Antisense oligonucleotide for promoting skipping of exon 41 of CEP290 gene and application thereof in preparation of joubert syndrome treatment drug

Abstract

This invention relates to the field of biomedicine, and more particularly to promoting... CEP290 Antisense oligonucleotides that skip exon 41 and their application in the preparation of drugs for the treatment of Joubert syndrome. This invention designs and screens an antisense oligonucleotide that... CEP290 Efficient splicing of precursor mRNA in gene expression induces exon 41 jumping to restore disrupted open reading frames, thereby promoting the production of proteins that retain key biological activity. The antisense oligonucleotides disclosed in this invention... CEP290 The mutation fluorescence reporter system efficiently induces targeted exon 41 skipping and precisely corrects the abnormal splicing caused by the c.5668G>T mutation, making the expression level of mCherry protein close to that of wild type. The efficacy is significantly better than the control sequence, showing great therapeutic potential in Joubert syndrome and related diseases.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more particularly to promoting... CEP290 Antisense oligonucleotides that skip exon 41 and their application in the preparation of drugs for the treatment of Joubert syndrome. Background Technology

[0002] Joubert syndrome (JBTS) is a rare and complex neurodevelopmental disorder that primarily follows an autosomal recessive inheritance pattern. It is classified as a ciliate disorder, a group of diseases caused by abnormalities in the structure or function of primary cilia. These non-motor, microtubule-based organelles play crucial roles in cell signaling pathways and are essential for normal embryonic development. The hallmark neuroimaging feature of JBTS is the "molar sign" (MTS), visible on axial MRI of the brain. This characteristic feature is formed by the combined effects of underdeveloped or absent cerebellar vermis, thickened and elongated superior cerebellar peduncle, and deepened interpeduncular fossa, resembling the cross-section of a molar. Clinically, JBTS presents with a range of symptoms, including hypotonia in infancy, developmental delay, ataxia (loss of muscle motor coordination), paroxysmal tachypnea or apnea (irregular breathing patterns), and oculomotor apraxia (disorder of voluntary eye movement). In addition to these core neurological features, JBTS often involves multisystem complications such as retinal dystrophy (leading to progressive vision loss), nephronial tuberculosis (a cystic kidney disease that can progress to kidney failure), liver fibrosis, and polydactyly. The prevalence of JBTS is estimated at 1.7 cases per 100,000 people aged 0–19 years, but this figure may underestimate the true incidence due to diagnostic challenges, particularly in mild or atypical cases. JBTS exhibits significant genetic heterogeneity, with more than 40 pathogenic genes currently identified. These genes encode proteins essential for the formation and function of primary cilia.

[0003] One of the most common mutant genes associated with JBTS is centrosome protein 290 ( CEP290 Also known as JBTS5 (especially in patients exhibiting the cerebellar-retinal-renal phenotype). CEP290 The gene is located on chromosome 12q21.32, contains 54 exons, and encodes a protein of 2479 amino acids located in the transition region of primary cilia. This region acts as a gatekeeper, regulating the entry and exit of proteins essential for cilia function and signaling pathways such as Sonic Hedgehog (Shh). CEP290 Mutations disrupt the composition of ciliary proteins, ciliation, and ciliary length, leading to phenotypic characteristics such as ciliary elongation and impairing cell signaling. CEP290Its importance extends beyond JBTS, encompassing a wide range of other cilia disorders such as Leber congenital amaurosis, Senior-Løken syndrome, Bardet-Biedl syndrome, and Meckel-Grüber syndrome, representing a spectrum of cilia disorders ranging from isolated visual impairment to multi-organ fatal diseases. The most common cilia disorders associated with JBTS5 are... CEP290 One of the pathogenic mutations is the nonsense mutation c.5668G>T in exon 41, which leads to premature termination codon ( This mutation triggers nonsense-mediated mRNA degradation (NMD), significantly reducing functionality. CEP290 The level of protein, or the production of truncated nonfunctional proteins. Studies in patient-derived fibroblasts and kidney cells have shown that this mutation leads to ciliary elongation, defective ciliary protein transport, and impaired ciliogenesis, highlighting its role in the pathogenesis of JBTS5. In addition to this mutation, CEP290 Exon 41 also contains other pathogenic variants, such as the c.5704G>T mutation. This specific mutation results in the substitution of guanine for thymine, thus creating a premature stop codon at position 1902 of the protein. Similar to the c.5668G>T mutation, it may trigger nonsense-mediated mRNA degradation or produce truncated mRNA. CEP290 Proteins ultimately lead to the occurrence of JBTS.

[0004] Currently, there is no cure for JBTS; treatment primarily focuses on supportive care to manage symptoms. Developmental delays are addressed through physical therapy, occupational therapy, speech therapy, and infant stimulation programs. For irregular breathing patterns, apnea monitoring and supportive care, such as stimulating medications and supplemental oxygen, are employed; in rare cases, mechanical support or tracheotomy may be necessary. Corrective lenses can be used to correct optical refractive errors. The disease is associated with serious complications such as retinal degeneration and nephropathy, which can progress to end-stage renal failure by an average age of 13. However, the slow progression of nephropathy in many cases provides a critical time window for potential therapeutic interventions. One promising treatment approach is the use of antisense oligonucleotide (ASO) technology. ASOs are short, single-stranded nucleic acid molecules designed to hybridize with target RNA via Watson / Crick base pairing. ASO-mediated RNA splicing regulation has become an important technological platform for developing novel therapies. In recent years, an increasing number of ASO drugs have been approved by the U.S. Food and Drug Administration (FDA) and the European Medicines Agency (EMA), demonstrating significant efficacy in various diseases. Antisense oligonucleotides (ASOs) can regulate gene expression through multiple mechanisms, including RNA interference, ribonuclease H-mediated degradation, splicing regulation, non-coding RNA repression, gene activation, and programmed genome editing. ASO-based therapies have shown significant potential in addressing genetic diseases. ASOs can be designed to promote exon skipping by binding to splicing repressive elements, such as nusinersen for treating spinal muscular atrophy, or to induce exon skipping by targeting splicing stimuli, a strategy used to treat Duchenne muscular dystrophy. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the existing technology and provide a way to promote... CEP290 Antisense oligonucleotides that skip exon 41 and their application in the preparation of drugs to alleviate or treat JBTS or related diseases.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a method for promoting CEP290 Antisense oligonucleotides that skip exon 41 of a gene, specifically targeting CEP290 The region on the precursor mRNA corresponding to nucleotides 25 to 48 of exon 41 induces exon 41 skipping at the splicing level, thereby producing functional mature mRNA lacking exon 41.

