A high specific activity cellulase mutant

Abstract

This invention relates to the fields of genetic engineering and protein engineering, specifically to a high specific activity cellulase mutant. Compared to the wild type, this invention provides a mutant containing at least one mutation site from P14G, K44Q, S45N, G46A, A54M, E81D, S109N, G112S, A122Q, M123I, V128L, W168F, D177S, and G258T, which significantly improves the specific activity of the enzyme, thereby reducing its production cost and promoting its widespread application in the industrial field.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and protein modification technology, specifically relating to a high specific activity cellulase mutant and its application. Background Technology

[0002] Cellulose is a D-glucanoid polymer linked by β-1,4-glycosidic bonds. It is one of the most abundant and renewable resources on Earth, with an estimated 1.5 x 10⁻⁶ cells produced annually through photosynthesis. 11 Hundreds of millions of tons of cellulose (Ryu, DD et al., 1980, Enzyme and Microbial Technology). In most cases, to utilize cellulose at high value, it must first be effectively degraded by cellulase. Cellulase is a complex inducible enzyme system composed of various hydrolases. It refers to a group of enzymes that can degrade cellulose to produce small molecules such as cellobiose and glucose. It generally includes three types of hydrolases: endo-β-1,4-glucanase (EC3.2.1.4), exo-β-1,4-glucanase (EC3.2.1.91), and β-glucosidase (EC3.2.1.21).

[0003] Cellulases contain a catalytic domain / core (CD) that exhibits cellulase activity. In addition to the catalytic domain, cellulase molecules may also contain one or more cellulose-binding domains (CBDs), also known as carbohydrate-binding domains / modules (CBDs / CBMs). CBDs enhance the binding of the enzyme to cellulose-containing cellulose and improve the efficiency of the catalytic domain.

[0004] Many organisms in nature produce cellulase, mainly microorganisms such as filamentous fungi, bacteria, and actinomycetes, among which Trichoderma (T.) richoderma As a strain used for the industrial production of cellulase, *Trichoderma* sp. has two exonuclease components (CbhI and CbhII) and five endonuclease components (EgI, EgII, EgIII, EgIV, and EgV). Due to its advantages such as efficient secretory expression and high-density fermentation, *Trichoderma* is often used to construct engineered strains for efficient expression of exogenous genes.

[0005] The industrial applications of cellulase are mainly concentrated in the fields of feed, bioenergy, detergents, textile finishing, and denim washing. In the bioenergy field, cellulase can completely degrade cellulose materials through hydrolysis, and its hydrolysis products can be further fermented to produce ethanol, hydrogen, and biodiesel. This field requires highly active acidic cellulase. In the detergent industry, alkaline cellulase can be added to detergents to improve washing performance. In the fields of textile finishing and denim washing, neutral cellulase has significant advantages due to its low reaction temperature, mild reaction conditions, and good fabric finishing effect.

[0006] Cellulase has wide applications in industry, possessing irreplaceable advantages and promising development prospects. Therefore, although cellulases have been successfully used commercially for many years, the industry still urgently needs new cellulases with improved performance. Summary of the Invention

[0007] The purpose of this invention is to provide a high specific activity cellulase mutant and its applications. This invention obtains a mutant protein by protein engineering the cellulase. Compared with the wild type, the specific activity of the mutant is significantly improved, and it can be widely used in industrial fields.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution: One aspect of the present invention relates to a cellulase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO: 1, and comprising, compared with SEQ ID NO: 1, an amino acid substitution at at least one position selected from the group consisting of: 14, 44, 45, 46, 54, 81, 109, 112, 122, 123, 128, 168, 177, 258.

[0009] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.

[0010] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.

[0011] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: P14G, K44Q, S45N, G46A, A54M, E81D, S109N, G112S, A122Q, M123I, V128L, W168F, D177S, G258T.

