Mutant alkaline protease from extreme environment and application of heterologous expression engineering bacteria thereof

Abstract

This invention discloses an engineered bacterium that heterologously expresses a mutant alkaline protease derived from extreme environments. This group of strains is named... E. coli C43(DE3) / pET28a-AP1 serine N It is to utilize E. coli Starting with strain C43(DE3), a truncated mutant gene derived from alkaline protease AP1 was introduced into its cells via electroporation using the pET28a(+) plasmid. It was found that the truncated mutation had little effect on the activity of this alkaline protease under alkaline conditions, and some truncated mutations even showed a significant increase in activity. This invention also discloses the application of this alkaline protease AP1 and its mutant alkaline protease in detergents, which can improve the washing effect of the detergent solution. Furthermore, this invention discloses an engineered strain expressing this alkaline protease AP1 using *Streptomyces* as the host, and found that in commonly used *Streptomyces* hosts, this alkaline protease can regulate the host's secondary metabolism (accumulation of natural products).

Description

Technical Field

[0001] This invention relates to a mutant alkaline protease heterologous expression engineered bacterium derived from extreme environments and its applications, belonging to the field of biotechnology. Background Technology

[0002] Extremophilic microorganisms refer to microorganisms that survive and reproduce in harsh environments such as high salinity, high alkalinity, high temperature, or low temperature. Through long-term evolution, they have developed unique metabolic regulatory mechanisms and physiological characteristics to adapt to these "forbidden zones of life." This evolutionary result directly manifests as the production of a series of novel metabolites with unique structures and functions (new bioactive substances), including enzymes with extremely high catalytic efficiency and extreme stability, as well as novel biomaterials. For example, many researchers have screened strains capable of producing alkaline proteases from extreme environments such as the deep sea [Zhang Rui, 2001], revealing the enormous potential of extremophilic microorganisms as a novel enzyme resource library.

[0003] Alkaline proteases belong to the serine proteolytic enzyme class of endopeptidases. Their core characteristic is the ability to efficiently hydrolyze protein peptide bonds under alkaline conditions, producing polypeptides or amino acids. These enzymes were initially discovered in porcine pancreas, and subsequently, microbial alkaline proteases were first isolated from *Bacillus licheniformis* [Gupta R, 2002]. Since then, microbial alkaline proteases have become the mainstream direction in industrial enzyme preparation research due to their advantages such as short production cycles, controllable costs, and ease of genetic modification. The optimal pH range for these enzymes is 8.5–11.0. In addition to common alkaline environments, researchers have screened strains capable of producing alkaline proteases from various extreme habitats, including polar high-altitude environments, high-salt marine environments, and even metal-polluted areas. It is worth noting that saline-alkali lakes, as typical dual extreme environments (high salinity + high alkaliness), often exhibit unique salt and alkali tolerance in the alkaline proteases produced by the haloalkaliphiles that inhabit them, and their molecular structures have special adaptive characteristics.

[0004] As one of the most important enzyme preparations in the field of industrial biotechnology today, alkaline proteases are currently the most widely used and in highest market demand. Their applications cover a wide range of industries, including enzyme-added detergents, food processing, pharmaceutical synthesis, feed improvement, leather depilation, silver recovery, chemical catalysis, and organic waste treatment. Among them, alkaline serine proteases dominate industrial applications due to their high catalytic activity and conformational stability under alkaline conditions. The active site of these enzymes contains a serine (Ser) residue with nucleophilic attack capability, which, together with aspartic acid (Asp) and histidine (His), forms a catalytic triad, completing peptide bond hydrolysis through a proton transfer relay network. These proteases operate within a pH range of 7–11, with the optimal pH mostly in the alkaline range, and most members exhibit significant substrate specificity. Studies have also shown that some alkaline proteases from extremophiles have good tolerance to organic solvents, surfactants, and oxidants, laying the foundation for their application under harsh industrial conditions.

