Gene of spirea anthranilate dehydrogenase acsdh777 and application in preparing gallic acid

Abstract

This invention relates to the Astilbe shikimate dehydrogenase AcSDH777 gene and its application in the preparation of gallic acid, belonging to the field of synthetic biology. The nucleotide sequence of the Astilbe shikimate dehydrogenase AcSDH777 gene is shown in SEQ ID NO.1, and the amino acid sequence of its encoded protein is shown in SEQ ID NO.2. This invention utilizes shikimate and NADP... + Using shikimate as a substrate, a dehydrogenation reaction occurs under the catalysis of the astilbestrol shikimate dehydrogenase encoded by the aforementioned astilbestrol shikimate dehydrogenase AcSDH777, producing gallic acid. The astilbestrol shikimate dehydrogenase AcSDH777 gene of this invention encodes a shikimate dehydrogenase with high catalytic activity, capable of directly generating gallic acid from shikimate and NADP+ using these as substrates. The reaction exhibits high efficiency, strong product specificity, significant application prospects, and ease of widespread application.

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology technology, specifically relating to the Astilbe shikimate dehydrogenase AcSDH777 gene and its application in the preparation of gallic acid. Background Technology

[0002] Astilbe chinensis is a perennial erect herb belonging to the genus Astilbe in the family Saxifragaceae. It is cool in nature and astringent in taste. It is commonly used in folk medicine to treat injuries from falls and blows, rheumatic joint pain, wind-heat colds, coughs, and snake bites. It can also be used to treat stomach pain and postoperative pain.

[0003] Modern chemical composition and pharmacological studies have shown that the main active components of astilbe are astilbene and bergenin, which have anti-tumor, analgesic, blood-activating and stasis-removing, anti-inflammatory, diuretic, antitussive, expectorant, antibacterial, and anti-endotoxin effects.

[0004] Gallic acid (3,4,5-trihydroxybenzoic acid) is a high-value-added phenolic acid compound with strong antioxidant activity and various physiological and pharmacological activities. It is widely used in food, medicine, feed, dyes, and the electronics industry. The current global market demand for gallic acid is approximately 8,000 tons per year and is continuously growing.

[0005] Currently, gallic acid is mainly extracted from plant tissues such as gallnut (Galla chinensis), which is rich in tannins. However, plant extraction methods not only generate large amounts of organic waste, placing significant pressure on the ecological environment, but also rely on traditional planting methods, limiting a stable supply of plant materials. Therefore, overcoming the shortcomings of existing technologies is a pressing issue that needs to be addressed in the field of synthetic biology. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide the Astilbe shikimate dehydrogenase AcSDH777 gene and its application in the preparation of gallic acid.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of the present invention provides the Astilbe shikimate dehydrogenase AcSDH777 gene, the nucleotide sequence of which is shown in SEQ ID NO.1, with a full length of 1596 bp.

[0008] The second aspect of the present invention provides a protein encoded by the Astilbe shikimate dehydrogenase AcSDH777 gene, the amino acid sequence of which is shown in SEQ ID NO.2, encoding 531 amino acid residues.

[0009] A third aspect of the present invention provides a recombinant plasmid containing the Astilbe shikimate dehydrogenase AcSDH777 gene.

[0010] Furthermore, the Astilbe shikimate dehydrogenase AcSDH777 gene was homologously recombined with the pET28a vector to obtain the pET28a-AcSDH777 recombinant plasmid.

[0011] A fourth aspect of the present invention provides a transgenic engineered bacterium containing the recombinant plasmid, or wherein the genome of the transgenic engineered bacterium is integrated with the exogenous Astilbe shikimate dehydrogenase AcSDH777 gene.

[0012] Furthermore, the genetically engineered bacteria is *Escherichia coli* strain BL21(DE3). The fifth aspect of this invention provides *Astilbe shikimate dehydrogenase* encoded by the *Astilbe shikimate dehydrogenase* AcSDH777 gene.

[0013] The sixth aspect of this invention provides the application of the Astilbe shikimate dehydrogenase AcSDH777 gene in the preparation of gallic acid.

[0014] Furthermore, with shikimic acid and NADP + Using as a substrate, under the catalysis of the astilbe shikimate dehydrogenase encoded by the Astilbe shikimate dehydrogenase AcSDH777 gene, shikimate undergoes a two-step consecutive dehydrogenation reaction, ultimately converting into gallic acid.