[0012] In some embodiments of the present invention, the mutant comprises the following substitutions or combinations thereof: P14G; P14G / K44Q; P14G / S45N; P14G / G46A; P14G / A54M; P14G / E81D; P14G / S109N; P14G / G112S; P14G / A122Q; P14G / M123I; P14G / V128L; P14G / D177S; P14G / G258T; P14G / K44Q / G46A; P14G / K44Q / E81D; P14G / K44Q / S109N; P14G / S45N / E81D; P14G / S45N / A122Q; P14G / S45N / M123I; P14G / G46A / E81D; P14G / G46A / V128L; P14G / G46A / D177S; P14G / E81D / S109N; P14G / E81D / G112S; P14G / E81D / M123I; P14G / E81D / D177S; P14G / E81D / G258T; P14G / S109N / A122Q; P14G / S109N / M123I; P14G / S109N / V128L; P14G / S109N / D177S; P14G / A122Q / W168F; P14G / A122Q / D177S; P14G / A122Q / G258T; K44Q; K44Q / S45N; K44Q / G46A; K44Q / A54M; K44Q / E81D; K44Q / S109N; K44Q / G112S; K44Q / M123I; K44Q / W168F; K44Q / D177S; K44Q / G258T; K44Q / S45N / E81D; K44Q / S45N / S109N; K44Q / S45N / A122Q; K44Q / S45N / M123I; K44Q / S45N / V128L; K44Q / G46A / E81D; K44Q / G46A / S109N; K44Q / G46A / V128L; K44Q / G46A / W168F; K44Q / S54M / E81D; K44Q / S54M / G112S; K44Q / S54M / V128L; K44Q / S54M / D177S; K44Q / S54M / G258T; K44Q / E81D / S109N; K44Q / E81D / G112S; K44Q / E81D / A122Q; K44Q / E81D / V128L; K44Q / E81D / W168F; K44Q / S109N / A122Q; K44Q / S109N / M123I; K44Q / S109N / V128L; K44Q / S109N / D177S; K44Q / A122Q / M123I; K44Q / A122Q / V128L; K44Q / A122Q / W168F; K44Q / A122Q / D177S; K44Q / M123I / W168F; K44Q / M123I / D177S; K44Q / M123I / G258T; K44Q / W168F / D177S; K44Q / D177S / G258T; K44Q / S109N / A122Q / D177S; K44Q / S109N / A122Q / G258T; K44Q / S109N / D177S / G258T; K44Q / A122Q / M123I / G258T; K44Q / A122Q / V128L / G258T; K44Q / A122Q / W168F / G258T; K44Q / V128L / D177S / G258T; K44Q / W168F / D177S / G258T; K44Q / G46A / E81D / W168F / D177S; K44Q / G46A / S109N / W168F / D177S; K44Q / A122Q / M123I / D177S / G258T; K44Q / A122Q / V128L / D177S / G258T; S45N; S45N / G46A; S45N / A54M; S45N / E81D; S45N / S109N; S45N / G112S; S45N / A122Q; S45N / M123I; S45N / V128L; S45N / W168F; S45N / D177S; S45N / G46A / E81D; S45N / G46A / S109N; S45N / G46A / A122Q; S45N / G46A / W168F; S45N / A54M / E81D; S45N / A54M / G112S; S45N / E81D / S109N; S45N / E81D / A122Q; S45N / E81D / V128L; S45N / E81D / W168F; S45N / S109N / A122Q; S45N / S109N / V128L; S45N / G112S / A122Q; S45N / G112S / M123I; S45N / G112S / V128L; S45N / G112S / W168F; S45N / A122Q / M123I; S45N / A122Q / V128L; S45N / A122Q / W168F; S45N / A122Q / D177S; S45N / M123I / W168F; S45N / M123I / D177S; S45N / M128I / G258T; S45N / W168F / D177S; S45N / D177S / G258T; S45N / G46A / E81D / G112S / W168F; S45N / A122Q / V128L / D177S / G258T; S45N / G46A / E81D / A122Q / V128L / D177S; A54M; A54M / E81D; A54M / S109N; A54M / G112S; A54M / A122Q; A54M / M123I; A54M / V128L; A54M / W168F; A54M / D177S; A54M / G258T; A54M / E81D / S109N; A54M / E81D / G112S; A54M / E81D / A122Q; A54M / G258T; A54M / E81D / W168F; A54M / S109N / A122Q; A54M / S109N / D177S; A54M / G112S / A122Q; A54M / G112S / M123I; A54M / G112S / V128L; A54M / G112S / W168F; A54M / A122Q / D177S; A54M / A122Q / M123I; A54M / A122Q / V128L; A54M / A122Q / D177S; A54M / M123I / W168F; A54M / M123I / D177S; A54M / M123I / G258T; A54M / W168F / D177S; A54M / D177S / G258T; A54M / E81D / S109N / A122Q A54M / E81D / S109N / M123I A54M / S109N / W168F / D177S A54M / G112S / A122Q / D177S; A54M / G112S / A122Q / G258T; A54M / A122Q / M123I / G258T; A54M / A122Q / D177S / G258T; A54M / M123I / W168F / G258T; A54M / V128L / D177S / G258T; A54M / W168F / D177S / G258T; A54M / G46A / E81D / W168F / D177S; A54M / G46A / S109N / W168F / D177S; A54M / G112S / M123I / W168F / D177S; A54M / G112S / V128L / W168F / D177S; A54M / A122Q / M123I / D177S / G258T; A54M / A122Q / V128L / D177S / G258T; E81D; E81D / S109N; E81D / G112S; E81D / A122Q; E81D / M123I; E81D / V128L; E81D / W168F; E81D / D177S; E81D / G258T; E81D / S109N / A122Q; E81D / S109N / M123I; E81D / S109N / D177S; E81D / G112S / M123I; E81D / G112S / W168F; E81D / A122Q / M123I; E81D / A122Q / V128L; E81D / A122Q / D177S; E81D / M123I / W168F; E81D / M123I / D177S; E81D / M123I / G258T; E81D / W168F / D177S; E81D / S109N / W168F / D177S; E81D / G112S / A122Q / D177S; E81D / A122Q / M123I / G258T; E81D / M123I / W168F / G258T; E81D / W168F / D177S / G258T; E81D / G112S / M123I / W168F / D177S; E81D / G112S / V128L / W168F / D177S; E81D / A122Q / V128L / D177S / G258T; S109N; S109N / A122Q; S109N / M123I; S109N / W168F; S109N / A122Q / V128L; S109N / M123I / W168F; S109N / V128L / D177S; S109N / A122Q / M123I / W168F; S109N / A122Q / W168F / D177S; S109N / A122Q / V128L / W168F / D177S; G112S; G112S / A122Q; G112S / M123I; G112S / D177S; G112S / A122Q / W168F; G112S / M123I / V128L; G112S / A122Q / M123I / W168F; G112S / A122Q / V128L / D177S; G112S / A122Q / V128L / W168F / D177S; A122Q; A122Q / M123I; A122Q / V128L; A122Q / D177S; A122Q / G258T; A122Q / M123I / V128L; A122Q / M123I / W168F; A122Q / W168F / D177S; A122Q / D177S / G258T; A122Q / M123I / V128L / D177S; A122Q / W168F / D177S / G258T; M123I; M123I / W168F; M123I / D177S; M123I / G258T; M123I / V128L / W168F; M123I / V128L / D177S; M123I / W168F / D177S; M123I / W168F / D177S / G258T; V128L; V128L / W168F; V128L / D177S; V128L / W168F / D177S; V128L / W168F / D177S / G258T; W168F; W168F / D177S; W168F / G258T; W168F / D177S / G258T; D177S; D177S / G258T; G258T.