[0005] However, despite the abundance of protease-producing microorganisms in nature, truly industrially viable alkaline protease-producing strains—possessing high catalytic activity, broad substrate adaptability, and stability under extreme conditions—remain relatively scarce. Currently, alkaline protease-producing bacteria that have achieved industrial production or received in-depth research mainly fall into two groups: Bacillus and fungi (such as *Aspergillus* and *Fusarium*). In addition, actinomycetes and archaea such as *Streptomyces*, *Halobacterium*, and *Halomonas* can also produce serine-type alkaline proteases. In recent years, researchers have also begun to focus on the enzyme-producing potential of other genera, providing new possibilities for the diversity of alkaline protease sources. Nevertheless, reports of isolating novel alkaline proteases from extremophiles remain relatively limited, and systematic research is still insufficient. Do alkaline proteases from extremophiles possess unique catalytic properties (such as facultative salt tolerance, organic solvent tolerance, and high activity at low temperatures)? How can their efficient production be achieved through heterologous expression systems? How can we further enhance the activity of these proteases? Answering these scientific questions is of great theoretical and practical significance for broadening the sources of alkaline proteases, deepening the understanding of the relationship between enzyme structure and function, and promoting the development of novel industrial biocatalysts.

[0006] Our research group has confirmed that *Microbacterium oxydans* HSL10, isolated from saline-alkali lakes, possesses the ability to produce alkaline proteases. Previous work included gene cloning of this protease and the construction of a heterologous expression strain of an alkaline protease (AP1) derived from extreme environments. This strain demonstrates that the enzyme is a non-metal ion-dependent alkaline protease (optimally produced at pH 9.0 and at a reaction temperature of 55°C). These related studies provide important clues for exploring novel extreme enzyme resources. Summary of the Invention

[0007] Based on the problems described in the background, the problem that this invention aims to solve is:

[0008] How to further optimize the activity of AP1, an alkaline protease derived from extreme environments, and expand its applications.

[0009] To achieve the above objectives, the present invention provides the following technical solution:

[0010] A mutant alkaline protease encoding gene derived from extreme environments, named ap1. serine N The ap1 serine N Including AP1 serine 0 (Sequence file 3), ap1 serine 1 (Sequence file 5), ap1 serine2 (Sequence file 7) and ap1 serine 3 (Sequence file 9); The gene sequence is derived from the encoding gene of alkaline protease AP1 of Microbacterium oxydans HSL10; The nucleotide sequence of the mutant gene was obtained by truncating both ends of the wild-type enzyme (AP1) gene (Sequence file 1), and the encoded product has alkaline protease activity.

[0011] Preferred, ap1 serine 1 and AP1 serine 2 The genes were obtained by truncating the wild-type enzyme (AP1) gene from the ends, with retained lengths of 1860 bp and 2115 bp, respectively. The activities of the encoded proteases were significantly enhanced under alkaline conditions compared with those of the wild-type protease.

[0012] A mutant alkaline protease derived from extreme environments, named AP1. serine N AP1 serine N Including AP1 serine 0 (Sequence file 4), AP1 serine 1 (Sequence file 6), AP1 serine 2 (Sequence file 8) and AP1 serine 3(Sequence file 10); The sequence is derived from the wild-type protease AP1 (1069 amino acids) (Sequence file 2) of Microbacterium oxydans HSL10, which is truncated at both ends. The encoded protease retains the protease catalytic activity domain and the catalytic activity triplet residues.

[0013] Preferably, AP1 serine 1 and AP1 serine 2 It was obtained by truncating both ends of the wild-type protease (AP1), retaining lengths of 620 and 705 amino acids, respectively. The encoded protease has higher activity than the wild-type protease under alkaline conditions.

[0014] A mutant alkaline protease heterologous expression engineered bacterium derived from extreme environments, named E. coli C43(DE3) / pET28a-AP1 serine N Its genotype is E. coli C43(DE3), kanamycin resistance, and ap1. serine N IPTG inducible P T7 The promoter was obtained by introducing a mutated protease gene carried by the pET28a(+) plasmid into the cells of E. coli C43 (DE3) as the starting strain via electroporation. Among them, the engineered strain E. coli C43 (DE3) / pET28a-AP1 contained two mutated alkaline proteases. serine 1 and pET28a-AP1 serine 2 The encoded protease exhibits higher activity than the wild-type protease under alkaline conditions.

