detect the expression level of IL-2 protein in the supernatant. The specific operating steps are as follows: 1. Take an ELISA plate pre-coated with specific antibodies, add 100 μl of cell supernatant to each well, and incubate at 37°C for 90 minutes; 2. Discard the liquid in the wells, add 350 μl of washing buffer to each well, let stand for 30 seconds, discard, and pat dry on absorbent paper. Repeat the washing 4 times; 3. Add 100 μl of biotinylated antibody working solution to each well, incubate at 37°C for 60 minutes, and wash the plate as above; 4. Add 100 μl of enzyme conjugate working solution to each well, incubate at 37°C for 30 minutes, and then wash the plate; 5. Add chromogenic reagent to each well, incubate at 37°C in the dark for 20 minutes, then add stop solution, mix well, and immediately measure the absorbance at 450 nm. The results are as follows. Figure 3 As shown.

[0030] The results showed that ELIAS detected high levels of IL-2 protein in the supernatant of 293T cells transfected with the recombinant plasmid pHW2000-PB2-IL-2. These results confirm that the recombinant vector can efficiently express the exogenous gene and secrete the expressed protein extracellularly.

[0031] Example 2: Rescue and identification of recombinant oncolytic influenza virus rFlu-PB2-IL-2 (1) Rescue and amplification of recombinant oncolytic influenza virus 293T cells were seeded into six-well plates, with 3 × 10⁶ cells per well. 5 1 cell per well, 2 ml / well, incubated overnight at 37°C in a 5% CO2 cell culture incubator. Once the cell confluence reaches approximately 80%, the cells are ready for transfection. According to the Polyfect transfection reagent instructions, recombinant vectors pHW2000-PB2-IL-2 (containing DNA molecules encoding PB2-IL-2-RNA), pHW2000-PB1 (containing DNA molecules encoding PB1-RNA), pHW2000-HA (containing DNA molecules encoding HA-RNA), pHW2000-PA (containing DNA molecules encoding PA-RNA), pHW2000-NP (containing DNA molecules encoding NP-RNA), pHW2000-NA (containing DNA molecules encoding NA-RNA), pHW2000-M (containing DNA molecules encoding M-RNA), and pHW2000-NS (containing DNA molecules encoding NS-RNA) were co-transfected into 293T cells at the same ratio and cultured at 37°C for 72 h.

[0032] Subsequently, the culture medium was subjected to three freeze-thaw cycles between -80°C and room temperature to ensure complete cell lysis, and the supernatant containing recombinant oncolytic virus particles was collected. The collected viral supernatant was inoculated into 9-day-old SPF-grade chicken embryos at 400 µl / embryo and cultured in an incubator at 37°C and 5% CO2 for 72 hours. The chicken embryos were then placed at 4°C overnight, and allantoic fluid containing recombinant virus particles could be collected.

[0033] The pHW2000 in the above recombinant vector is a known plasmid that is publicly available. The material used in this invention is from Testobio, catalog number: TSPLA10545. The PB2, PB1, PA, HA, NP, NA, M, and NS gene fragments in the aforementioned recombinant vectors are all derived from the known influenza virus strain A / Puerto Rico / 8 / 1934 (H1N1). This strain is a publicly available and known strain, and its complete genome sequence has been published in the NCBI GenBank database. The GenBank accession numbers for each gene are as follows: PB2 (polymerase basic protein 2): LC120388.1; PB1 (polymerase basic protein 1): LC120389.1; PA (polymerase acid protein): LC120390.1; HA (hemagglutinin): LC120391.1; NP (nuclear protein): LC120392.1; NA (neuraminidase): LC120393.1; M (matrix protein): LC120394.1; NS (non-structural protein): LC120395.1.

[0034] (2) Hemagglutination assay to determine viral replication efficiency: Take a 96-well rapid reaction plate and add 50 μl of physiological saline to each well. Then, add 50 μl of viral allantoic fluid to each well of the first column of the 96-well plate and mix well. Take 50 μl from each well of the first column and add it to the second column, mix well, and so on, performing serial dilutions of 2. Resuspend the suspension containing 1% red blood cells, and then add 50 μl / well to the 96-well rapid reaction plate. After standing at room temperature for 30 min, interpret the hemagglutination titer of the 96-well plate. The results are as follows: Figure 4 As shown.

