Recombinant bacteria for producing L-proline and construction method and application thereof

Abstract

This invention discloses a recombinant bacteria for producing L-proline, its construction method, and its applications, belonging to the fields of molecular biology and bioengineering. This invention constructs a recombinant bacteria that directly ferments glucose to produce L-proline by knocking out the key genes putA and aceA in the L-proline degradation pathway, replacing the NADPH-dependent glutamate dehydrogenase GdhA with the NADH-dependent glutamate dehydrogenase RocG, replacing the soluble pyridine nucleotide transhydrogenase SthA with the pyridine nucleotide transhydrogenase PntAB, replacing PtsG in the PTS transport system with glucokinase Glk, replacing GalR with the glucose promoter Glf, replacing OmpT with phosphoenolpyruvate carboxylase Ppc, and introducing γ-glutamyl kinase ProB and its mutants and glutamate-5-semialdehyde dehydrogenase ProA. Under conventional fermentation conditions, 86-119 g / L L-proline can accumulate in the fermentation broth after 62 hours, with a glucose conversion rate of 0.33-0.49 g / g, significantly higher than existing processes. This invention features low raw material costs, a short fermentation cycle, and high yield, making it a promising candidate for industrial application.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and bioengineering, specifically relating to a recombinant bacterium that produces L-proline, its construction method, and its application. Background Technology

[0002] L-proline is a high-value amino acid involved in protein synthesis and metabolism, and possesses various protective functions, such as stabilizing cell structure and enzymes, scavenging reactive oxygen species, and maintaining redox balance. In plants, L-proline is one of the most widely distributed compatible solutes, improving plant tolerance to salt stress and seedling survival rates. Therefore, it has wide applications in the pharmaceutical, agricultural, food, and chemical industries. The main production method for L-proline is microbial fermentation, with *Corynebacterium glutamicum* (*Corynebacterium*) being the primary method. Corynebacterium glutamicum *Corynebacterium glutamicum* has become the most commonly used proline industrial fermentation strain due to its natural proline synthesis capacity, efficient metabolic engineering plasticity, and excellent industrial adaptability. Although *Corynebacterium glutamicum* has a certain advantage in proline synthesis yield, its glucose substrate utilization rate is low, leaving considerable room for improvement. *Escherichia coli* (…) Escherichia coli Due to its clear genetic background, fast growth rate, easy regulation of metabolic pathways, and mature exogenous protein expression system, it has become an ideal strain for biosynthesis and is widely used for the efficient synthesis of amino acids and their derivatives.

[0003] In *E. coli*, glucose is used as a substrate and enters the tricarboxylic acid (TCA) cycle via glycolysis. Glutamate is generated using α-ketoglutarate as a TCA cycle node. Then, L-proline is produced from glutamate via catalysis by γ-glutamyl kinase (ProB), glutamate-semialdehyde dehydrogenase (ProA), and pyrroline-5-carboxylic acid reductase (ProC). Existing technologies mainly focus on the mutation and modification of ProB, a key enzyme in the L-proline synthesis pathway. Chinese invention patent CN101084312A reports that a mutation at position 149 of the ProB protein from *Corynebacterium glutamicum* can relieve feedback inhibition of L-proline production. Alternatively, there are studies on optimizing the de novo biosynthetic pathway of *Corynebacterium glutamicum*. Chinese invention patent CN114107141A uses a specific strong promoter to overexpress key genes in the pathway, thereby increasing the yield, conversion rate, and production intensity of L-proline in engineered strains. However, the utilization rate of glucose substrate in L-proline synthesis using recombinant Corynebacterium glutamicum as an engineered strain is currently low. There is a need to construct more efficient engineered strains to reduce production costs while achieving more efficient proline synthesis. Summary of the Invention

[0004] The purpose of this invention is to provide a method for constructing a recombinant strain for producing L-proline, and to apply it to the production of L-proline, which can achieve high yield, high glucose conversion rate, low cost and simple production process of L-proline, laying the foundation for subsequent industrial production of L-proline.

