Use of ZmESKIMO1 gene in improving plant salt stress tolerance and aboveground biomass

Abstract

This invention relates to the application of the ZmESKIMO1 gene in improving plant salt stress tolerance and aboveground biomass, belonging to the field of plant gene breeding technology. The nucleotide sequence of the ZmESKIMO1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by this gene is shown in SEQ ID NO.2. Overexpression of the ZmESKIMO1 gene improves plant salt stress tolerance and aboveground biomass under salt stress conditions. In plant breeding, genetic engineering technology is used to create or screen germplasm with high ZmESKIMO1 gene expression levels from natural ecotypes to obtain plant varieties with strong salt stress tolerance and high aboveground biomass under salt stress conditions. This invention conducted salt stress experiments on ZmESKIMO1 gene knockout mutant materials and gene overexpression materials, discovering and verifying that ZmESKIMO1 gene overexpression enhances plant salt stress tolerance and increases aboveground biomass under salt stress conditions.

Description

Technical Field

[0001] This invention belongs to the field of plant gene breeding technology, specifically involving the application of the ZmESKIMO1 gene in improving plant salt stress tolerance and aboveground biomass. Background Technology

[0002] Maize is one of the major food and cash crops, and excessive soil salinity is a major environmental stress factor affecting maize yield. High salinity interferes with water absorption and ion balance in maize, causing osmotic stress and ion toxicity, leading to stunted plant growth, leaf wilting, and decreased biomass accumulation, ultimately resulting in yield loss. Phenotypic, early salt stress may manifest as leaf wilting and slow growth; if not addressed promptly, it can trigger oxidative stress and metabolic disorders, and in severe cases, even plant death.

[0003] Currently, field salinization problems are largely addressed through irrigation regulation or chemical amendments, but these methods are costly and may cause secondary environmental damage. Therefore, discovering and utilizing natural salt-tolerant genes to cultivate salt-tolerant maize germplasm is a sustainable approach to addressing salinization stress. This not only helps improve crop adaptability in saline-alkali areas but also has significant theoretical and practical value for ensuring global maize production security. In this regard, this invention provides the application of the ZmESKIMO1 gene in improving plant salt stress tolerance and aboveground biomass. Summary of the Invention

[0004] The purpose of this invention is to provide the application of the ZmESKIMO1 gene in improving plant salt stress tolerance and aboveground biomass in order to solve the above-mentioned problems.

[0005] The present invention achieves the above objectives through the following technical solutions: This invention provides the application of the ZmESKIMO1 gene in improving plant salt stress tolerance and aboveground biomass. The nucleotide sequence of the ZmESKIMO1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0006] As a further optimization of the present invention, overexpression of the ZmESKIMO1 gene improves the salt stress tolerance of plants.

[0007] As a further optimization of the present invention, overexpression of the ZmESKIMO1 gene increases the aboveground biomass of plants under salt stress conditions.

[0008] As a further optimization of the present invention, in the process of plant breeding, genetic engineering technology is used to create or screen germplasm with high expression of the ZmESKIMO1 gene from natural ecotypes to obtain plant varieties with strong salt stress tolerance and high aboveground biomass under salt stress conditions.

[0009] As a further optimization of the present invention, the plant is corn.

[0010] The beneficial effects of this invention are as follows: This invention conducted salt stress experiments on ZmESKIMO1 gene knockout mutants and gene overexpression materials. Phenotypic observation and physiological and biochemical index detection revealed that knockout mutant plants were sensitive to salt, while overexpression plants exhibited strong salt tolerance. Statistical and comparative analysis of aboveground biomass showed that under salt stress, the aboveground biomass of knockout mutant plants was significantly lower than that of wild-type plants, while the aboveground biomass of overexpression plants was significantly higher than that of wild-type plants. This comprehensive analysis validates that the ZmESKIMO1 gene positively regulates plant salt stress tolerance and aboveground biomass under salt stress. This finding provides key gene targets and genetic resources for the breeding of salt-tolerant maize varieties. Attached Figure Description

[0011] Figure 1 Electrophoresis image of full-length ZmESKIMO1 CDS amplification; Figure 2 Results of mutation site identification for gene knockout mutant materials; Figure 3 Phenotypes of wild-type and gene knockout mutant lines; Figure 4 The results of SOD enzyme activity assays for wild-type and gene knockout mutant lines are shown. Figure 5 The results of proline determination in wild-type and gene knockout mutant lines; Figure 6 The statistical results of sodium and potassium element distribution and content in wild-type and gene knockout mutant lines; Figure 7 The aboveground biomass statistics for wild-type and gene knockout mutant lines; Figure 8 Seedling phenotypes of wild-type and gene-overexpressing lines; Figure 9 The aboveground biomass statistics are for wild-type and gene-overexpressing lines. Figure 10 The seedling phenotypes of wild-type, gene knockout mutant, and overexpression lines are represented.