[0015] The application of a heterologous expression engineered bacterium of mutant alkaline protease derived from extreme environments in detergent additives can improve the detergency of detergents at room temperature.

[0016] A mutant alkaline protease heterologous expression engineered bacterium derived from extreme environments was developed. The engineered bacterium was a Streptomyces-derived engineered bacterium, with the host cell Streptomyces albus J1074. The full-length encoding gene of the alkaline protease AP1 from extreme environments was expressed using the Streptomyces expression vector p15A. The ability of metabolites synthesized in the engineered bacterium was significantly regulated by the protease AP1.

[0017] The beneficial effects of this invention are:

[0018] This invention relies on targeted truncation mutation of alkaline proteases in extreme environments to precisely target key functional amino acid segments, overcoming the performance limitations of wild-type proteases.

[0019] This invention employs a dual-host heterologous expression system of Escherichia coli and Streptomyces to optimize protein expression patterns and effectively enhance the catalytic activity and environmental adaptability of alkaline protease.

[0020] Compared with traditional wild enzyme research, this invention features an innovative technical approach, combining the dual advantages of enzyme molecule modification and microbial metabolic regulation. It offers strong process controllability and is suitable for large-scale production, demonstrating significant application prospects and industrialization advantages in the detergent industry and natural product synthesis. Attached Figure Description

[0021] Figure 1 Washing performance test of laundry detergent with added protease AP1

[0022] Figure 2 Schematic diagram of the AP1 protease domain and truncation mutations (A: Predicted domains of wild-type AP1 protease; B: Truncation mutations in wild-type AP1 protease)

[0023] Figure 3. Cloning of the AP1 truncated mutant gene and detection of enzyme activity after mutation (A: protease gene cloning process; B: detection of enzyme activity after protease truncation mutation)

[0024] Figure 4. Effects of protease AP1 expression on Streptomyces secondary metabolism (A: Construction of plasmids expressing the protease AP1 gene in Streptomyces; B: Effects of protease AP1 on host secondary metabolism in Streptomyces) Detailed Implementation

[0025] The present invention will be described in detail below with reference to the accompanying drawings and specific examples in order to better understand the present invention, but the content described is not limited to the scope of protection of the present invention.

[0026] The applicant previously cloned a novel alkaline protease gene (ap1-HSL10) from the genome of *Microbacterium oxydans* HSL10, which exhibits alkaline protease activity and alkaliphilic activity. This invention utilizes gene mutation to enhance the activity of this alkaline protease-encoding gene and investigates its application in improving detergent detergency and enhancing the secondary metabolic capacity of *Streptomyces*.

[0027] The present invention describes a group of engineered bacteria used for truncating mutant protease gene expression, the engineered bacteria being named E. coli C43(DE3) / pET28a-AP1. serine N Its genotype is E. coli C43, kanamycin resistance, and ap1. serine N IPTG-inducible P T7The promoter is derived from E. coli C43(DE3) strain, which is introduced into its cells via electroporation using the pET28a(+) plasmid carrying the ap1 gene. serine N And obtained. Among them, ap1 serine N It is a group of derived genes derived from a truncated mutation of the wild-type protease AP1 gene (ap1-HSL10). E. coli C43(DE3) is a commonly used bacterial heterologous expression host; plasmid pET28a-AP1 serine N This is a mutant gene used for heterologous expression of the serine protease AP1 derived from *Microbes oxidans* HSL10. Different mutant protease genes, such as AP1, are used. serine N Inserted into the pET28a(+) expression vector, carrying the kanamycin resistance gene; two of the engineered bacteria encode AP1. serine 1 and AP1 serine 2 (Activity is enhanced).