[0015] The discovery process of the Astilbe shikimate dehydrogenase AcSDH777 gene involved in this invention is as follows: From Astilbe plants, using transcriptome sequencing technology combined with bioinformatics analysis methods, and after extensive experimental screening and verification, it was successfully identified. The steps for obtaining this gene are: extracting total RNA from the young tissues of Astilbe plants, reverse transcribing it to synthesize cDNA, and using this cDNA as a template for PCR amplification to obtain the full-length sequence of the AcSDH777 gene. The specific primer sequences with homologous walls used to amplify the Astilbe shikimate dehydrogenase AcSDH777 gene are shown below: Upstream homologous arm primer: gtggacagcaaatgggtcgcggatccatgactctcgggagcgtac (SEQ ID NO.3).

[0016] Downstream homologous arm primer: tgtcgacggagctcgaattcggatccctatgtgttctttgccaaggtttcc (SEQ ID NO.4).

[0017] The shikimate dehydrogenase AcSDH777 gene isolated and identified from Astilbe can serve as an important marker gene for molecular-assisted breeding of Astilbe, and also as an important candidate gene for gallic acid production in yeast chassis cell construction.

[0018] This invention relates to a shikimate dehydrogenase gene, AcSDH777, cloned and identified from Astilbe chinensis, and its encoded protein, as well as its innovative application in the biosynthesis of gallic acid. This invention utilizes molecular biology techniques to discover and modify a shikimate dehydrogenase with gallic acid synthesis activity, achieving a highly efficient biocatalytic process for the two-step dehydrogenation of gallic acid from shikimate as a substrate. This provides a novel and efficient biocatalyst for the green and sustainable production of the natural, high-value-added antioxidant gallic acid.

[0019] Compared with the prior art, the beneficial effects of this invention are as follows: (1) This invention clarifies the function of the Astilbe shikimate dehydrogenase AcSDH777 gene, which encodes Astilbe shikimate dehydrogenase that can directly use shikimate as a substrate to continuously catalyze the dehydrogenation to produce gallic acid. This invention obtains a highly soluble shikimate dehydrogenase with high catalytic activity by mining and modifying it, thus realizing the efficient heterologous synthesis of gallic acid by microorganisms. (2) Compared with the traditional chemical method of synthesizing gallic acid, which has large pollution and low purity, and the high resource dependence and low yield of direct extraction from natural plant gallnut, the present invention uses synthetic biology methods to not only improve the production efficiency of gallic acid, but also increase the unit yield and shorten the production cycle. (3) Escherichia coli can efficiently heterologously express the Astilbe shikimate dehydrogenase AcSDH777 gene, which can reconstruct the complete synthetic pathway from glucose to gallic acid. Compared with eukaryotic expression systems, the Escherichia coli used in this invention has a clear genetic background, simple culture conditions, high transformation efficiency, and short fermentation cycle, making it very suitable for large-scale industrial production. Attached Figure Description

[0020] Figure 1 This is a schematic diagram of the synthetic pathway of gallic acid; Figure 2 This is a schematic diagram illustrating the construction of the pET28a-AcSDH777 recombinant plasmid; Figure 3The electrophoresis results show the results of pET28a-AcSDH777 recombination; where M represents DNA Marker, and the markers (from bottom to top) are 100bp, 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3000bp, and 5000bp; lanes 1 and 2 are for selecting two positive transformants of pET28a-AcSDH777 after recombination, both of which are 1000bp-1500bp. Figure 4 This is an SDS-PAGE electrophoresis image of recombinant plasmid pET28a-AcSDH777; where M represents the molecular weight of the protein, from bottom to top: 10 kDa, 15 kDa, 25 kDa, 35 kDa, 45 kDa, 65 kDa, 75 kDa, 100 kDa, 135 kDa, 180 kDa; lane 1 shows the purified protein of recombinant plasmid pET28a-AcSDH777 eluted with 250 mmol / L imidazole buffer; Figure 5 The catalytic activity of astilbe shikimate dehydrogenase AcSDH777 on shikimate was determined by HPLC. In the figure, AcSDH777 represents the detection result of the enzyme activity reaction product of this invention; shikimate represents the detection result of shikimate standard; 3-dehydroshikimate represents the detection result of 3-dehydroshikimate standard; gallic acid represents the detection result of gallic acid standard. Figure 6 Mass spectra of gallic acid, the catalytic product of astilbestrol shikimate dehydrogenase AcSDH777, and gallic acid standard are shown. In Figure A, gallic acid is the catalytic product of astilbestrol shikimate dehydrogenase AcSDH777, and in Figure B, gallic acid standard is the catalytic product of gallic acid. In the figures, AcSDH777 represents gallic acid, the catalytic product of astilbestrol shikimate dehydrogenase AcSDH777; gallic acid-STD represents gallic acid standard. Detailed Implementation

[0021] The present invention will now be described in further detail with reference to the embodiments.