[0012] Figure 11Growth phenotypes of wild-type, gene knockout mutant, and overexpression lines in the Aksu saline-alkali experimental field in Xinjiang. Detailed Implementation

[0013] The present application will now be described in further detail. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0014] I. Experimental Materials Unless otherwise specified, all methods used in this invention are conventional methods known to those skilled in the art, and all reagents and materials used are commercially available products.

[0015] II. Experimental Methods 1. Cloning of the ZmESKIMO1 gene Using wild-type maize variety B73 as background material, RNA was extracted, and the extracted total RNA was reverse transcribed to synthesize the first strand of cDNA, which was then used as a template for PCR amplification to obtain a 1668 bp gene fragment (e.g., Figure 1 (As shown). The obtained gene fragment was ligated into the T-cloning vector pCAMBIA1305, and the resulting responsive vector was transformed into E. coli. Positive clones were picked and sequenced. The sequencing results were consistent with the predicted results, and the nucleotide sequence shown in SEQ ID NO.1 and the corresponding amino acid sequence shown in SEQ ID NO.2 were obtained.

[0016] The sequences of the specific primers used for PCR amplification are as follows: SEQ ID NO.3: ZmESKIMO1-F: 5'>ATGCAGCAGCGGCGCAAG<3'; SEQ ID NO.4: ZmESKIMO1-R: 5'>CTACTGCTGGGCCTGGGC<3'.

[0017] 2. Obtaining gene knockout mutant materials The ZmESKIMO1 gene in maize was knocked out using CRISPR / Cas9 technology. Two sgRNA target sites were designed based on the ZmESKIMO1 cDNA sequence. The oligonucleotide sequence of the sgRNA was introduced into the sgRNA-WMV vector via PCR amplification using CRISPR / Cas9 technology. Wild-type KN5585 plants were transformed using Agrobacterium-mediated transformation, and T0 generation positive transformants were obtained through resistance screening. ZmESKIMO1 gene knockout mutants were identified by Sanger sequencing. Knockout individuals were screened by self-crossing and successive sequencing of the target sites to obtain homozygous T3 generation gene knockout mutant materials. Figure 2 ).

[0018] The target sequence is as follows: SEQ ID NO.5: GCCGTTCGCGATGAAGCAGGCGG; SEQ ID NO. 6: GCGGGACGGTGACGCTCCCGACGG.

[0019] 3. Obtaining gene overexpression materials Using the Ubi promoter to drive the 5×MYC tag and the DNA sequence of the target gene ZmESKIMO1, a ZmESKIMO1 overexpression vector was constructed using PBI121 as the backbone vector and genetically transformed. The obtained positive transgenic seedlings were amplified and verified using specific primers to obtain ZmRCHY3 gene overexpression material.

[0020] The specific primer sequences are as follows: SEQ ID NO.7: F: CCATCGTCAACCACTACATCGAGACA; SEQ ID NO. 8: R: CTTCAGCAGGTGGGTGTAGAGCGT.

[0021] 4. Identification of the gene function of ZmESKIMO1 4.1 Field propagation and agronomic trait identification of gene knockout mutant materials Homozygous T3 generation seeds of gene knockout mutant material were sown in Hefei in spring for propagation. After single-plant pollination, the harvested maize seeds were germinated and transplanted when they reached the two-leaf stage. A control group and a salt treatment group were set up. Starting after transplanting, each pot of the control group was watered with 500ml of clean water, and each pot of the salt treatment group was watered with 500ml of 200mM salt water. Both were placed in a greenhouse at 28℃ and treated every 5 days. The cultivation substrate is a mixture of black soil and vermiculite in a 1:2 ratio. Each pot is covered with 1100g of soil, and the transplanting density is 9 plants per pot. Different materials are planted in separate pots.

[0022] (1) Identification of salt stress phenotype Two weeks later, the plants were phenotypically observed. The growth status of the plants in the salt treatment group and the control group was as follows: Figure 3 As shown, under normal conditions, there is no significant difference in growth status between the wild type (KN5585) and the gene knockout mutant. Under salt stress, the gene knockout mutant exhibits a significant salt-sensitive phenotype, and plant growth is significantly inhibited. Samples were taken from wild-type and gene knockout mutants. 0.1 g of sample was weighed from the middle of the second leaf, flash-frozen in liquid nitrogen, and then ground using a grinder. 900 μL of 0.1 mol / L phosphate buffer was added, and the mixture was vortexed for 3 minutes. The mixture was centrifuged at 3500 rpm for 10 minutes, and the supernatant was collected. The supernatant was used to determine superoxide dismutase (SOD) activity and proline (PRO) content. The results are as follows: Figure 4 , 5 The results showed that, under salt stress conditions, compared with the wild type, the SOD enzyme activity in the gene knockout mutant decreased and the proline content increased. Elemental analysis was performed using ICP-OES. Sodium and potassium ion content was measured in the aboveground parts and roots of plants in both the salt-treated and control groups. The results are as follows: Figure 6 The results showed that under normal conditions, there were no significant differences in sodium and potassium content and sodium-potassium ratio between the wild type and the gene knockout mutant; however, under salt stress, the sodium ion accumulation and sodium-potassium ratio in the aboveground parts of the mutant plants were significantly higher than those in the wild type. The above phenotypic observations and physiological and biochemical index detection results indicate that loss of function of the ZmESKIMO1 gene leads to extreme sensitivity of maize plants to salt stress and a significant decrease in salt stress tolerance.