[0035] The results showed that the HA hemagglutination titer of the P1 generation recombinant oncolytic influenza virus rFlu-PB2-IL-2 after chicken embryo amplification reached 1:210, proving that the virus has good replication ability.

[0036] (3) RT-PCR identification of exogenous genes: RNA from recombinant oncolytic influenza virus rFlu-PB2-IL-2 and wild-type PR8 was extracted from allantoic fluid using the Tiangen Virus RNA Extraction Kit. The extracted viral RNA was used as a template for reverse transcription. The reverse transcription program was: 25℃, 5 min; 55℃, 15 min; 85℃, 5 min. This yielded the corresponding cDNAs of rFlu-PB2-IL-2 and wild-type PR8. Using the obtained cDNAs as templates, primers were used... F-2: 5'-CCTTGCGAAAGGAGAGAAGGCTAATG-3', as shown in SEQ ID NO: 5; R-2: 5'-TTGCCCTTGAGGGCTTGTTGAGA-3', as shown in SEQ ID NO: 6; The exogenous gene was amplified by PCR, with the expected target fragment size of 712 bp. The PCR reaction volume was 20 μl, and the reaction program was as follows: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 30 s, 61℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 30 cycles; 72℃ extension for 10 min. Then, the PCR amplification products were subjected to agarose gel electrophoresis to preliminarily identify the size of the target fragment. The results are as follows. Figure 5 As shown in the figure. Subsequently, gel recovery was performed, and the sequenced samples were compared with SEQ ID NO: 2. The results are as follows. Figure 6 As shown.

[0037] PCR identification revealed that the wild-type PR8 influenza virus genome did not contain the foreign gene, but the recombinant oncolytic influenza virus rFlu-PB2-IL-2 genome did, with the fragment size consistent with expectations. Furthermore, the sequencing results of the PCR amplification products were identical to SEQ ID NO: 2, showing no mutations or deletions. These results demonstrate that we successfully rescued the recombinant oncolytic influenza virus rFlu-PB2-IL-2 carrying the IL-2 gene.

[0038] (4) ELISA detection of the ability of rFlu-PB2-IL-2 to express exogenous IL2 in chicken embryos: Allantoic fluid containing recombinant oncolytic influenza virus rFlu-PB2-IL-2 was collected, centrifuged at 1000×g for 10 min, and the supernatant was added to ELISA 96 plates, 100 μl per well, and incubated at 37°C for 90 min. The liquid in the wells was discarded, and 350 μl of washing buffer was added to each well. After standing for 30 seconds, the liquid was discarded, and the plates were patted dry on thickly stacked absorbent paper. This process was repeated three times. 100 μl of biotinylated antibody working solution was added to each well, and the plates were incubated at 37°C for 60 min. The plate was then washed as before; 100 μl of enzyme conjugate was added to each well, and the plates were incubated at 37°C for 30 min. Finally, the chromogenic reagent was added, and the plates were incubated in the dark for 20 min. The stop solution was added, and the OD450 value was measured immediately after mixing. The concentration of IL-2 in the chicken embryo allantoic fluid was estimated based on the standard curve. Then, the IL-2 expression level in the chicken embryos was calculated based on the collected volume of chicken embryo allantoic fluid. The results are shown below. Figure 7 As shown.

[0039] The results showed that a large amount of IL-2 protein, up to 8849 pg / egg, was present in the allantoic fluid of chicken embryos infected with the recombinant virus. This demonstrates that rFlu-PB2-IL-2 can efficiently express the exogenous protein IL-2.

[0040] Example 3: Concentration and purification of recombinant oncolytic influenza virus (1) Concentration and purification of recombinant oncolytic influenza virus: Chicken embryo allantoic fluid containing recombinant virus particles was inoculated into 120 9-day-old SPF chicken embryos, 200 μl per embryo. The embryos were incubated at 37°C for 72 h, followed by overnight incubation at 4°C. The allantoic fluid was collected and filtered through a 0.22 μm membrane. The filtered allantoic fluid was mixed with 0.01 mol / L PBS solution at a 1:2 volume ratio to prepare a virus dilution. The allantoic fluid was then concentrated and purified using a tangential flow filtration system. After pretreatment with 0.1 mol / L NaOH solution for 30 min, pure water for 30 min, and PBS solution for 30 min, the virus dilution was loaded and concentrated to 200 mL. Then, 800 mL of PBS solution was added for ultrafiltration to 200 mL. This washing step was repeated three times. Finally, the virus solution was further concentrated by ultrafiltration to approximately 15 mL. The final product was collected to obtain concentrated recombinant oncolytic influenza virus.