[0022] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.

[0023] The culture medium used in this invention: LB liquid medium: 10 g / L tryptone + 5 g / L yeast extract + 10 g / L sodium chloride; LB solid medium (LB solid plates): 10 g / L tryptone + 5 g / L yeast extract + 10 g / L sodium chloride + 15 g / L agar powder.

[0024] Example 1

[0025] To identify the key gene responsible for shikimic acid dehydrogenation in Astilbe, we first used its Unigene basic functional annotation data to preliminarily screen potential SDH candidate genes from the sequencing annotation results. Simultaneously, we performed local BLAST homology analysis using the sequence information of known plant shikimic acid dehydrogenases (SDH). By comprehensively organizing and evaluating the results from these two methods, we identified one gene suspected of encoding shikimic acid dehydrogenase. To verify the function of this gene, the inventors subsequently conducted a series of experiments, including cDNA synthesis, PCR amplification and product recovery of the target gene, homologous recombination of the gene and vector, induction of recombinant protein expression, enzyme activity reaction, and detection of the reaction products using HPLC and LC / MS techniques. Through this series of systematic studies, we successfully identified a target gene capable of catalyzing a two-step dehydrogenation reaction of shikimic acid to gallic acid, and named it AcSDH777. Figure 1 As shown. The main experimental steps are detailed below: (1) Preparation of cDNA template Fresh rhizome tissue from *Astilbe* was selected, sliced ​​into thin sections, and immediately immersed in liquid nitrogen for rapid freezing to preserve RNA integrity. Total RNA extraction was performed using the HiPure Plant RNA MiniKit kit manufactured by Guangzhou Meiji Biotechnology Co., Ltd., strictly following the standard operating procedures provided in the kit. After the extracted RNA passed quality testing, it was reverse transcribed into cDNA first strand using a reverse transcription kit from TAKARA. The prepared cDNA solution was stored at -20℃ for subsequent experimental use.

[0026] (2) Gene amplification and recovery Based on the analysis of previous Astilbe genome sequencing results, specific PCR primers targeting the candidate SDH gene were designed using SnapGene molecular biology software, and the primers were synthesized by the Kunming branch of Beijing Qingke Biotechnology Co., Ltd.

[0027] Upstream homologous arm primer: gtggacagcaaatgggtcgcggatccatgactctcgggagcgtac (SEQ ID NO.3).

[0028] Downstream homologous arm primer: tgtcgacggagctcgaattcggatccctatgtgttctttgccaaggtttcc (SEQ ID NO.4).

[0029] PCR amplification was performed using a 2×PhantaMax Master Mix high-fidelity DNA polymerase system. The specific reaction components were as follows: 25 μL of 2×PhantaMax Master Mix, 1.5 μL each of 10 mM upstream and downstream homologous primers, 1 μL of Astilbe cDNA template, and ddH2O to a final volume of 50 μL. The PCR program was as follows: 95°C pre-denaturation for 3 minutes; followed by 35 cycles, each cycle consisting of 95°C denaturation for 15 seconds, 58°C annealing for 15 seconds, and 72°C extension for 1 minute; a final extension at 72°C for 5 minutes after each cycle, and finally incubation at 10°C. The amplified products were separated by 1% (w / v) agarose gel electrophoresis, and the target gene AcSDH777 fragment was recovered by gel excision using a Tiangen agarose gel DNA recovery kit. The concentration and purity of the recovered DNA fragments were determined using a NanoReady ultra-micro UV-Vis spectrophotometer, and after passing the determination, they were stored at -20°C for later use.