[0007] Currently, Joubert syndrome is a rare genetic disorder for which there is no effective treatment. Because... CEP290The modular structure of the protein contains repeating coiled-coil domains, indicating that the loss of a single domain (encoded by exon 41) does not completely disrupt protein function; therefore, ASO is well-suited as a therapeutic strategy for JBTS. In vitro and in vivo studies have demonstrated that... CEP290 Restoration of protein function can salvage the ciliary phenotype. Furthermore, ASO offers a personalized treatment approach targeting specific mutations, with a transient mechanism of action that minimizes long-term risks compared to permanent gene-editing strategies. The antisense oligonucleotides designed in this invention... CEP290 Precursor mRNA binding to gene expression, the target region in the genome is shown in SEQ ID NO. 63, and the corresponding precursor mRNA target sequence is shown in SEQ ID NO. 65, which can promote exon 41 skipping ( Figure 1 It can restore open reading frame disruption caused by mutations, thereby promoting the production of proteins that retain key biological activity, and has the potential to treat Joubert syndrome or related diseases.

[0008] Preferably, the nucleotide sequence of the antisense oligonucleotide is selected from any one of the sequences shown in SEQ ID NO. 11 to SEQ ID NO. 15, or has at least 70%, 80%, 85%, 90%, or 95% sequence identity with any one of the sequences shown in SEQ ID NO. 11 to SEQ ID NO. 15, and has the ability to induce... CEP290 The activity of gene exon 41 skipping.

[0009] This invention first designed 10 ASO sequences targeting 155 nucleotides each (their genomic sequences are shown in SEQ ID NO. 64, and the corresponding precursor mRNA target sequences are shown in SEQ ID NO. 66). Each ASO is 20 nucleotides long, with 5 nucleotides overlapping between adjacent ASOs. ASO activity was tested in vitro in HEK293 cells; the positive control (SEQ ID NO. 62), 25 nucleotides long, showed significant promotion... CEP290 ASO targeting exon 41 skipping, specifically the 5′ splicing site of this exon (Ramsbottom SA et al. 2018, Proc Natl Acad Sci USA; PMID: 30446612); the buffer group (without ASO during cell transfection) served as a negative control. Analysis of ASO-induced changes in endogenous gene exon 41 splicing using semi-quantitative RT-PCR (sqRT-PCR) revealed that SEQ ID NO. 04 and SEQ ID NO. 09 significantly promoted exon 41 skipping. Among them, the ASO targeting the GAAGAA potential splice enhancer (ESE) region of the exon (SEQ ID NO. 04) showed the highest exon skipping percentage (%skip).

[0010] Furthermore, based on the superior performance of SEQ ID NO. 04, a total of 15 ASOs (SEQ ID NO. 11 to SEQ ID NO. 25) were designed, each ASO being 20 nucleotides in length. Adjacent ASOs were shifted one nucleotide in position. In vitro cell assays showed that all ASOs significantly promoted exon 41 skipping compared to the buffer group, with several ASOs significantly outperforming the positive control ASO (SEQ ID NO. 62). The five best-performing ASOs were SEQ ID NO. 11 to SEQ ID NO. 15.

[0011] Based on the above conclusions, those skilled in the art will understand that, while maintaining the core sequence function, individual nucleotide substitutions can be made to the above five preferred antisense oligonucleotides without disrupting target binding, for example, substitutions that induce... CEP290 Exon 41 skipping activity and variants with at least 70%, 80%, 85%, 90%, or 95% sequence identity with the original sequence can all achieve splicing regulation effects that are essentially equivalent to the original sequence.

[0012] More preferably, the nucleotide sequence of the antisense oligonucleotide is as shown in SEQ ID NO.11 or SEQ ID NO.14, or has at least 70%, 80%, 85%, 90%, or 95% sequence identity with the sequences shown in SEQ ID NO.11 or SEQ ID NO.14, and has inducing properties. CEP290 The activity of gene exon 41 skipping.

[0013] Preferably, the antisense oligonucleotide is formed by covalently linking a nucleotide of sequence SEQ ID NO.11 with a 5′ splice site decoy sequence via a phosphodiester bond; the 5′ splice site decoy sequence is selected from any one of the sequences shown in SEQ ID NO.50 to SEQ ID NO.61; the decoy sequence is attached to the 5′ end or the 3′ end of the antisense oligonucleotide.

[0014] The above structure is the bipartite ASO designed in this invention, implemented using the 5D-ASO technology (WO2024067885A1) to promote exon skipping: This invention uses SEQ ID NO.11 as the target sequence in the ASO, adding a short 5′ splice site decoy (5D) sequence to one side, thereby enhancing the exon skipping effect by trapping U1 snRNA. The 5′ splice site decoy sequence is selected from any one of the sequences shown in SEQ ID NO.50 to SEQ ID NO.61, and is covalently linked to the 5′ or 3′ end of SEQ ID NO.11 via a phosphodiester bond. The bipartite ASO sequences designed for SEQ ID NO.11 are named SEQ ID NO.26 to SEQ ID NO.49. These bipartite antisense oligonucleotides simultaneously retain the activity of binding to the target gene and the function of competitively binding U1 snRNA to the 5′ splice site.

[0015] This invention utilizes 5D-ASO technology to construct binary ASOs based on rigorously screened antisense oligonucleotides (SEQ ID NO. 11), thereby further improving the exon skipping efficiency of ASOs. Specifically, the 5D-ASO technology involves attaching a 7-9 nt sequence (a total of 12 sequences, SEQ ID NO. 50 to SEQ ID NO. 61) to the 5′ or 3′ end of the ASO sequence targeting the precursor mRNA. This type of sequence can perfectly complement a portion of the single-stranded free region at the 5′ end of U1 snRNA, thus acting as a 5′ splice site decoy, interfering with the recognition of the actual 5′ splice site near the target exon by U1 snRNP, thereby improving the exon skipping efficiency.