[0013] The present invention also relates to DNA molecules encoding the above-mentioned cellulase mutants.

[0014] The present invention also relates to recombinant expression plasmids comprising the above-described DNA molecules.

[0015] The present invention also relates to a host cell comprising the above-described recombinant expression plasmid.

[0016] In some embodiments of the present invention, the host cell is *Trichoderma reesei* (…). Trichoderma reesei ).

[0017] The recombinant expression plasmid was transferred into Trichoderma reesei host cells for recombinant expression, and the resulting cellulase mutant had a higher specific activity.

[0018] The cellulase mutants provided by this invention exhibit higher specific activity at 50°C. Compared with the wild type, cellulase mutants containing single-point mutations of P14G, K44Q, S45N, G46A, A54M, E81D, S109N, G112S, A122Q, M123I, V128L, W168F, D177S, and G258T generally showed an increase in specific activity of 18%-59% at 50°C. Among them, the specific activities of the E81D single-point mutant and the G112S single-point mutant were increased by 59% and 51%, respectively, achieving unexpected technical effects.

[0019] In summary, the cellulase mutant described in this invention is more suitable for industrial applications than the wild type, and can greatly reduce the amount of cellulase used, save labor and energy, and reduce production costs. Detailed Implementation

[0020] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECULAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENTPROTOCOLS IN MOLECULAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, this invention is not limited to any specific methods, experimental protocols, and reagents described.

[0021] The method for determining cellulase activity in the examples is as follows: (1) Definition of enzyme activity Under conditions of 50°C and pH 6.0, the amount of enzyme required to release 1 μmol of reducing sugar per minute from a 5 mg / ml sodium carboxymethyl cellulose solution is defined as one enzyme activity unit (U), where the reducing sugar is in equal amounts to glucose.

[0022] (2) Measurement method Add 0.5 mL of CMC substrate to each of three test tubes and preheat them together with the enzyme solution at 50°C for 5 min. Add 0.5 mL of the test solution to each of the first and second test tubes and start the reaction at 50°C for 15 min. After the reaction is complete, add 1.5 mL of DNS reagent to each of the three test tubes, and add 0.5 mL of the enzyme solution to the third test tube. Remove and shake the three test tubes well, and react them in a boiling water bath for 5 min. Quickly cool to room temperature and dilute to 5.0 mL with water. Using the solution in the third test tube as a control, measure the absorbance of the solutions in the first and second test tubes at a wavelength of 540 nm. The absorbance should be between 0.25 and 0.35. The absolute value of the difference between the absorbance of the enzyme solution and the absorbance of the control enzyme solution should not exceed 0.015.

[0023] Enzyme activity X = (equivalent amount of glucose / 180 / 15 / 0.5) × n.

[0024] Where: X—enzyme activity unit, IU / g (mL); 180 — Glucose converted from micrograms to micromoles; 15 — Reaction time between the test solution and the substrate; 0.5 — The amount of the enzyme solution to be tested added to the reaction; n – dilution factor.

[0025] The protein content determination method in the examples is as follows: The Coomassie Brilliant Blue (Bradford) binding method for protein determination is a combined colorimetric and dye-based method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution, turning blue upon binding with protein. Within a certain protein concentration range, it obeys Beer's Law and can be measured colorimetrically at 595 nm. It exhibits significant absorption within 3–5 minutes and remains stable for at least 1 hour. In the range of 10–1000 μg / mL, the absorbance is directly proportional to the protein concentration.

[0026] The enzyme solution and Coomassie Brilliant Blue solution were mixed at a volume ratio of 1:5, allowed to stand for 10 minutes, and the protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method.

[0027] The present invention will now be described in detail with reference to specific embodiments.

[0028] Example 1 Screening of cellulase mutants To improve the specific activity of wild-type cellulase SE (amino acid sequence SEQ ID NO: 1, encoding nucleotide sequence SEQ ID NO: 2), the applicant screened for a large number of mutations in amino acids near the active site of the enzyme using directed evolution technology.

[0029] The PCR primers S1-F and S1-R are designed as follows: S1-F: GGC GAATTC GCCGATG GCAAGTCGACCC (underlined characters indicate restriction endonucleases) Eco RI identification site); S1-R: ATA GCGGCCGC TTAAAGGCACTGCGAGTACCA (underlined characters represent restriction endonucleases) Not I. Identification site).

[0030] Using the wild-type cellulase SE gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above primers with the GeneMorph II random mutagenesis PCR kit (Stratagene). The PCR products were recovered from the gel. Eco RI Not After enzyme digestion, I was ligated with the pET21a plasmid that had been digested with the same enzyme, and transformed into E. coli BL21(DE3). The transformed cells were plated on LB / Amp plates and incubated upside down at 37°C. After the transformants appeared, they were picked one by one with a toothpick and transferred to a 96-well plate. 150 μL of LB / Amp medium containing 0.1 mM IPTG was added to each well. The plates were incubated at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain E. coli cell lysate containing cellulase.

[0031] Take 50 μL of lysis buffer into two new 96-well plates and measure their cellulase activity and protein content at 50 °C. Calculate the specific activity of different mutants.