[0028] This invention relates to an engineered strain of Streptomyces expressing alkaline protease, named *S. albus* J1074 / p15A-AP1. Its genotype is *Streptomyce albus* J1074, aparamycin resistance, ap1-HSL10. The strain is obtained by integrating the shuttle expression plasmid p15A-AP1 at the attB site of its genome. *Streptomyce albus* J1074 is a commonly used host for secondary metabolism research. p15A-AP1 is an expression plasmid used for heterologous expression of the serine protease AP1 derived from *Microbes oxytetracycline* HSL10. The wild-type protease AP1 gene ap1-HSL10 is inserted into an expression vector based on p15A (carrying the aparamycin resistance gene and the integration element). The p15A-AP1 was constructed by assembling three fragments: the coding gene for the full-length protease AP1 (ap1-HSL10), promoter elements, and the vector p15A; and then integrating it into the genome of Streptomyce albus J1074.

[0029] 1. Specifically, the present invention describes the heterologous expression of mutant alkaline protease AP1 derived from extreme environments. serine N The method for constructing engineered bacteria involves the following steps:

[0030] (1) Using the complete wild-type protease AP1 encoding gene (ap1-HSL10) as a template, a series of primers were designed and PCR amplification was carried out to obtain genes of different lengths (truncated mutant genes) (the primer sequences used are shown in Table 1).

[0031] (2) Shortened mutant genes of different lengths were transformed into the same E. coli GBdir cell using the commonly used Red / ET recombination technology (PCR linear fragment and linear vector pET28(a) were co-transformed into the same E. coli GBdir cell for linear recombination) to obtain four expression plasmids, namely pET28a-AP1. serine 0 (Inserted fragment is 1980bp), pET28a-AP1 serine 1 (Inserted fragment is 1860bp), pET28a-AP1 serine 2 (Insertion fragment is 2115bp), pHSLpET28a-AP1 serine 3 (The inserted fragment is 2184bp); while pET28a-AP1, as the control plasmid, contains an inserted fragment of 3210bp, which is the gene (ap1-HSL10) of the wild-type intact protease AP1.

[0032] (3) Electroporate the above expression plasmids into E. coli C43(DE3) cells to construct a group of engineered bacteria.

[0033] (4) The obtained engineered bacterial cells were cultured on a medium containing skim milk powder and the size of the hydrolysis zone was detected.

[0034] 2. Specifically, the method for constructing the engineered strain of Streptomyces heterologous expression of alkaline protease AP1 described in this invention comprises the following steps:

[0035] (1) PCR amplification was performed to obtain the linearized shuttle vector p15A portion (5.3kb), the linearized promoter sequence SA6P (0.7kb), and the full-length wild-type AP1 coding gene (ap1-HSL10).

[0036] (2) Using the Gibson Assembly kit, the above three PCR products were incubated and then transferred into Escherichia coli GBdir. After culturing for 2 days, the plasmid was extracted and verified by enzyme digestion to obtain the shuttle plasmid p15A-AP1.

[0037] (3) The shuttle plasmid p15A-AP1 was introduced into the commonly used Streptomyces albus J0174 (S. albus J1074) host cell via conjugation transfer.

[0038] (4) After liquid fermentation of engineered bacteria S. albus J1074 / p15A-AP1, the fermentation broth was extracted; quantitative HPLC was performed on the crude extract to analyze the synthesis level of bacterial secondary metabolites.

[0039] General note: The wild-type alkaline protease AP1 gene ap1- involved in the following examples. HSL10The source is the wild-type strain *Microbacterium oxysporum*, and its truncated mutant gene is named ap1. serineN The plasmids were amplified using the wild-type protease AP1 gene as a template; E. coli C43(DE3) is a commonly used bacterial heterologous expression host, and the plasmid vector pET28a(+) used for expressing the alkaline protease AP1 was purchased from Novagen, USA; E. coli ET12567 / pUZ8002 was obtained from the John Innes Institute, UK. E. coli GBdir was a strain preserved by our research group and used for gene cloning (linear homologous recombination); gene sequencing during plasmid construction was performed by BGI Genomics. Other plasmids not mentioned were commercially available conventional plasmids. All reagents and consumables involved were domestically produced. Unless otherwise specified, the experimental methods and reagents used in the examples are conventional methods and commercially available reagents in the field.