[0016] For ease of description, in this invention, such 5′ splice site decoy sequences are simply referred to as "5D," "5D sequence," "decoy," or "decoy sequence"; di-antisense oligonucleotides are simply referred to as "5D-ASO" or "5D ASO"; and those containing only CEP29 The ASO of the exon 41 target sequence (i.e., without the 5D sequence) is simply referred to as the unit ASO.

[0017] After extensive combination screening, this invention found that when a specific decoy sequence is connected to the 5′ or 3′ end of SEQ ID NO. 11 in a specific direction, it can synergistically enhance the jumping efficiency of exon 41, and its effect is better than that of SEQ ID NO. 11 without 5D modification.

[0018] Preferably, the nucleotide sequence of the antisense oligonucleotide is selected from any one of the sequences shown in SEQ ID NO.26 to SEQ ID NO.49, or has at least 70%, 80%, 85%, 90%, or 95% sequence identity with any one of the sequences shown, and has the ability to induce CEP290 The activity of gene exon 41 skipping.

[0019] Specifically, using SEQ ID NO. 11 as the target sequence, 12 decoy sequences shown in SEQ ID NO. 50 to SEQ ID NO. 61 were linked to its 5′ or 3′ ends, respectively, constructing a total of 24 binary antisense oligonucleotides (SEQ ID NO. 26 to SEQ ID NO. 49). In vitro splicing activity assays showed that SEQ ID NO. 27, SEQ ID NO. 28, SEQ ID NO. 31, SEQ ID NO. 32, SEQ ID NO. 33, SEQ ID NO. 35, and SEQ ID NO. 36 induced... CEP290 The skipping activity of exon 41 was significantly better than that of SEQ ID NO.11 without decoy sequence modification, with SEQ ID NO.28 having the highest skipping percentage. Figure 5 ).

[0020] The above results indicate that the strategy of connecting a specific 5D sequence to the 5′ or 3′ end of SEQ ID NO.11 can synergistically improve exon skipping efficiency.

[0021] Based on the above conclusions, those skilled in the art will understand that, while maintaining the core sequence function, individual nucleotide substitutions can be made to the above seven preferred di-antsense oligonucleotides without disrupting target binding and decoy functions, for example, retaining the inducing function. CEP290 Exon 41 skipping activity and variants with at least 70%, 80%, 85%, 90%, or 95% sequence identity with the original sequence can all achieve splicing regulation effects that are essentially equivalent to the original sequence.

[0022] Preferably, the antisense oligonucleotide is selected from any one of the sequences shown in SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.35, or SEQ ID NO.36, or has at least 70%, 80%, 85%, 90%, or 95% sequence identity with any one of the sequences shown therein, and has the inducing effect. CEP290 The activity of gene exon 41 skipping.

[0023] More preferably, the sequence of the antisense oligonucleotide is as shown in SEQ ID NO. 28, or has at least 70%, 80%, 85%, 90%, or 95% sequence identity with the sequence shown in SEQ ID NO. 28, and has inducing properties. CEP290 The activity of gene exon 41 skipping.

[0024] Preferably, the antisense oligonucleotide is a chemically modified single-stranded oligonucleotide.

[0025] The present invention also discloses the above-mentioned chemically modified single-stranded antisense oligonucleotides, comprising one or more nucleotides chemically modified in one or more ways known to those skilled in the art.

[0026] The chemical modification is selected from at least one of nucleoside backbone modification, ribose site modification, base modification, or phosphate linker site modification. Through the above single or combined modifications, the in vivo nuclease stability and target sequence binding affinity of antisense oligonucleotides are improved, and non-specific immunogenicity is reduced, which is suitable for the long-term in vivo administration needs of Joubert syndrome and related diseases.

[0027] Preferably, the chemical modification includes at least one of the following modifications: (a) In each nucleoside unit of the antisense oligonucleotide, the natural monomeric glycosyl group is optionally 2′- O -Methoxyethyl(2′-MOE), 2′- O -Methyl(2′-OMe), 2′-fluoro(2′-F), 2′- O Modification with at least one of -[2-(methylamino)-2-oxoethyl](2′-O-NMA), locked nucleic acid (LNA), or restricted ethyl (cEt); (b) One of the non-bridging oxygen atoms in some or all of the phosphodiester bonds connecting adjacent nucleoside monomers is replaced by a sulfur atom; (c) In one or more nucleotide units of the antisense oligonucleotide, the nucleoside base is modified with at least one of 5-methylcytosine (5mC), 5-hydroxymethylcytosine (5hmC) or pseudouracil (Ψ).

[0028] Preferably, the antisense oligonucleotides disclosed in this invention further include, but are not limited to, at least one of the following: phosphodiamidomorpholino (PMO, in which the five-membered furanose ring of natural ribose in each nucleoside unit of the antisense oligonucleotide is replaced by a six-membered morpholino ring, and adjacent morpholino ring units are covalently linked by a neutral phosphoryl diamine group), tricyclic DNA (tcDNA, in which the five-membered furanose ring of natural ribose in each nucleoside unit of the antisense oligonucleotide is replaced by a rigid tricyclic sugar ring, and adjacent tricyclic nucleoside units are covalently linked by a natural phosphodiester bond or a modified neutral backbone), and peptide nucleic acid (PNA, in which the natural ribose-phosphate backbone of each nucleoside unit of the antisense oligonucleotide is replaced by a neutral N-(2-aminoethyl)glycine peptide chain backbone, and the bases are covalently linked to the polypeptide backbone by a methylene carbonyl group).

[0029] The above modifications are independent of each other and can be used to modify the entire sequence of oligonucleotide nucleosides as a whole, or to selectively modify any part of the nucleoside site. Furthermore, different types of chemical modifications can be contained in the same oligonucleotide molecule at the same time.

[0030] Preferably, the thymine (T) in the antisense oligonucleotide sequence disclosed in this invention can be independently replaced with uracil (U). The variants where thymine is replaced with uracil also apply to any of the chemical modifications described above (including but not limited to 2′- O -Methoxyethyl modification, 2′- O α-methyl modification or phosphodiamid morpholine modification, etc.