[0032] Experimental results showed that some mutations had no effect on the specific activity of cellulase at 50℃, while others even worsened its specific activity. Still others, although increasing the specific activity of cellulase, significantly altered its enzymatic properties, which did not meet the requirements. Ultimately, the applicant obtained mutation sites that significantly improved specific activity at 50℃, namely: P14G, K44Q, S45N, G46A, A54M, E81D, S109N, G112S, A122Q, M123I, V128L, W168F, D177S, and G258T.

[0033] Based on wild-type cellulase SE, this invention provides cellulase mutants containing single mutation sites of P14G, K44Q, S45N, G46A, A54M, E81D, S109N, G112S, A122Q, M123I, V128L, W168F, D177S, and G258T.

[0034] The present invention also provides cellulase mutants comprising at least two mutation sites selected from P14G, K44Q, S45N, G46A, A54M, E81D, S109N, G112S, A122Q, M123I, V128L, W168F, D177S, and G258T. Examples include: two-point mutants such as P14G / E81D, A54M / G258T, E81D / M123I, G112S / A122Q, G112S / D177S, and A122Q / D177S; three-point mutants such as P14G / S45N / M123I, S45N / E81D / A122Q, E81D / G112S / W168F, and A122Q / W168F / D177S; and K44Q / S Four-point mutants including 109N / D177S / G258T, A54M / G112S / A122Q / D177S, E81D / S109N / W168F / D177S, G112S / A122Q / V128L / D177S; and five-point mutants including K44Q / A122Q / V128L / D177S / G258T, E81D / G112S / M123I / W168F / D177S.

[0035] Example 2 Expression of cellulase mutant in Trichoderma reesei Based on the codon preference of Trichoderma, the gene sequence SEQ ID NO:2 of the wild-type cellulase SE and the gene sequence of the mutant were optimized and synthesized, and the 5' and 3' ends of the synthesized sequence were respectively added. Xho I and Mlu I have two restriction enzyme sites.

[0036] 2.1 Expression plasmid construction The synthesized plasmids were then processed with restriction endonucleases. Xho I (Fermentas) and Mlu I was digested with enzymes; simultaneously, restriction endonucleases were used. Xho I (Fermentas) and Mlu I. The plasmid pTGII was digested with enzymes; the digested products were purified using a gel purification kit, and the two digested products were ligated using T4 DNA ligase (Fermentas); the ligation products were transformed into Trans5α Escherichia coli (Transgen), and selection was performed using ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen). After successful sequencing, the recombinant expression plasmid containing the cellulase gene was obtained.

[0037] Plasmids were purified from correctly sequenced E. coli clones using a plasmid medium-quantity preparation kit (Axygen).

[0038] 2.2 Protoplast Preparation Spore suspensions of the cellulase gene-deficient Trichoderma reesei host fungus were inoculated onto PDA plates and cultured at 30°C for 6 days. After abundant sporulation, colonies of approximately 1 cm × 1 cm were excised and placed in liquid medium containing 120 mL YEG / U (0.5% yeast extract, 1% glucose, 0.1% uridine) and cultured at 30°C with shaking at 220 rpm for 14–16 h. Mycelia were collected by filtration through sterile gauze and washed once with sterile water. The mycelia were then placed in Erlenmeyer flasks containing 20 mL of 10 mg / mL lyase solution (Sigma L1412) and incubated at 30°C with shaking at 90 rpm for 1–2 h. The progress of protoplast transformation was observed under a microscope.

[0039] Add 20 mL of pre-chilled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the Erlenmeyer flask, gently mix, filter through sterile Miracloth filter cloth, collect the filtrate, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add 5 mL of pre-chilled 1.2 M sorbitol solution to resuspend the bacterial cells, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add an appropriate amount of pre-chilled 1.2 M sorbitol to resuspend and dispense (200 μL / tube, protoplast concentration 10). 8 (units / mL).

[0040] 2.3 Expression plasmid transformation and strain validation All the following operations were performed on ice. 10 μg of recombinant plasmid was added to a sterile 7 mL centrifuge tube containing 200 μL of protoplast solution. Then, 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2) was added, the bottom of the tube was gently tapped to mix, and the tube was incubated on ice for 20 min. Next, 2 mL of 25% PEG was added, mixed, and incubated at room temperature for 5 min. Finally, 4 mL of PEG solution was added... 1.2M sorbitol was gently mixed and poured into the melted upper medium (0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose) and gently mixed again. This mixture was then spread onto the prepared lower medium (2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar) and incubated at 30°C for 5–7 days until transformants appeared. Transformants were then transferred to the lower medium for re-screening and incubated at 30°C for 2 days. Strains with smoother colony edges were considered positive transformants.