[0030] (3) Construction and identification of recombinant plasmids A schematic diagram of homologous recombination is shown below. Figure 2 As shown in the diagram. First, the pET28a vector was linearized using BamH1 enzyme digestion to obtain the linearized pET28a vector. The specific reaction components were as follows: 1 μg pET28a vector, 1.5 μL BamH1, 5 μL rCutSmart Buffer, and ddH2O to a final volume of 50 μL. Digestion was performed at 37°C for 30 min, followed by termination by heating at 65°C for 5 min. The digestion products were verified by agarose gel electrophoresis and purified using the OMEGA EZNA® Cycle Pure Kit. DNA concentration was measured using a NanoDrop2000 instrument and stored at -20°C for long-term storage.

[0031] During the homologous recombination reaction, the system assembly was strictly performed according to the instructions of the homologous recombinase kit. Based on the concentrations of the target gene AcSDH777 fragment and the linearized vector, the optimal amount of each component was calculated according to the formula provided by the recombination kit. Then, under ice bath conditions, each component was added sequentially to the PCR reaction tube and gently mixed. The reaction system is shown in Table 1. After incubation at 50℃ for 30 min, the recombinant plasmid construction was completed, and the pET28a-AcSDH777 recombinant plasmid was obtained.

[0032] Table 1

[0033] The steps for recombinant plasmid transformation are as follows: Thaw DH5α competent cells stored at -80℃ in an ice bath, add 10 μL of pET28a-AcSDH777 recombinant plasmid, and incubate on ice for 30 min; heat shock in a metal bath at 42℃ for 90 s, and then incubate on ice for 3 min; add 500 μL of LB liquid medium to a centrifuge tube, and culture in a shaker at 37℃ for 1 h; then plate 100 μL of the bacterial culture onto an LB solid medium plate containing 100 μg / mL Kana.

[0034] Several single colonies were randomly selected from the transformation plate for PCR identification. The PCR identification was performed using 2×Taq Master Mix enzyme from Nanjing Novizan Biotechnology Co., Ltd. The reaction system was as follows: 10 μL of 2×Taq Master Mix, 0.8 μL each of the upstream and downstream primers (10 mM), 2 μL of single colony as template, and ddH2O to a final volume of 20 μL.

[0035] Identification of upstream and downstream primer sequences: Identification of upstream primer pet28a-F: ccgtttagaggccccaagg (SEQ ID NO.5) Identification of downstream primer pet28a-R: ggaattgtgagcggataacaattcc (SEQ ID NO.6) The PCR reaction program was set as follows: pre-denaturation at 95℃ for 3 minutes; followed by 35 cycles, each cycle consisting of denaturation at 95℃ for 15 seconds, annealing at 58℃ for 15 seconds, extension at 72℃ for 30 seconds, and a final extension at 72℃ for 5 minutes after each cycle, followed by incubation at 10℃. The electrophoretic detection results of the recombinant products are as follows. Figure 3 As shown, lanes 1 and 2 are for selecting two positive transformants of pET28a-AcSDH777 after recombination. The band size is as expected, indicating that the pET28a-AcSDH777 recombinant plasmid was successfully constructed.

[0036] (4) SDS-PAGE protein electrophoresis The pET28a-AcSDH777 recombinant plasmid was transformed into Escherichia coli BL21(DE3) competent cells (the transformation method was the same as that for DH5α competent cells). Positive clones were inoculated into 5 mL of LB liquid medium containing 100 μg / mL Kana and cultured overnight at 37°C with shaking at 220 rpm. The clones were then transferred to 500 mL of LB liquid medium containing 100 μg / mL Kana and cultured for 3 h. 0.1 mM IPTG (isopropyl-β-D-thiogalactoside) was added and the clones were induced to culture at 16°C with 180 rpm for 16 h. After induction, the bacterial culture was centrifuged at 4℃ and 5000 rpm for 10 min, the supernatant was discarded, and the cells were resuspended in 40 μL of Tris-HCl (pH 7.5) buffer. The cells were then sonicated 2-3 times at 4℃, followed by centrifugation at 12000 rpm for 40 min. The supernatant was transferred to a nickel chromatography column and subjected to two column loading tests. Elution was performed using imidazole at concentrations of 20 mmol / L, 50 mmol / L, and 250 mmol / L. The purified protein from the 250 mmol / L imidazole elution peak was collected and then separated and detected by SDS-PAGE gel electrophoresis. The results are as follows: Figure 4 As shown, a distinct band appears at the expected molecular weight position, indicating that the soluble expression protein of the AcSDH777 target gene has been successfully obtained.