[0031] It should be noted that U substitution for T does not alter the Watson-Crick base pairing pattern between the oligonucleotide and the target; therefore, this type of substitution will not affect the variant's induction. CEP290 The core function of exon 41 skipping has a substantial negative impact. Furthermore, compared to thymine, uracil, lacking a methyl group at the 5-position, can reduce intermolecular hydrophobic interactions under certain chemical modifications (e.g., but not limited to the neutral backbone of PMOs), which is beneficial for reducing the tendency for sequence self-aggregation and improving formulation properties. Based on the fundamental principle that this substitution does not change the base pairing specificity, those skilled in the art can selectively replace one or more thymines in the sequence with uracil, depending on formulation requirements or in vivo administration scenarios, without altering the target binding specificity.

[0032] Secondly, the present invention also discloses in CEP290 A screening method for ASOs whose gene expression splicing level promotes exon 41 skipping includes the following steps: S1: Initial screening of ASOs that show some effectiveness; S2: Optimize ASO based on preliminary screening results; S3: Based on the screening results of S2, a more effective binary ASO is constructed using 5D-ASO technology.

[0033] Both S1 and S2 involve stepwise screening and optimization.

[0034] In S3, the optimal ASO obtained after optimization in S1 and S2 is used to improve the efficiency of ASO in promoting exon skipping.

[0035] Thirdly, the present invention provides a pharmaceutical composition comprising the above-described antisense oligonucleotide and a pharmaceutically acceptable carrier.

[0036] Preferably, the pharmaceutically acceptable carrier is adapted to the in vivo drug delivery requirements of Joubert syndrome and related diseases, supporting multiple routes of administration such as parenteral, intrathecal, intravenous, subcutaneous, intraperitoneal and intramuscular administration, and can meet the in vivo drug delivery application scenarios for the clinical treatment of such diseases.

[0037] Fourthly, the present invention provides the use of the above-mentioned antisense oligonucleotides or pharmaceutical compositions thereof in the preparation of medicaments for alleviating or treating Joubert syndrome or related diseases.

[0038] Preferably, the related diseases include, but are not limited to, Leber congenital amaurosis, Meckel-Grüber syndrome, Senior-Løken syndrome, nephron tuberculosis, retinal dystrophy / retinitis pigmentosa, Bardet-Biedl syndrome, etc. CEP290 Diseases caused by mutations in exon 41 of the gene, or hereditary kidney damage and retinal dystrophy-related complications associated with Joubert syndrome.

[0039] The beneficial effects of this invention are as follows: (1) The present invention provides an antisense oligonucleotide obtained through screening, which can specifically target CEP290 The strategy involves efficiently inducing exon 41 skipping at the splicing level in the pre-gene mRNA exon 41 region, producing a protein that retains key biological activities. This strategy directly targets the pathogenic mechanisms of Joubert syndrome and related diseases at the molecular level, demonstrating a clear targeting and mechanism of action.

[0040] (2) The binary antisense oligonucleotide further constructed in this invention promotes exon 41 jumping activity better than ASO without 5D modification, demonstrating the technical effect of synergistic enhancement.

[0041] (3) The antisense oligonucleotides disclosed in this invention show promising application prospects in the preparation of drugs for alleviating or treating Joubert syndrome or related diseases, and are expected to provide a highly efficient and specific gene therapy strategy for related patients. Attached Figure Description

[0042] Figure 1 for CEP290 A schematic diagram of the mechanism of exon 41 skipping therapy.

[0043] Figure 2 The results of the activity assays of 10 initial screening ASOs designed for the target region of 155 nucleotides (SEQ ID NO. 66) in this invention; after ASO transfection into HEK293 cells cultured in vitro, the effects of promoting endogenous [activity] were analyzed. CEP290 The effect of gene exon 41 skipping; the above figure is a representative sqRT-PCR electrophoresis image from one of three independent experiments (n = 3); where FL: full-length transcript; Δ41: transcript that skipped exon 41; %skip: percentage of exon 41 skipping; This indicates that compared with the buffer control group, P < 0.05; This indicates that compared with the buffer control group, P < 0.01.

[0044] Figure 3 The activity assay results of 15 ASOs (SEQ ID NO.11 to SEQ ID NO.25) designed targeting the sequence near the target site of SEQ ID NO.04 were obtained; after ASOs were transfected into HEK293 cells in vitro, their effects on the endogenous activity of HEK293 cells were analyzed. CEP290 The effect of exon 41 skipping in genes; the image above is a representative sqRT-PCR electrophoresis image from one of three independent experiments (n = 3); where FL: full-length transcript; Δ41: transcript that skipped exon 41; %skip: percentage of exon 41 skipping; ## indicates that compared with the buffer control group, P<0.001; ## indicates that compared with the SEQ ID NO.62 control group, P<0.01; ### indicates that compared with the SEQ ID NO.62 control group, P<0.001.

[0045] Figure 4 The results of fluorescence microscopy verification of the efficacy of one of the best ASOs (SEQ ID NO.11) are shown in Figure A; Figure A is a schematic diagram of ASO-mediated exon skipping; the upper part of Figure B is a bright-field microscopy image, and the lower part is a red fluorescence field imaging image corresponding to the same field of view; WT is the wild-type reporter gene plasmid control group.

[0046] Figure 5 In response to CEP290 The 5D sequence screening results (MOE / PS / 5mC modification) of ASO (SEQ ID NO.11) for gene screening; the above figure is a representative sqRT-PCR electrophoresis image (n = 3) from three independent experiments; where FL: full-length transcript; Δ41: transcript skipping exon 41; %skip: percentage of exon 41 skipped; # indicates that compared with the buffer control group, P<0.001; # indicates that compared with the SEQ ID NO.11 control group, P<0.05; ## indicates that compared with the SEQ ID NO.11 control group, P<0.01; ### indicates that compared with the SEQ ID NO.11 control group, P<0.001.

[0047] Figure 6 Fluorescence microscopy verification results for the optimal efficacy of binary ASO (SEQ ID NO.28); Figure A is a schematic diagram of ASO-mediated exon skipping; the upper half of Figure B is a bright-field bright-field microscopy image, and the lower half is a red fluorescence field imaging image corresponding to the same field of view; WT is the wild-type reporter gene plasmid control group. Detailed Implementation

[0048] To better illustrate the purpose, technical solutions, and advantages of this invention, the invention will be further described below in conjunction with specific embodiments. The embodiments of this invention are intended to demonstrate the technical solutions of this invention and should not be construed as limiting its scope. Although a detailed description has been provided, those skilled in the art will understand that adjustments can be made to the technical solutions described in the embodiments, or specific components can be replaced with equivalents, without changing the core principles or intent of this invention. Such adjustments or substitutions still fall within the scope and spirit of the technical solutions in the embodiments of this invention.