[0041] Take an appropriate amount of mycelium and place it in a 2 mL centrifuge tube. Add 100 mg of sterile quartz sand and 400 μL of extraction buffer (100 mM Tris-HCl, 100 mM EDTA, 250 mM NaCl, 1% SDS). Vigorously shake with a bead mixer for 2 min. After incubating in a 65 °C water bath for 20 min, add 200 μL of 10 M NH4AC and incubate on ice for 10 min. Centrifuge at 13000 rpm for 10 min. Take the supernatant, add 2 volumes of anhydrous ethanol, and place at -20 °C for 30 min. Centrifuge at 13000 rpm for 10 min and discard the supernatant. Wash twice with 70% ethanol. Air dry, dissolve in water, and store at -20 °C.

[0042] Using the extracted genomic DNA from the transformants as a template, the target gene was amplified by PCR using primers SE-F and SE-R for verification.

[0043] SE-F: GCCGATG GCAAGTCGACCC; SE-R:TTAAAGGCACTGCGAGTACCA.

[0044] PCR amplification conditions were: 94℃ for 4 min; 94℃ for 40 s; 58℃ for 40 s, 72℃ for 1 min, 30 cycles; 72℃ for 7 min, 16℃; PCR amplification products were recovered using a gel extraction kit and sequenced for analysis.

[0045] Following the above method, the applicant constructed recombinant Trichoderma reesei engineered strains expressing wild-type cellulase SE and the above mutants, respectively.

[0046] Example 3 Fermentation Verification The engineered Trichoderma reesei strains constructed above were inoculated onto PDA solid plates and cultured at 30℃ for 6 days. After spore abundance, two 1 cm diameter mycelial blocks were inoculated into 250 mL Erlenmeyer flasks containing 50 mL of fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements). The flasks were cultured at 30℃ for 48 h, followed by 25℃ for 48 h. The fermentation broth was centrifuged to obtain fermentation supernatants containing wild-type cellulase SE and the aforementioned mutant, respectively. The cellulase activity and protein content of the fermentation supernatants were measured, and the specific activity was calculated. The specific results are shown in Table 1.

[0047] Specific activity refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein. Generally speaking, the higher the specific activity of an enzyme, the purer the enzyme.

[0048] Specific activity calculation formula: Specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0049] Table 1. Specific activity of cellulase SE and its mutants at 50℃ Cellulase Specific activity (U / mg) at 50℃ wild type 186 P14G 233 K44Q 255 S45N 230 G46A 260 A54M 223 E81D 295 S109N 245 G112S 280 A122Q 240 M123I 231 V128L 255 W168F 256 D177S 252 G258T 220 As can be seen from the data in Table 1, compared with wild-type cellulase SE, the single-point mutants provided by this invention, which contain P14G, K44Q, S45N, G46A, A54M, E81D, S109N, G112S, A122Q, M123I, V128L, W168F, D177S, and G258T respectively, generally showed an increase in specific activity of 18%-59% at 50℃. Among them, the specific activities of the E81D single-point mutant and the G112S single-point mutant were increased by 59% and 51% respectively, achieving unexpected technical effects.

[0050] In summary, the cellulase mutant described in this invention is more suitable for industrial applications than the wild type, and can greatly reduce the amount of cellulase used, save labor and energy, and reduce production costs.

Claims

1. A cellulase mutant, characterized in that, The mutant comprises an amino acid sequence having at least 90% identity with SEQ ID NO:1, and contains an amino acid substitution at at least one position selected from the group consisting of: 14, 44, 45, 46, 54, 81, 109, 112, 122, 123, 128, 168, 177, 258 compared to SEQ ID NO:

1.

2. The mutant as described in claim 1, characterized in that, The amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:

1.

3. The mutant as described in claim 2, characterized in that, The amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:

1.