[0040] Example 1

[0041] Alkaline protease AP1 and mutant alkaline protease from Microbacterium oxydans HSL10 enhance detergency in detergents.

[0042] (1) Using the above-constructed expression cell E.coli C43(DE3) (C43 / pET28a-AP1 (plasmid containing complete protease gene), fermented in liquid SYNG medium at 200 rpm 37 ℃ for 2 days (expression induced by 0.4 mmol / L IPTG), and crude enzyme solution was extracted from the fermentation broth.

[0043] (2) Cut 6 pieces of white cotton cloth, each 5 square centimeters in size. Place 1 ml of pig's blood on each piece of cloth and allow it to dry completely. Mix 1 gram of enzyme-free laundry detergent with 1 ml of crude enzyme solution (enzyme concentration 1 mg / ml), add to 100 ml of water, and pour into a beaker containing the contaminated cotton cloth. Mix at 50 rpm for 30 minutes, then remove. Perform a full-wavelength scan of the absorbance of the washing waste liquid (using enzyme-free laundry detergent as a control).

[0044] White cotton fabrics of the same size were contaminated with the same amount and concentration of pig blood and then dried. They were placed in the same volume of water and the same washing solution was added (enzyme-treated clothes: an enzyme solution containing protease AP1 was added; enzyme-free clothes: the same buffer solution was added to the laundry detergent, but without enzyme, as a control). The fabrics were stirred evenly on the same shaker for the same amount of time. The OD value of the washing wastewater was measured.

[0045] First, the OD value is detected across the entire wavelength range. Figure 1 -Left side, at different dilutions). Results show that the OD of the pig blood washing waste liquid... 410It has a maximum absorption, which allows for the quantitative detection of light absorption at this wavelength.

[0046] Next, the OD values ​​of the washing wastewater from the two cases were measured and compared at a wavelength of 410 nm. 410 . result( Figure 1 (Right) shows that the OD in the washing wastewater increased slightly after adding enzymes, indicating that the washing effect was improved.

[0047] Example 2

[0048] Expression and activity analysis of mutant alkaline protease clones from Microbacterium oxydans HSL10.

[0049] (1) The alkaline protease AP1 is derived from Microbacterium oxydans HSL10, and its activity has been verified. Its nucleotide sequence consists of 3210 bp (the gene sequence encoding it is shown in Appendix 1, SEQ-1). The domains at both ends of the protease are not related to protease activity. Figure 2 Therefore, truncated mutation analysis was conducted: using the complete protease AP1 encoding gene as a template, a series of primers were designed, and PCR amplification was performed to obtain genes of different lengths (truncated mutant genes AP1). seine N () Figure 2 The primer sequences used are shown in Table 1.

[0050] (2) Genes of different lengths were inserted into pET28a(+). The method was as follows: the plasmid vector pET28a(+) was cut into linear segments by BamHI and Hand III; the linear PCR product and the linear plasmid vector were introduced into E. coli GBdir by electroporation, and the expression plasmid was constructed based on linear recombination mediated by homologous recombinase Red / ET.

[0051] (3) The four expression plasmids obtained are as follows:

[0052] pET28a-AP1 serine 0 (Contains mutated serine protease AP1) serine 0 The expression plasmid for the gene, kanamycin resistance, has an insert fragment of 1980 bp; the nucleotide sequence of the protease gene is shown in sequence file 3).

[0053] pET28a-AP1 serine 1 (Contains mutant serine protease AP1) serine 1 The expression plasmid for the gene, kanamycin resistance, has an insert fragment of 1860 bp. The nucleotide sequence of the protease gene is shown in sequence file 5.

[0054] pET28a-AP1serine 2 (Contains mutant serine protease AP1) serine 2 The expression plasmid for the gene, kanamycin resistance, has an insert fragment of 2115 bp; the nucleotide sequence of the protease gene is shown in sequence file 7); pET28a-AP1 serine 3 (Mutant serine protease AP1) serine 3 The expression plasmid for the gene, kanamycin resistance, insert fragment 2184 bp, protease nucleotide sequence is shown in sequence file 9).