[0049] Unless otherwise specified, the experimental methods used in this invention are conventional methods, and the materials and reagents used are commercially available products that can be obtained through commercial channels.

[0050] The experimental procedures involved in this invention are as follows: 1. Cell Culture and Transfection HEK293 cells were cultured in Dulbecco modified Eagle medium (DMEM, Invitrogen, Carlsbad, USA) supplemented with 10% (v / v) fetal bovine serum (FBS) and antibiotics (100 U / mL penicillin and 100 mg / mL streptomycin) at 37°C and 5% CO2.

[0051] 2. ASO transfection steps (2.1) Resuspend the antisense oligonucleotide (ASO) in double-distilled water (dd water) and store it at a storage concentration of 20 μM for subsequent experiments.

[0052] (2.2) On the first day of the experiment, the cells were placed at a density of approximately 1.5 × 10⁶ cells per well. 5 The cells were seeded at a density of 100 cells per well into 12-well plates. 1 mL of complete growth medium was added to each well, and the plates were incubated overnight under standard culture conditions until the cells reached approximately 80% confluence.

[0053] (2.3) The transfection mixture was prepared as follows: Solution A: Add an exact amount of ASO to 50 μL of DMEM culture medium and mix thoroughly.

[0054] Solution B: Dilute 1.5 μL of LExFect transfection reagent in 50 μL of DMEM medium, mix gently, and equilibrate at room temperature for 5 minutes.

[0055] Mix solutions A and B by gently tapping to ensure homogeneity. Briefly centrifuge to remove air bubbles and incubate at room temperature for 20 minutes to form the transfection mixture.

[0056] (2.4) Aspirate the existing culture medium from each well and immediately add 400 μL of preheated serum-free medium to maintain cell viability. Add the transfection mixture from step (2.3) to each well and gently shake to ensure even distribution. After incubating at 37°C for 5–6 hours, replace with preheated complete growth medium to support cell recovery and continued culture.

[0057] (2.5) After incubation for another 30 hours, total RNA was extracted from the cells for downstream analysis.

[0058] 3. RNA extraction (3.1) Discard the cell culture medium, add 600 μL Trizol, let stand at room temperature for 10 minutes, repeatedly pipet and transfer to a 1.5 mL RNase-free centrifuge tube.

[0059] (3.2) Add 120 μL of chloroform (1 / 5 of the volume of Trizol), shake well to mix thoroughly, and let stand at room temperature until the layers separate.

[0060] (3.3) Centrifuge at 12,000 rpm for 15 minutes at 4°C. The sample separates into three layers: a turbid organic phase at the bottom, a white layer in the middle, and a colorless and transparent aqueous phase on top. Carefully transfer approximately 300 μL of the upper aqueous phase to a new RNase-free centrifuge tube to avoid contamination of the middle layer.

[0061] (3.4) Add an equal volume of pre-cooled isopropanol, mix by inverting, and let stand at 4°C for 10 minutes.

[0062] (3.5) Centrifuge at 12000 rpm for 10 minutes at 4℃, discard the supernatant, and a white precipitate will be visible. Add 800 μL of 75% ethanol to wash the precipitate.

[0063] (3.6) Add 800 μL of 75% ethanol and shake until a white precipitate floats up.

[0064] (3.7) Centrifuge at 12,000 rpm for 5 minutes at 4°C and discard the supernatant completely.

[0065] (3.8) Open the centrifuge tube cap and dry the sample in a laminar flow hood. Add an appropriate amount of purified water treated with diethyl pyrocarbonate (DEPC) according to the amount of precipitate. After the RNA is completely dissolved, determine its concentration and purity using Nanodrop and store at -80℃.

[0066] 4. Semi-quantitative RT-PCR (sqRT-PCR) The labeled RT-PCR reverse transcription system consisted of 20 μL of 5× RT buffer (4 μL), dNTP mixture (10 mMeach) (1 μL), and Oligo (dT) solution. 18 1 μL of (50 μM) total RNA, 1 μg of total RNA, 1 μL of M-MLV reverse transcriptase, and 12 μL of water were incubated at 42℃ for 50 minutes and then at 65℃ for 15 minutes on a PCR instrument to obtain cDNA.

[0067] The PCR reaction system consisted of 20 μL of 2×Taq master mix (10 μL), upstream primer (1 μL), downstream primer (1 μL), cDNA (1 μL, <10% of total volume), and double-distilled water (7 μL).

[0068] The PCR program is as follows: 1) 95℃ for 2 minutes; 2) 95℃ for 10 seconds; 3) 57℃ for 20 seconds; 4) 72℃ for 35 seconds, repeat steps 2-4 30 times; 5) 72℃ for 5 minutes.

[0069] 5. Design of reaction primers For endogenous CEP290 : Exon 40-F: 5′-GAACTGCAAAAGAAACAAAAAGCC-3′; Cy5-Exon 42-R: 5′-GTAAAGACTTCCCCTCTCTTTCTC-3′.

[0070] Cy5-labeled PCR products were separated using a 6% natural polyacrylamide gel and subsequently imaged for fluorescence using a G: BOX Chem XL system (Syngene, Cambridge, UK). Fluorescence signals were quantified using ImageJ software, and the skipping rate of exon 41 was calculated as a percentage of total spliced ​​transcripts (%skip).

[0071] 6. This invention designs a total of 49 antisense oligonucleotides (SEQ ID NO. 01 to SEQ ID NO. 49), covering the entire exon 41 and its surrounding intron sequences; SEQ ID NO. 62 is a positive control sequence; SEQ ID NO. 63 is the sequence of the target region in the genome determined through fine screening; and SEQ ID NO. 65 is its corresponding precursor mRNA target sequence, which spans... CEP290 Nucleotides 25 to 48 of exon 41; SEQ ID NO. 64 is the target site for the initial screening stage. CEP290 The sequence of a 155 nt target nucleotide in the genome, SEQ ID NO.66 is its corresponding precursor mRNA sequence.