4. The mutant as described in claim 2, characterized in that, The mutant contains a substitution of at least one amino acid from the following group: P14G, K44Q, S45N, G46A, A54M, E81D, S109N, G112S, A122Q, M123I, V128L, W168F, D177S, G258T.

5. The mutant as described in claim 4, characterized in that, The mutant contains substitutions or combinations of substitutions selected from the following substitutions and combinations of substitutions: P14G; P14G / K44Q; P14G / S45N; P14G / G46A; P14G / A54M; P14G / E81D; P14G / S109N; P14G / G112S; P14G / A122Q; P14G / M123I; P14G / V128L; P14G / D177S; P14G / G258T; P14G / K44Q / G46A; P14G / K44Q / E81D; P14G / K44Q / S109N; P14G / S45N / E81D; P14G / S45N / A122Q; P14G / S45N / M123I; P14G / G46A / E81D; P14G / G46A / V128L; P14G / G46A / D177S; P14G / E81D / S109N; P14G / E81D / G112S; P14G / E81D / M123I; P14G / E81D / D177S; P14G / E81D / G258T; P14G / S109N / A122Q; P14G / S109N / M123I; P14G / S109N / V128L; P14G / S109N / D177S; P14G / A122Q / W168F; P14G / A122Q / D177S; P14G / A122Q / G258T; K44Q; K44Q / S45N; K44Q / G46A; K44Q / A54M; K44Q / E81D; K44Q / S109N; K44Q / G112S; K44Q / M123I; K44Q / W168F; K44Q / D177S; K44Q / G258T; K44Q / S45N / E81D; K44Q / S45N / S109N; K44Q / S45N / A122Q; K44Q / S45N / M123I; K44Q / S45N / V128L; K44Q / G46A / E81D; K44Q / G46A / S109N; K44Q / G46A / V128L; K44Q / G46A / W168F; K44Q / S54M / E81D; K44Q / S54M / G112S; K44Q / S54M / V128L; K44Q / S54M / D177S; K44Q / S54M / G258T; K44Q / E81D / S109N; K44Q / E81D / G112S; K44Q / E81D / A122Q; K44Q / E81D / V128L; K44Q / E81D / W168F; K44Q / S109N / A122Q; K44Q / S109N / M123I; K44Q / S109N / V128L; K44Q / S109N / D177S; K44Q / A122Q / M123I; K44Q / A122Q / V128L; K44Q / A122Q / W168F; K44Q / A122Q / D177S; K44Q / M123I / W168F; K44Q / M123I / D177S; K44Q / M123I / G258T; K44Q / W168F / D177S; K44Q / D177S / G258T; K44Q / S109N / A122Q / D177S; K44Q / S109N / A122Q / G258T; K44Q / S109N / D177S / G258T; K44Q / A122Q / M123I / G258T; K44Q / A122Q / V128L / G258T; K44Q / A122Q / W168F / G258T; K44Q / V128L / D177S / G258T; K44Q / W168F / D177S / G258T; K44Q / G46A / E81D / W168F / D177S; K44Q / G46A / S109N / W168F / D177S; K44Q / A122Q / M123I / D177S / G258T; K44Q / A122Q / V128L / D177S / G258T; S45N; S45N / G46A; S45N / A54M; S45N / E81D; S45N / S109N; S45N / G112S; S45N / A122Q; S45N / M123I; S45N / V128L; S45N / W168F; S45N / D177S; S45N / G46A / E81D; S45N / G46A / S109N; S45N / G46A / A122Q; S45N / G46A / W168F; S45N / A54M / E81D; S45N / A54M / G112S; S45N / E81D / S109N; S45N / E81D / A122Q; S45N / E81D / V128L; S45N / E81D / W168F; S45N / S109N / A122Q; S45N / S109N / V128L; S45N / G112S / A122Q; S45N / G112S / M123I; S45N / G112S / V128L; S45N / G112S / W168F; S45N / A122Q / M123I; S45N / A122Q / V128L; S45N / A122Q / W168F; S45N / A122Q / D177S; S45N / M123I / W168F; S45N / M123I / D177S; S45N / M128I / G258T; S45N / W168F / D177S; S45N / D177S / G258T; S45N / G46A / E81D / G112S / W168F; S45N / A122Q / V128L / D177S / G258T; S45N / G46A / E81D / A122Q / V128L / D177S; A54M; A54M / E81D; A54M / S109N; A54M / G112S; A54M / A122Q; A54M / M123I; A54M / V128L; A54M / W168F; A54M / D177S; A54M / G258T; A54M / E81D / S109N; A54M / E81D / G112S; A54M / E81D / A122Q; A54M / G258T; A54M / E81D / W168F; A54M / S109N / A122Q; A54M / S109N / D177S; A54M / G112S / A122Q; A54M / G112S / M123I; A54M / G112S / V128L; A54M / G112S / W168F; A54M / A122Q / D177S; A54M / A122Q / M123I; A54M / A122Q / V128L; A54M / A122Q / D177S; A54M / M123I / W168F; A54M / M123I / D177S; A54M / M123I / G258T; A54M / W168F / D177S; A54M / D177S / G258T; A54M / E81D / S109N / A122Q A54M / E81D / S109N / M123I A54M / S109N / W168F / D177S A54M / G112S / A122Q / D177S; A54M / G112S / A122Q / G258T; A54M / A122Q / M123I / G258T; A54M / A122Q / D177S / G258T; A54M / M123I / W168F / G258T; A54M / V128L / D177S / G258T; A54M / W168F / D177S / G258T; A54M / G46A / E81D / W168F / D177S; A54M / G46A / S109N / W168F / D177S; A54M / G112S / M123I / W168F / D177S; A54M / G112S / V128L / W168F / D177S; A54M / A122Q / M123I / D177S / G258T; A54M / A122Q / V128L / D177S / G258T; E81D; E81D / S109N; E81D / G112S; E81D / A122Q; E81D / M123I; E81D / V128L; E81D / W168F; E81D / D177S; E81D / G258T; E81D / S109N / A122Q; E81D / S109N / M123I; E81D / S109N / D177S; E81D / G112S / M123I; E81D / G112S / W168F; E81D / A122Q / M123I; E81D / A122Q / V128L; E81D / A122Q / D177S; E81D / M123I / W168F; E81D / M123I / D177S; E81D / M123I / G258T; E81D / W168F / D177S; E81D / S109N / W168F / D177S; E81D / G112S / A122Q / D177S; E81D / A122Q / M123I / G258T; E81D / M123I / W168F / G258T; E81D / W168F / D177S / G258T; E81D / G112S / M123I / W168F / D177S; E81D / G112S / V128L / W168F / D177S; E81D / A122Q / V128L / D177S / G258T; S109N; S109N / A122Q; S109N / M123I; S109N / W168F; S109N / A122Q / V128L; S109N / M123I / W168F; S109N / V128L / D177S; S109N / A122Q / M123I / W168F; S109N / A122Q / W168F / D177S; S109N / A122Q / V128L / W168F / D177S; G112S; G112S / A122Q; G112S / M123I; G112S / D177S; G112S / A122Q / W168F; G112S / M123I / V128L; G112S / A122Q / M123I / W168F; G112S / A122Q / V128L / D177S; G112S / A122Q / V128L / W168F / D177S; A122Q; A122Q / M123I; A122Q / V128L; A122Q / D177S; A122Q / G258T; A122Q / M123I / V128L; A122Q / M123I / W168F; A122Q / W168F / D177S; A122Q / D177S / G258T; A122Q / M123I / V128L / D177S; A122Q / W168F / D177S / G258T; M123I; M123I / W168F; M123I / D177S; M123I / G258T; M123I / V128L / W168F; M123I / V128L / D177S; M123I / W168F / D177S; M123I / W168F / D177S / G258T; V128L; V128L / W168F; V128L / D177S; V128L / W168F / D177S; V128L / W168F / D177S / G258T; W168F; W168F / D177S; W168F / G258T; W168F / D177S / G258T; D177S; D177S / G258T; G258T.

6. A DNA molecule encoding any of the mutants described in claims 1-5.

7. A recombinant expression plasmid comprising the DNA molecule of claim 6.

8. A host cell comprising the recombinant expression plasmid of claim 7.

9. The host cell as described in claim 8, characterized in that, The host cell is *Trichoderma reesei* ( Trichoderma reesei ).