[0055] In addition, a control plasmid was constructed: pET28a-AP1 (an expression plasmid containing wild-type serine protease AP1, kanamycin resistant, with an insert fragment of 3210 bp, and the protease nucleotide sequence is shown in sequence file 1).

[0056] The recombinant plasmids that were correctly digested with enzymes were successfully sequenced.

[0057] (4) Plate analysis of alkaline protease activity using plasmids with correct sequencing: After introducing the above plasmids into host cells E.coli C43(DE3), they were cultured overnight at 37°C and 950 rpm in LB liquid medium. 40 μL of the overnight culture was transferred to 1.4 mL of LB medium and cultured at 37°C and 950 rpm for 2 h. 1 mL of the culture was taken to measure the OD value to ensure that the number of bacteria in each culture was on the same order of magnitude. 2 μL of the culture was dropped into SYNG solid medium (IPTG induction concentration 0.4 mmol / L) and cultured at 37°C for 48 h. The size of the hydrolysis zone was observed.

[0058] LB medium was used for routine liquid culture of E. coli; SYNG medium (10g skim milk powder; 15g agar powder; 5g yeast extract; 10g NaCl; 10g glucose, diluted with water to 800mL, pH 9.0 or pH 8.0. Sterilized at 115℃ for 30min. Skim milk powder was sterilized separately from other ingredients, and then mixed in a laminar flow hood after sterilization) was used.

[0059] In this laboratory, the antibiotic used is kanamycin (concentration: 25 µg / ml); protein expression is induced using IPTG (IPTG induction concentration: 0.4 mmol / L).

[0060] After solid culture (pH 9.0 or pH 8.0) of the above engineered bacteria (E. coli containing protease gene expression plasmids with different truncated mutations) on enzyme activity detection medium, the activity of different protease genes in producing degradation hydrolysis zones (hydrolysis zone diameter / colony diameter) was detected.

[0061] The results showed that ( Figure 3B): At pH 9.0 and pH 8.0, the hydrolytic ability of the truncated series of proteases did not decrease significantly compared with the original full-length proteases; individual mutant proteases (such as AP1) serine 1 and AP1 serine 2 The activity of this protein is significantly increased compared to the original full-length protease activity, making it more effective as a detergent additive.

[0062] Figure 3 This indicates that under alkaline conditions, removing some non-essential amino acid sequences does not affect the activity of this protease, and that in E. coli, the larger the protein molecular weight, the less likely it is to be expressed.

[0063] Table 1 Primer sequences for protease gene cloning

[0064] AP1-P1 5'-CATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGATGGGTCGAACACCCTCCG The gene for wild-type protease AP1 AP1-P2 5'-AGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTGCGGCCGCCTACTCCGGCTTCGCCGTT (Complete on both the N-end and C-end) <![CDATA[AP serine 0 -P1]]> 5'-CATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGATGGGTCGAACACCCTCCG <![CDATA[Mutant protease AP1 serine 0 gene]]> <![CDATA[AP serine 0 -P2]]> 5'-AGCAGCCGGATC TCA GTGGTGGTGGTGGTGGTG CTC GAG TGC GGC CGC GAA CGG ATT CGT GTT CTT CG (N end complete, C end truncated) <![CDATA[AP serine 1 -P1]]> 5'-CATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGAAGGACGTCCCTCGGCGTCTA <![CDATA[Mutant protease AP1 serine 1 gene]]> <![CDATA[AP serine 1 -P2]]> 5'-AGCAGCCGGATCTCAGTGGTGGTGGGTGGTGGTG CTC GAG TGC GGC CGC GAC CTT GAC GTT CAC TCC (Truncate the N-end and truncate the C-end) <![CDATA[AP serine 2 -P1]]> 5'-CATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGATCGTGGTGATGAAGTCGGA <![CDATA[Mutant protease AP1 serine 2 gene]]> <![CDATA[AP serine 2 -P2]]> 5'-AGCAGCCGGATCTCAGTGGTGGTGGGTGGTGGTG CTC GAG TGC GGC CGC GAC CTT GAC GTT CAC TCC (Truncate the N-end and truncate the C-end) <![CDATA[AP serine 3 -P1]]> 5'-CATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCAACCGCGGGCTACGCGAC <![CDATA[Mutant protease AP1 serine 3 gene]]> <![CDATA[AP serine 3 -P2]]> 5'-AGCAGCCGGATCTCAGTGGTGGTGGGTGGTGGTG CTC GAG TGC GGC CGC GAC CTT GAC GTT CAC TCC (Truncate the N-end and truncate the C-end)