[0072] All ASOs are chemically modified as follows: all sugar groups are modified by 2′- O The methoxyethyl modification, the cytosine bases are all modified with 5-methylcytosine, and the non-bridging oxygen atoms in the phosphodiester bonds connecting all adjacent nucleoside units are replaced with sulfur atoms (MOE / PS / 5mC) to enhance its stability and efficacy.

[0073] The designed antisense oligonucleotide sequence (5′-3′) is as follows: SEQ ID NO.01:TTGCCCTAAAAAATAAAATG, SEQ ID NO.02:TTATCTGTCAGGGGTTTGCC, SEQ ID NO.03:ATTAGACTTTGTTTATTATC, SEQ ID NO.04:CTTTGGAGTCTTCAATTAG, SEQ ID NO.05:AGTTTTTTTAACTTTCCTTTG, SEQ ID NO.06:TCTAATTGGTTCTCTAGTTT, SEQ ID NO.07:TCCTCCACCTTTCACTCTAA, SEQ ID NO.08:GGTTTTAGGTCTACTTCCTC, SEQ ID NO.09:ACCTTTTCTTTCATAGGTTT, SEQ ID NO.10:TATGTTTCTTCACATACCTT, SEQ ID NO.11:AGTTCTTCAATTAGACTTTG, SEQ ID NO.12:GAGTTCTTCAATTAGACTTT, SEQ ID NO.13:GGAGTTCTTCAATTAGACTT, SEQ ID NO.14:TGGAGTTCTTCAATTAGACT, SEQ ID NO.15:TTGGAGTTCTTCAATTAGAC, SEQ ID NO.16:TTTGGAGTTCTTCAATTAGA, SEQ ID NO.17:CCTTTGGAGTTCTTCAATTA, SEQ ID NO.18:TCCTTTGGAGTTCTTCAATT, SEQ ID NO.19:TTCCTTTGGAGTTCTTCAAT, SEQ ID NO.20:TTTCCTTTGGAGTTCTTCAA, SEQ ID NO.21:CTTTCCTTTGGAGTTCTTCA, SEQ ID NO.22:ACTTTCCTTTGGAGTTCTTC, SEQ ID NO.23:AACTTTCCTTTGGAGTTCTT, SEQ ID NO.24:TAACTTTCCTTTGGAGTTCT, SEQ ID NO.25:TTAACTTTCCTTTGGAGTTC, SEQ ID NO.26:CAGGTAAAGTTCTTCAATTAGACTTTG, SEQ ID NO.27:AGGTAAGAGTTCTTCAATTAGACTTTG, SEQ ID NO.28:GGTAAGTAGTTCTTCAATTAGACTTTG, SEQ ID NO.29:GTAAGTAAGTTCTTCAATTAGACTTTG, SEQ ID NO.30:TAAGTATAGTTCTTCAATTAGACTTTG, SEQ ID NO.31: CAGGTAAGAGTTCTTCAATTAGACTTTG, SEQ ID NO.32:AGGTAAGTAGTTCTTCAATTAGACTTTG, SEQ ID NO.33:GGTAAGTAAGTTCTTCAATTAGACTTTG, SEQ ID NO.34:GTAAGTATAGTTCTTCAATTAGACTTTG, SEQ ID NO.35:CAGGTAAGTAGTTCTTCAATTAGACTTTG, SEQ ID NO.36:AGGTAAGTAAGTTCTTCAATTAGACTTTG, SEQ ID NO.37:GGTAAGTATAGTTCTTCAATTAGACTTTG, SEQ ID NO.38:AGTTCTTCAATTAGACTTTGCAGGTAA, SEQ ID NO.39:AGTTCTTCAATTAGACTTTGAGGTAAG, SEQ ID NO.40:AGTTCTTCAATTAGACTTTGGGTAAGT, SEQ ID NO.41:AGTTCTTCAATTAGACTTTGGTAAGTA, SEQ ID NO.42:AGTTCTTCAATTAGACTTTGTAAGTAT, SEQ ID NO.43:AGTTCTTCAATTAGACTTTGCAGGTAAG, SEQ ID NO.44:AGTTCTTCAATTAGACTTTGAGGTAAGT, SEQ ID NO.45:AGTTCTTCAATTAGACTTTGGGTAAGTA, SEQ ID NO.46:AGTTCTTCAATTAGACTTTGGTAAGTAT, SEQ ID NO.47:AGTTCTTCAATTAGACTTTGCAGGTAAGT, SEQ ID NO.48:AGTTCTTCAATTAGACTTTGAGGTAAGTA, SEQ ID NO. 49: AGTTCTTCAATTAGACTTTGGGTAAGTAT.

[0074] The 5′ splice site decoy sequence (5′-3′) is as follows: SEQ ID NO.50: CAGGTAA SEQ ID NO.51:AGGTAAG SEQ ID NO.52:GGTAAGT SEQ ID NO.53: GTAAGTA SEQ ID NO.54: TAAGTAT SEQ ID NO.55: CAGGTAAG SEQ ID NO.56:AGGTAAGT SEQ ID NO.57: GGTAAGTA SEQ ID NO.58:GTAAGTAT SEQ ID NO.59:CAGGTAAGT SEQ ID NO.60: AGGTAAGTA SEQ ID NO.61:GGTAAGTAT The positive control sequence (5′-3′) is as follows: SEQ ID NO. 62: ATGTTTTCTTCACATACCTTTTCTTT.

[0075] The target sequence in the genome (5′-3′) is as follows: SEQ ID NO.63:CAAAGTCTAATTGAAGAACTCCAA, SEQ ID NO.64: CATTTTATTTTTTAGGGCAAACCCCTGACAGATAATAAACAAAGTCTAATTGAAGAACTCCAAAGGAAAGTTAAAAAACTAGAGAACCAATTAGAGTGAAAGGTGGAGGAAGTAGACCTAAAACCTATGAAAGAAAAGGTATGTGAAGAAACATA.