[0037] (5) Enzyme activity reaction The enzyme-catalyzed reaction was carried out in 8-tube PCR apparatus, and the amounts of each component added were as shown in Table 2. The reaction components were added to the centrifuge tubes in the order listed in Table 2 and mixed thoroughly. The centrifuge tubes were placed in a PCR instrument and reacted at a constant temperature of 30°C for 11 hours. The reaction was terminated with 100 μL of methanol after the reaction, and the products were then detected.

[0038] Table 2

[0039] (6) Product testing The HPLC detection conditions are as follows: The instrument used for HPLC analysis was an Agilent 1290 ultra-high performance liquid chromatograph. The HPLC column was an XBridgeShield RP18 (4.6 mm × 250 mm, 5 μm). The mobile phase for product determination was 0.1% (v / v) formic acid aqueous solution (A) - acetonitrile (B), with gradient elution: 0–8 min, 1%–5% B; 8–13 min, 5%–10% B; 13–20 min, 10%–20% B; 20–25 min, 20%–45% B; 25–35 min, 45%–90% B; 35–40 min, 90%–90% B. The gradient change was linear during elution. Elution time: 40 min; injection volume: 10 μL; flow rate: 0.6 mL / min; gallic acid detection wavelength: 260 nm; column temperature: 30 °C; injection volume: 10 μL. The detection results are shown in the figure. Figure 5 This indicates the production of gallic acid.

[0040] The LC / MS detection conditions are as follows: Detection was performed using an Agilent 1290 UPLC / 6540 Q-Tof liquid chromatography-mass spectrometry (LC / MS) system. Mass spectrometry conditions: negative ion mode, voltage 3500V; fragmentation voltage: 135V; cone voltage: 60V; radio frequency voltage: 750V; scan range: 100-1000 m / z. Chromatographic conditions: an Agilent ZORBAX SB-C18 column (250 mm × 4.6 mm, 5.0 μm) was used, with a flow rate of 0.6 mL / min. The mobile phase was 0.01% (v / v) formic acid (A) and acetonitrile (B), with gradient elution: 0–8 min, 1%–5% B; 8–13 min, 5%–10% B; 13–20 min, 10%–20% B; 20–25 min, 20%–45% B; 25–35 min, 45%–90% B; 35–38 min, 90%–90% B; 38–45 min, 90%–100% B. The gradient change was linear during elution. Elution time: 45 min; injection volume: 10 μL; flow rate: 0.6 mL / min. Detection results are shown below. Figure 6 The results show the fragment ion diagram of the reaction product gallic acid ( Figure 6 Fragment ion diagram of A in the figure and standard gallic acid (A) Figure 6 The results in B) are consistent, further confirming the product gallic acid.

[0041] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. The Astilbe shikimate dehydrogenase AcSDH777 gene, characterized by, The nucleotide sequence of the Astilbe shikimate dehydrogenase AcSDH777 gene is shown in SEQ ID NO.

1.

2. The protein encoded by the Astilbe shikimate dehydrogenase AcSDH777 gene as described in claim 1, characterized in that, The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A recombinant plasmid containing the Astilbe shikimate dehydrogenase AcSDH777 gene as described in claim 1.

4. The recombinant plasmid containing the Astilbe shikimate dehydrogenase AcSDH777 gene according to claim 3, characterized in that, The Astilbe shikimate dehydrogenase AcSDH777 gene was homologously recombined with the pET28a vector to obtain the pET28a-AcSDH777 recombinant plasmid.

5. A transgenic engineered bacterium containing the recombinant plasmid of claim 3, or wherein the genome of the transgenic engineered bacterium is integrated with an exogenous Astilbe shikimate dehydrogenase AcSDH777 gene of claim 1.

6. The genetically engineered bacteria according to claim 5, characterized in that, The genetically engineered bacteria is Escherichia coli BL21(DE3) strain.

7. The astilbe shikimate dehydrogenase encoded by the Astilbe shikimate dehydrogenase AcSDH777 gene as described in claim 1.

8. The application of the Astilbe shikimate dehydrogenase AcSDH777 gene as described in claim 1 in the preparation of gallic acid.

9. The application of the Astilbe shikimate dehydrogenase AcSDH777 gene according to claim 8 in the preparation of gallic acid, characterized in that: With shikimic acid and NADP + Using as a substrate, the astilbe shikimate dehydrogenase encoded by the Astilbe shikimate dehydrogenase gene AcSDH777 undergoes a dehydrogenation reaction to produce gallic acid.

Images