[0065] Example 3

[0066] The alkaline protease AP1 from Microbacterium oxydans HSL10 is expressed in Streptomyces to promote secondary metabolism.

[0067] (1) First, the full-length alkaline protease gene fragment, the vector fragment, and the promoter element were amplified by PCR, resulting in three fragments:

[0068] Using P15A-1 / P15A-2 as primers (primer sequences: P15A-1: '-AGATCCGAAAACCCCAAGTT; P15A-2: 5'-TAGAAAAACAACTTA AATGTGAAAGTG), and shuttle vector P15A (5.3kb) as a template, PCR amplification was performed to obtain linearized shuttle vector P15A (5.3kb). Amplification conditions: 94℃ for 2 min, (98℃ for 10 s; 50℃ for 15 s; 72℃ for 2 min 30 s) × 30, 72℃ for 10 min;

[0069] ii-Use SA6P-1 / SA6P-2 as primers (primer sequences: SA6P-1: 5'-ACCCACTTTCACATTTAAGTTGTTTTTCTAGGCGCCGACCGCACCACACTCACGAG; SA6P-2: 5'-TGCCGCCATCCGGAGGGGTGTTCGACCCATGTGAA)

[0070] Using GTGGTCCTCCCAGGACTGGGGG) as a template, the promoter sequence SA6P-PCR (0.7kb) was obtained; amplification conditions: 94℃ for 2 min, (98℃ for 10 s; 67℃ for 5 s; 72℃ for 1 min) × 30, 72℃ for 10 min;

[0071] iii- Using HSL10-1 / HSL10-2 as primers (primer sequences: HSL10-1: 5'-ATGGGTCGAACACCCCTCCGGA; HSL10-2: 5'-TAAGATCCGTAACTTGGGG TTTTCGGATCTCTACTCCGGCTTCGCCGTTTCC), and Microbacterium oxydans HSL10 genomic DNA as a template, the AP1 gene (3.2kb) was amplified. Amplification conditions: 94℃ for 2 min, (98℃ for 10 s; 60℃ for 5 s; 72℃ for 3 min 20 s) × 30, 72℃ for 10 min.

[0072] (2) Assemble the above three fragments to construct the Streptomyces expression plasmid: Using the Gibson Assembly kit, the three PCR products were incubated at 50°C for 30 min in a Thermal cycler at a certain concentration ratio (500, 100, and 300 ng, respectively, and 20 μL of 2×Gibson Master in a 20 μL system). Then, they were transferred into E. coli GBdir, cultured overnight, and the plasmid was extracted and verified by enzyme digestion.

[0073] (3) Activity detection in Streptomyces: First, the plasmid obtained above was introduced into Escherichia coli ET12567 / pUZ8002, and then transferred into the common Streptomyces host - Streptomyces albus J0174 via conjugation transfer. Seed liquid fermentation was carried out at 200 rpm and 30℃ (TSB medium, formula: 30 g / L tryptone soybean). After 2 days, it was transferred into MS medium (formula (per liter): 20 g soybean flour, 20 g mannitol, 20 g agar powder, and 2.5 M MgCl2 was added to the final concentration of 10 mM before use); fermentation was carried out for 5 days (200 rpm, 30℃).