[0076] The corresponding precursor mRNA target sequence (5′-3′) is: SEQ ID NO.65: CAAAGUCUAAUUGAAGAACUCCAA, SEQ ID NO.66: CAUUUUAUUUUUUAGGGCAAACCCCUGACAGAUAAUAAACAAAGUCUAAUUGAAGAACUCCAAAGGAAAGUUAAAAAACUAGAGAACCAAUUAGAGUGAAAGGUGGAGGAAGUAGACCUAAAACCUAUGAAAGAAAAGGUAUGUGAAGAAACAUA.

[0077] Example 1: CEP29 Preliminary screening of exon 41 skipping ASO This embodiment designs 10 ASOs, named sequentially from SEQ ID NO.01 to SEQ ID NO.10 according to their positions from the 5′ end to the 3′ end. The target region is 155 nucleotides in length and contains... CEP290 The last 15 nucleotides of intron 40, the complete exon 41, and the first 17 nucleotides of intron 41.

[0078] Each ASO was transfected into human embryonic kidney 293 (HEK293) cells at 50 nM using the ExFect transfection reagent method. A buffer-treated group that did not receive any ASO served as a negative control. The previously reported (PMID: 30446612) promotion... CEP290 An exon 41-jumping ASO (SEQ ID NO. 62) was used as a positive control; this ASO targets the 5' splicing site between exon 41 and intron 41. The effects of ASO on endogenous... CEP290 The effect of exon 41 splicing. RNA samples collected from cells were analyzed by fluorescent RT-PCR to measure the abundance changes of full-length mRNA and mRNA lacking exon 41. The percentage of exon 41 skipping was calculated.

[0079] The results are as follows Figure 2 As shown, after testing and screening, two ASOs (SEQ ID NO.04 and SEQ ID NO.09) significantly promoted the skipping of exon 41. The skipping rate of exon 41 increased from about 6% in the buffer group to 56% and 53%, respectively, both higher than the 38% skipping rate of the control ASO (SEQ ID NO.62, the same below).

[0080] Example 2: Fine sieving optimization of ASO Based on the preliminary screening results of Example 1, this example aims to optimize the ASO targeting the region of SEQ ID NO. 04. Microstepping was performed in the vicinity of the SEQ ID NO. 04 target region with a step size of 1 nt, and the resulting ASOs were named sequentially from SEQ ID NO. 11 to SEQ ID NO. 25 according to their positions from the 5′ end to the 3′ end. Each sequence was transfected into HEK293 cells at a concentration of 50 nM. Subsequently, the splicing changes of endogenous gene precursor RNA transcripts were analyzed by fluorescently labeled RT-PCR.

[0081] The results are as follows Figure 3 As shown, several ASOs exhibited stronger activity than the control ASOs, with the five best-performing ASOs sequenced as SEQ ID NO.11 to SEQ ID NO.15, targeting nucleotides 25 to 48 of exon 41 (SEQ ID NO.65). The two most potent ASOs, SEQ ID NO.11 and SEQ ID NO.14, increased the skipping rate of exon 41 from ~1% (buffer group) to 80%. This significant effect on the natural transcript highlights their suitability for use in... CEP290 The potential of exon 41 skipping therapy in treating related diseases.

[0082] Example 3: Validation of the efficacy of SEQ ID NO. 11 using a fluorescence reporter system To evaluate the therapeutic potential of the optimized antisense oligonucleotide SEQ ID NO.11, this invention develops a fluorescent reporter system using an mCherry sequence. CEP290 WeGene detected ASO activity at the protein level. CEP290 The microgene consists of the following components in sequence: exon 40 (222 nucleotides), intron 40 (352 nucleotides), exon 41 (123 nucleotides), intron 41 (shortened to 455 nucleotides), exon 42 (146 nucleotides), the first 255 nucleotide sequence of intron 42, and the mCherry reading frame sequence. The patient's mutation c.5668G>T was introduced into exon 41 to mimic the disease genotype, creating an early stop codon that suppressed the expression of red fluorescent protein (RFP) in transfected HEK293 cells.

[0083] The plasmid expressing the mutant reporter gene was co-transfected with SEQ ID NO.11 or the control SEQ ID NO.62, and the results were as follows: Figure 4As shown, the gene was transcribed and translated normally into mCherry protein, exhibiting abundant and strong red fluorescence in the field of view. c.5668G>T was the negative control group of the mutant reporter gene plasmid (without ASO treatment). Due to the nonsense mutation of c.5668G>T, translation terminated prematurely (unable to translate mCherry), and almost no red fluorescence was observed in the field of view. c.5668G>T + SEQ ID NO.62 was the treatment group of the mutant reporter gene plasmid plus SEQ ID NO.62. This ASO induced some exon 41 skipping, restoring a small amount of mCherry protein expression, and exhibiting a darker and weaker red fluorescence in the field of view. c.5668G>T + SEQ ID NO.11 was the treatment group of the mutant reporter gene plasmid plus SEQ ID NO.11. This ASO efficiently induced exon 41 skipping (successfully crossing the mutation site), significantly restoring mCherry protein expression, and exhibiting abundant and bright red fluorescence in the field of view, with fluorescence intensity far superior to that of the SEQ ID NO.62 treatment group.

[0084] The fluorescence level induced by SEQ ID NO.11 was close to that of the wild-type construct. The significant restoration of mCherry expression after ASO transfection highlights its potential to precisely correct aberrant splicing caused by the c.5668G>T mutation and thus alleviate disease symptoms.

[0085] Example 4: 5D-ASO screening for SEQ ID NO.11 This invention utilizes 5D-ASO technology to construct binary ASOs based on a rigorously screened antisense oligonucleotide (SEQ ID NO. 11), further enhancing the exon skipping efficiency of ASOs. This embodiment focuses on screening 5D-ASOs targeting SEQ ID NO. 11. A 7-9 nt 5′ splice site decoy sequence (SEQ ID NO. 50 to SEQ ID NO. 61) is attached to its 5′ or 3′ end, resulting in 24 designed 5D ASOs, named SEQ ID NO. 26 to SEQ ID NO. 49 according to their length and position.

[0086] 5D-ASO (SEQ ID NO.26 to SEQ ID NO.49) was transfected into HEK293 cells at a concentration of 25 nM to evaluate its effect on endogenous... CEP290 Effects on the gene. RNA samples were collected, and the abundance changes of full-length mRNA and mRNA lacking exon 41 were analyzed using sqRT-PCR. The percentage of exon 41 skipping was calculated.