[0041] (2) HA hemagglutination titer detection of concentrated recombinant virus: Take a 96-well rapid reaction plate and add 50 μl of physiological saline to each well. Then, add 50 μl of concentrated virus solution to each well of the first column of the 96-well plate and mix well. Take 50 μl of the liquid from each well of the first column and add it to the second column, mix well, and so on, performing serial dilutions of 2. Resuspend the 1% red blood cell suspension and then add 50 μl / well to the 96-well rapid reaction plate. After standing at room temperature for 30 min, interpret the hemagglutination titer of the 96-well plate. The results are as follows: Figure 8 As shown.

[0042] Table 2. Quantitative values ​​of viral hemagglutination titer (HA).

[0043]

[0044] Depend on Figure 8 As shown in Table 2, the concentrated recombinant oncolytic influenza virus rFlu-PB2-IL-2 achieved a hemagglutination titer of 1:2. 15 Its hemagglutination titer was 32 times that of the unconcentrated virus, indicating that the virus concentration was successful.

[0045] (3) TCID of concentrated recombinant virus 50 Detection: Digest MDCK cells and seed them into 96-well plates, with 3 × 10⁶ cells per well. 4MDCK cells, 100 μl / well, were incubated overnight at 37°C in a 5% CO2 incubator. After the cells adhered and grew into a monolayer, the culture medium was aspirated and washed twice with PBS and once with serum-free DMEM. The concentrated recombinant oncolytic influenza virus was serially diluted 10-fold in serum-free DMEM containing 0.01% TPCK trypsin, with 10 gradients, and 100 μl was added to each well of a 96-well plate. A negative control was also included. The 96-well plates were incubated at 37°C in a 5% CO2 incubator for 72 h. Then, the plates were freeze-thawed once at -80°C, and 50 μl / well of the supernatant was aspirated and added to each well of a 96-well rapid reaction plate. Subsequently, 50 μl / well of 1% erythrocyte suspension was added to each well of the 96-well rapid reaction plate. The TCID of the virus was calculated based on the hemagglutination results. 50 The result is as follows Figure 9 As shown.

[0046] Table 3. Tissue half-maximal infectious titer (TCID) of P2 generation recombinant oncolytic influenza virus rFlu-PB2-IL-2 after concentration 50 calculate

[0047] Distance ratio = (Percentage of lesions above 50% - 50%) / (Percentage of lesions above 50% - Percentage of lesions below 50%) = (55.6 - 50) / (55.6 - 0) = 0.1.

[0048] lgTCID 50 =Difference between distance ratios × logarithms of dilutions + logarithm of dilutions with lesion rates above 50% = 0.1 × (-1) + (-7) = -7.1, i.e., TCID 50 =10 -7.1 / 100ul.

[0049] Therefore, the TCID of the concentrated recombinant oncolytic influenza virus rFlu-PB2-IL-2 50 Up to 10 -7.1 / 100ul, while the unconcentrated recombinant oncolytic influenza virus TCID 50 Only 10 -4.7 / 100ul, the results show that the virus's activity is increased 100 times after concentration.

[0050] Example 4 In vivo tumor-suppressive efficacy and safety verification of recombinant oncolytic influenza virus (1) Establishment of a C57BL / 6 mouse model of syngeneic colorectal cancer MC38 subcutaneous xenograft: Female C57BL / 6 mice were selected to establish a mouse model of colorectal cancer MC38 subcutaneous tumor. The surgical site on the right back was cleaned with povidone-iodine solution, and 100 µl of mouse colorectal cancer MC38 cell fluid (1×10⁻⁶) was subcutaneously injected into the site. 6 (Number of tumors per 100µl). Observe tumor growth every other day, measure the major diameter (L) and minor diameter (S) of the tumor with calipers, and calculate the tumor volume (V) using the formula V=L×S. 2 ×1 / 2.