[0074] (4) Extraction of fermentation broth: When the fermentation is finished, pour all the fermentation broth into a 50 mL centrifuge tube and centrifuge at 8000 rpm at room temperature for 5 min; discard the supernatant, resuspend the bacterial cells in methanol (analytical grade), and mix on a mixer for 3 h; centrifuge at 4000 rpm at room temperature for 1 min, evaporate the methanol by rotation, add 1 mL of methanol (chromatographic grade) to the remaining part to completely dissolve the compound, and obtain the crude extract of fermentation.

[0075] (5) Semi-quantitative HPLC analysis was performed on the crude extract to compare its effect on the yield of bacterial secondary metabolites (most antibiotics). Based on... Figure 4 -B indicates that the introduction of the alkaline protease gene produces multiple peaks, suggesting that the introduction of the alkaline protease gene plays a significant regulatory role in the production of two or more compounds, giving Streptomyces a broader prospect for research and application as an engineered bacterium.

Claims

1. A mutant alkaline protease encoding gene derived from extreme environments, characterized in that, The alkaline protease gene is named ap1 serine N The ap1 serine N include ap1 serine 0 (Sequence file 3) ap1 serine 1 (Sequence file 5) ap1 serine2 (Sequence file 7) and ap1 serine 3 (Sequence file 9); The gene sequence is derived from *Microbacterium oxysporum*. Microbacterium oxydans The gene encoding the alkaline protease AP1 of HSL10; the nucleotide sequence of the mutant gene was obtained by truncating both ends of the wild-type enzyme (AP1) gene (sequence file 1), and the encoded product has alkaline protease activity.

2. The mutant alkaline protease encoding gene from an extreme environment as described in claim 1, characterized in that, ap1 serine 1 and ap1 serine 2 The genes were obtained by truncating the wild-type enzyme (AP1) gene from the ends, with retained lengths of 1860 bp and 2115 bp, respectively. The activities of the encoded proteases were significantly enhanced under alkaline conditions compared with those of the wild-type protease.

3. A mutant alkaline protease derived from extreme environments, characterized in that, The alkaline protease was named AP1. serine N AP1 serine N Including AP1 serine 0 (Sequence file 4), AP1 serine 1 (Sequence file 6), AP1 serine 2 (Sequence file 8) and AP1 serine 3 (Sequence file 10); the sequence is derived from Microbacterium oxysporum ( Microbacterium oxydans The wild-type protease AP1 (1069 amino acids) of HSL10 (sequence file 2) was truncated at both ends, and the encoded protease retained the protease catalytic activity domain and the catalytic activity triplet residues.

4. The mutant alkaline protease from an extreme environment according to claim 3, characterized in that, AP1 serine 1 and AP1 serine 2 It was obtained by truncating both ends of the wild-type protease (AP1), retaining lengths of 620 and 705 amino acids, respectively. The encoded protease has higher activity than the wild-type protease under alkaline conditions.

5. A mutant alkaline protease heterologous expression engineered bacterium derived from extreme environments, characterized in that, The engineered bacteria were named E. coli C43(DE3) / pET28a-AP1 serine N Its genotype is E. coli C43(DE3), kanamycin resistance ap1 serine N IPTG inducible P T7 promoter is a tool that utilizes E. coli C43 (DE3) was the starting strain, and the mutant protease gene carried by the pET28a(+) plasmid was introduced into its cells via electroporation. Among them, two engineered strains of mutant alkaline protease were obtained. E. coli C43 (DE3) / pET28a-AP1 serine 1 and pET28a-AP1 serine 2 The encoded protease exhibits higher activity than the wild-type protease under alkaline conditions.

6. The application of an engineered bacterium that heterologously expresses a mutant alkaline protease derived from an extreme environment, characterized in that, When used in detergent additives, it can enhance the cleaning effect of detergent at room temperature.

7. A mutant alkaline protease heterologous expression engineered bacterium derived from extreme environments, characterized in that, The engineered bacteria are engineered bacteria derived from Streptomyces, and the host cell... Streptomyces albus J1074 is the gene encoding the full-length alkaline protease AP1, which originates from extreme environments. It is commonly expressed using the Streptomyces expression vector p15A. The ability of engineered strains to synthesize metabolites is significantly regulated by the protease AP1.

Images