[0023] (2) Aboveground biomass analysis Aboveground biomass refers to the total dry matter weight of the aboveground parts of a crop (including stems, leaves, ears, etc.) per unit area at a specific growth stage. It is an important indicator for assessing the growth status and yield potential of maize. The aboveground biomass of plants in the salt treatment group and the control group was statistically analyzed, and the results are as follows: Figure 7 As shown, under normal conditions, there is no significant difference in aboveground biomass between wild-type and gene knockout mutants. However, under salt stress, the aboveground biomass of gene knockout mutants is significantly lower than that of wild-type.

[0024] 4.2 Field propagation and agronomic trait identification of gene overexpression materials After the homozygous T3 generation seeds of the gene overexpression material germinated into true leaves, they were transplanted after being identified as positive by Bar test strips. A salt stress control experiment was conducted by setting up a control group and a salt treatment group. The specific operation method is the same as in Section 4.1.

[0025] Two weeks later, the growth status of the plants in the salt-treated group and the control group was as follows: Figure 8 As shown, the overexpressing plants in the salt-treated group had better growth than the control group, indicating that the ZmESKIMO1 overexpressing plants were more tolerant to salt stress than the wild type.

[0026] The aboveground biomass of plants in the salt-treated group and the control group was statistically analyzed, and the results are as follows: Figure 9 As shown, in the salt-treated group, the aboveground biomass of the overexpressing plants was significantly higher than that of the wild type.

[0027] 4.3 Greenhouse culture and phenotypic analysis of gene knockout mutants and gene overexpression materials Homozygous T3 generation plants of gene knockout mutants and overexpression materials were germinated in a greenhouse using filter paper. After transplanting into pots, they were treated as described in Section 4.1, cultured, and observed until the seedling stage. The phenotypes of the obtained plants are as follows: Figure 10 As shown, under salt stress, the growth of gene knockout mutant plants was worse than that of wild type, while the growth of overexpression plants was significantly better than that of wild type, indicating that overexpression plants had stronger salt stress tolerance.

[0028] 4.4 Field Experiments with Gene Knockout Mutants and Gene Overexpression Materials in Saline-Alkali Environments In a saline-alkali experimental field located in Aksu, Xinjiang (E: 80°29'2.00"E, N: 41°15'11.67"N), homozygous T3 generation plants of gene knockout mutants and overexpression materials were planted in saline-free and saline areas, respectively, and cultured and observed until the seedling stage. The phenotypes of the obtained plants are as follows: Figure 11 As shown, under salt stress, the growth of gene knockout mutant plants was worse than that of wild type, while the growth of overexpression plants was significantly better than that of wild type, indicating that overexpression plants had stronger salt stress tolerance.

[0029] 5. Conclusion In summary, loss of function of the ZmESKIMO1 gene results in highly salt-sensitive plants, and the aboveground biomass of mutant plants under salt stress is significantly lower than that of the wild type. Overexpression of the ZmESKIMO1 gene enhances the plant's tolerance to salt stress, and the aboveground biomass of overexpressing plants under salt stress is significantly higher than that of the wild type. Therefore, the ZmESKIMO1 gene positively regulates the salt stress tolerance and aboveground biomass of maize plants under salt stress.

[0030] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. The application of the ZmESKIMO1 gene in improving plant salt stress tolerance and aboveground biomass, characterized by: The nucleotide sequence of the ZmESKIMO1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that: Overexpression of the ZmESKIMO1 gene enhances plant tolerance to salt stress.

3. The application according to claim 1, characterized in that: Overexpression of the ZmESKIMO1 gene increases aboveground biomass in plants under salt stress conditions.

4. The application according to claim 2 or 3, characterized in that: In the process of plant breeding, genetic engineering technology is used to create or screen germplasm with high expression of the ZmESKIMO1 gene from natural ecotypes to obtain plant varieties with strong salt stress tolerance and high aboveground biomass under salt stress conditions.

5. The application according to claim 1, characterized in that: The plant in question is corn.

Images