[0051] (2) Grouping and treatment regimens of tumor mouse models: The tumor has grown to a size of 70 to 100 mm. 3 Mice were randomly assigned to three groups (n=4 per group) based on tumor size: PBS group (blank control group), wtPR8 group, and rFlu-PB2-IL-2 group. The viral load injected per mouse was 2 × 10⁻⁶. 6 PFU, 10 μL each time, was injected 5 times at 48-hour intervals. The injection method was intratumoral injection. Tumor volume was measured every other day, and a volume change curve was plotted. The results are as follows: Figure 10 As shown in the figure. The results showed that oncolytic influenza virus significantly inhibited tumor growth on day 3 after recombinant oncolytic therapy, and the tumor volume change slowed down after 7 days. Wild-type influenza virus, after the same dose treatment, resulted in a significantly higher tumor growth rate than the recombinant virus treatment group. These results indicate that recombinant oncolytic influenza virus can significantly inhibit tumor growth.

[0052] (3) Evaluation of the antitumor effect of rFlu-PB2-IL-2 in a mouse model of tumor: Once the tumor volume reached the treatment endpoint, the mice were euthanized by cervical dislocation, tumor tissue was harvested, tumor weight was measured, a tumor weight histogram was plotted, and the tumor inhibition rate was calculated. The results are as follows: Figure 11 , Figure 12 , Figure 13 As shown, compared with the PBS group, the weight of the transplanted tumor was significantly reduced after 11 days of oncolytic treatment in the recombinant oncolytic influenza virus group. According to the tumor weight calculation, the tumor inhibition rate of wild-type influenza virus can reach about 50%, while under the same dose treatment, the tumor inhibition rate of recombinant virus can reach more than 90%, which is a significant improvement in tumor inhibition rate.

[0053] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0054] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A recombinant oncolytic influenza virus, characterized by: The recombinant oncolytic influenza virus is an influenza virus expressing the IL-2 protein, and its PB2 gene has been modified into the recombinant gene PB2-IL-2. The amino acid sequence of the IL-2 protein is shown in SEQ ID NO: 1; The nucleotide sequence of the recombinant gene PB2-IL-2 is shown in SEQ ID NO:

2.

2. The recombinant oncolytic influenza virus according to claim 1, characterized in that: The genome of the recombinant oncolytic influenza virus consists of eight single-stranded, segmented RNAs. The negative-strand RNA of the recombinant oncolytic influenza virus transcribes a set of positive-strand RNAs complementary to the negative-strand RNAs. The set of positive-strand RNAs includes PB2-IL-2-RNA, PB1-RNA, NP-RNA, HA-RNA, NA-RNA, PA-RNA, M-RNA, and NS-RNA. The PB2-IL-2-RNA is a positive-sense RNA encoding the recombinant gene PB2-IL-2-RNA of claim 1; The PB1-RNA is a positive-sense RNA encoding the PB1 gene in the influenza virus strain. The NP-RNA is a positive-sense RNA encoding the NP gene in the influenza virus strain; The HA-RNA is a positive-sense RNA encoding the HA gene in the influenza virus strain. The NA-RNA is a positive-sense RNA encoding the NA gene in the influenza virus strain; The PA-RNA is a positive-sense RNA encoding the PA gene in the influenza virus strain. The M-RNA is a positive-sense RNA encoding the M gene in the influenza virus strain; The NS-RNA is a positive-sense RNA encoding the NS gene in the influenza virus strain.

3. The recombinant oncolytic influenza virus according to any one of claims 1-2, characterized in that: The recombinant gene PB2-IL-2-RNA sequence is obtained by inserting the following nucleotide sequences sequentially from 5' to 3' before the stop codon at the 5'NCR end of the PB2 gene in the influenza virus strain: the hydrolyzable linker peptide P2A nucleotide sequence, the IL-2 signal peptide nucleotide sequence, the IL-2 nucleotide sequence, and the PB2 gene 5'NCR end packaging signal nucleotide sequence, while keeping other nucleotides unchanged. The nucleotide sequence of the hydrolyzable linker peptide P2A is shown as the nucleotide sequence of positions 2305-2370 in SEQ ID NO: 2; The IL-2 signal peptide nucleotide sequence is shown as nucleotides 2371-2430 in SEQ ID NO: 2; The IL-2 nucleotide sequence is shown as nucleotides 2431-2877 in SEQ ID NO: 2; The nucleotide sequence of the 5'NCR end packaging signal sequence of the PB2 gene is shown as nucleotides 2878-2976 in SEQ ID NO: 2; The recombinant gene can be obtained by inserting the IL-2 gene into the influenza virus gene PB2, or by inserting the IL-2 gene into other genes on the influenza virus genome.