[0087] The results are as follows Figure 5 As shown. Under the same experimental conditions in the same batch, the buffer group CEP290The skipping rate of exon 41 was ~3%. SEQ ID NO. 27 increased the skipping rate to 63%, SEQ ID NO. 28 to 77%, SEQ ID NO. 31 to 70%, SEQ ID NO. 32 to 71%, SEQ ID NO. 33 to 75%, SEQ ID NO. 35 to 76%, and SEQ ID NO. 36 to 72%. All binary ASOs exhibited significant activity in promoting exon 41 skipping. Among them, the optimal sequence SEQ ID NO. 28 could... CEP290 The skipping rate of exon 41 was increased to 77%, significantly higher than the 54% exon skipping rate of the control unit ASO (sequence shown in SEQ ID NO. 11). This highly efficient splicing regulatory activity, validated at the level of endogenous natural transcripts in cells, fully demonstrates the effectiveness of the di-antense oligonucleotide disclosed in this invention in mediating splicing... CEP290 Therapeutic skipping of exon 41 of the gene and its clear drug potential in diseases associated with corresponding pathogenic mutations.

[0088] Example 5: Validation of the efficacy of SEQ ID NO. 28 using a fluorescence reporter system The development of the fluorescence reporting system method is the same as in Example 3.

[0089] The mutant plasmid was co-transfected with either control SEQ ID NO.28 or SEQ ID NO.62, and the results were as follows: Figure 6As shown, the gene normally transcribes and translates mCherry protein, exhibiting abundant and strong red fluorescence in the field of view. c.5668G>T represents the negative control group of the mutant reporter gene plasmid (without ASO treatment). Due to the nonsense mutation in c.5668G>T, translation terminates prematurely (unable to translate mCherry), and almost no red fluorescence is observed in the field of view. c.5668G>T + SEQ ID NO.62 represents the treatment group with the mutant reporter gene plasmid plus SEQ ID NO.62. This ASO induces partial exon 41 skipping, restoring a small amount of mCherry protein expression, and exhibits darker and weaker red fluorescence in the field of view. c.5668G>T + SEQ ID NO.28 represents the treatment group with the mutant reporter gene plasmid plus SEQ ID NO.28. The fluorescence imaging results show that this ASO highly efficiently induces exon 41 skipping, successfully bypassing the premature termination caused by the nonsense mutation and significantly restoring downstream mCherry protein expression. The field of view revealed a large amount of extremely bright red fluorescence, with fluorescence intensity and a positive cell ratio far exceeding those of the SEQ ID NO. 62 treatment group. Furthermore, the induced fluorescence level was closer to that of the wild-type construct, highlighting its superior exon skipping effect. These results indicate that 5D in SEQ ID NO. 28, by interfering with the function of U1 snRNP, achieves exon skipping efficiency beyond the ASO unit (an antisense sequence targeting only precursor mRNA), providing a superior candidate molecule for treating splicing disorders related to the c.5668G>T mutation.

[0090] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A kind of promotion CEP290 Antisense oligonucleotides that skip exon 41 of a gene, characterized by: The antisense oligonucleotide specifically targets CEP29 The region on the 0 gene precursor mRNA corresponding to nucleotides 25 to 48 of exon 41 induces exon 41 skipping at the splicing level, thereby producing a functional mature mRNA lacking exon 41.

2. The antisense oligonucleotide as described in claim 1, characterized in that, The nucleotide sequence of the antisense oligonucleotide is selected from any one of the sequences shown in SEQ ID NO. 11 to SEQ ID NO. 15, or has at least 70%, 80%, 85%, 90%, or 95% sequence identity with any one of the sequences shown in SEQ ID NO. 11 to SEQ ID NO. 15, and has inducing properties. CEP290 The activity of gene exon 41 skipping.

3. The antisense oligonucleotide as described in claim 1, characterized in that, The antisense oligonucleotide is formed by covalently linking a nucleotide of sequence SEQ ID NO. 11 with a 5′ splice site decoy sequence via a phosphodiester bond; the 5′ splice site decoy sequence is selected from any one of the sequences shown in SEQ ID NO. 50 to SEQ ID NO. 61; the decoy sequence is attached to the 5′ end or the 3′ end of the antisense oligonucleotide.

4. The antisense oligonucleotide as described in claim 3, characterized in that, The nucleotide sequence of the antisense oligonucleotide is selected from any one of the sequences shown in SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.35, or SEQ ID NO.36, or has at least 70%, 80%, 85%, 90%, or 95% sequence identity with any one of the sequences shown, and has inducing properties. CEP290 The activity of gene exon 41 skipping.

5. The antisense oligonucleotide as described in claim 1, characterized in that, The antisense oligonucleotide is a chemically modified single-stranded oligonucleotide.

6. The antisense oligonucleotide as described in claim 5, characterized in that, The chemical modification includes at least one of the following modifications: (a) In each nucleoside unit of the antisense oligonucleotide, the natural monomeric glycosyl group is optionally 2′- O -Methoxyethyl, 2′- O -methyl, 2′-fluoro, 2′- O Modification with at least one of -[2-(methylamino)-2-oxoethyl], locked nucleic acid, or restricted ethyl; (b) One of the non-bridging oxygen atoms in some or all of the phosphodiester bonds connecting adjacent nucleoside monomers is replaced by a sulfur atom; (c) In one or more nucleotide units of the antisense oligonucleotide, the nucleoside base is modified with at least one of 5-methylcytosine, 5-hydroxymethylcytosine or pseudouracil.

7. The antisense oligonucleotide as described in claim 5, characterized in that, The chemical modification is selected from at least one of phosphodiamidomorpholine, tricyclic DNA modification, and peptide nucleic acid modification.

8. The antisense oligonucleotide as described in claim 5, characterized in that, The thymine in the antisense oligonucleotide sequence is replaced with uracil.

9. A pharmaceutical composition, characterized in that, Includes the antisense oligonucleotides as described in any one of claims 1-8 and pharmaceutically acceptable carriers.

10. The use of the antisense oligonucleotide of any one of claims 1-8 or the pharmaceutical composition of claim 9 in the preparation of a medicament for relieving or treating Joubert syndrome or related diseases.

Images