4. The method for constructing and rescuing recombinant oncolytic influenza virus according to any one of claims 1-3, characterized in that: A recombinant vector containing a DNA molecule encoding PB2-IL-2-RNA, a recombinant vector containing a DNA molecule encoding PB1-RNA, a recombinant vector containing a DNA molecule encoding NP-RNA, a recombinant vector containing a DNA molecule encoding HA-RNA, a recombinant vector containing a DNA molecule encoding NA-RNA, a recombinant vector containing a DNA molecule encoding PA-RNA, a recombinant vector containing a DNA molecule encoding M-RNA, and a recombinant vector containing a DNA molecule encoding NS-RNA were co-introduced into packaging cells to obtain recombinant oncolytic influenza virus; The vector includes the pHW2000 plasmid.

5. A drug for treating colorectal cancer, characterized in that: The active pharmaceutical ingredient is the recombinant oncolytic influenza virus as described in any one of claims 1-3.

6. The use of the recombinant oncolytic influenza virus according to any one of claims 1-3 as any of the following products, characterized in that: The products include: (1) The genome of the recombinant oncolytic influenza virus; (2) A complete set of vectors for treating tumors, i.e., a vector containing the encoding gene of IL-2; (3) A complete expression cassette for treating tumors, i.e., an expression cassette containing the gene encoding IL-2; (4) A complete set of genes for treating tumors, namely the gene encoding IL-2; (5) A set of proteins for the treatment of tumors, namely the IL-2 protein.

7. The recombinant oncolytic influenza virus-related biomaterial according to any one of claims 1-3, characterized in that: The biomaterial is any of the following products: (1) A set of DNA molecules encoding the set of positive-sense RNAs of the recombinant oncolytic influenza virus; the set of DNA molecules consists of DNA molecules encoding the PB2-IL-2-RNA, DNA molecules encoding the PB1-RNA, DNA molecules encoding the NP-RNA, DNA molecules encoding the HA-RNA, DNA molecules encoding the NA-RNA, DNA molecules encoding the PA-RNA, DNA molecules encoding the M-RNA and DNA molecules encoding the NS-RNA; (2) A set of recombinant vectors; the set of recombinant vectors consists of a recombinant vector containing a DNA molecule encoding the PB2-IL-2-RNA, a recombinant vector containing a DNA molecule encoding the PB1-RNA, a recombinant vector containing a DNA molecule encoding the NP-RNA, a recombinant vector containing a DNA molecule encoding the HA-RNA, a recombinant vector containing a DNA molecule encoding the NA-RNA, a recombinant vector containing a DNA molecule encoding the PA-RNA, a recombinant vector containing a DNA molecule encoding the M-RNA, and a recombinant vector containing a DNA molecule encoding the NS-RNA; (3) Microorganisms containing the recombinant oncolytic influenza virus; (4) an animal cell containing the recombinant oncolytic influenza virus; (5) an animal tissue containing the recombinant oncolytic influenza virus; (6) an animal organ containing the recombinant oncolytic influenza virus; In the above biological materials, the animal cell, the animal tissue and the animal organ do not include reproductive materials; In the above biological materials, the microorganism, the animal cell, the animal tissue and the animal organ can be used as a host of the recombinant oncolytic virus.

8. Use of the recombinant oncolytic influenza virus according to any one of claims 1-3 in the preparation of a medicament for treating a tumor, characterized in that: the tumor is colorectal cancer.

9. The recombinant oncolytic influenza virus according to any one of claims 1-3, characterized in that: the influenza virus strain comprises an influenza A virus or an influenza B virus.

Images