[0005] To achieve the above objectives, the present invention provides the following technical solution: One of the objectives of this invention is to provide a method for constructing a recombinant strain that produces L-proline, wherein the encoding genes of γ-glutamyl kinase ProB and glutamate-5-semialdehyde dehydrogenase ProA are introduced into recipient bacteria through a recombinant vector to obtain a recombinant strain that produces L-proline. The γ-glutamyl kinase ProB gene encodes a protein with the amino acid sequence of SEQ ID No. 1 or a derived protein with γ-glutamyl kinase activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 1. The glutamate-5-semialdehyde dehydrogenase ProA gene encodes a protein with the amino acid sequence of SEQ ID No. 2 or a derivative protein with glutamate-5-semialdehyde dehydrogenase activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 2. The recipient bacteria are mutant Escherichia coli or wild-type Escherichia coli.

[0006] Furthermore, the mutant Escherichia coli is obtained by modifying the d1 gene of wild-type Escherichia coli as follows: d1. Knock out L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase PutA; The L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase PutA gene encodes a protein with the amino acid sequence of SEQ ID No. 3 or a derived protein with L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 3. The L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase PutA gene is any one of the DNA molecules from d11 to d13. d11, whose coding sequence is the cDNA molecule or genomic DNA of SEQ ID No. 18; d12, a cDNA molecule or genomic DNA that hybridizes under stringent conditions to the DNA molecule defined by d11 and encodes the L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase described therein; d13, a cDNA molecule or genomic DNA that has 75% or more identity with the DNA molecule defined by d11 or d12 and encodes the L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase described therein; Furthermore, the mutant Escherichia coli is a mutant of the wild-type Escherichia coli obtained by performing any one of the following gene modifications (d2, d3, d4, d5, d6, and d7) or a combination of gene modifications on wild-type Escherichia coli and the mutant Escherichia coli obtained in the previous step: d2. Replace the NADPH-dependent glutamate dehydrogenase GdhA gene with the NADH-dependent glutamate dehydrogenase RocG gene. d3. Replace the soluble pyridine nucleotide transhydrogenase SthA gene with the pyridine nucleotide transhydrogenase PntAB gene. d4. Replace the PtsG gene of glucose transporter in the PTS transport system with the Glk gene of glucokinase; d5. Replace the GalR gene, a regulator of galactose transport and metabolism, with the Glf gene, a glucose promoter. d6. Replace the outer membrane protease OmpT gene with the phosphoenolpyruvate carboxylase Ppc gene; d7. Knock out isocitrate lyase AceA; The NADPH-dependent glutamate dehydrogenase GdhA gene encodes a protein with the amino acid sequence of SEQ ID No. 4, or a derivative protein with glutamate dehydrogenase activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 4.

[0007] The NADPH-dependent glutamate dehydrogenase GdhA gene is any one of the DNA molecules from d31 to d33: d31. Its coding sequence is the cDNA molecule or genomic DNA of SEQ ID No. 19; d32. A cDNA molecule or genomic DNA that hybridizes under stringent conditions with the DNA molecule defined by d31 and encodes the NADPH-dependent glutamate dehydrogenase described therein; d33, a cDNA molecule or genomic DNA that has 75% or more identity with the DNA molecule defined by d31 or d32 and encodes the NADPH-dependent glutamate dehydrogenase. The NADH-dependent glutamate dehydrogenase RocG gene encodes a protein with the amino acid sequence of SEQ ID No. 5 or a derived protein with glutamate dehydrogenase activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 5. The NADH-dependent glutamate dehydrogenase RocG gene is any one of the DNA molecules in d41-d43: d41. Its coding sequence is the cDNA molecule or genomic DNA of SEQ ID No. 20; d42. A cDNA molecule or genomic DNA that hybridizes under stringent conditions with the DNA molecule defined by d41 and encodes the NADH-dependent glutamate dehydrogenase. d43. A cDNA molecule or genomic DNA that has 75% or more identity with the DNA molecule defined by d41 or d42 and encodes the NADH-dependent glutamate dehydrogenase. The soluble pyridine nucleotide transhydrogenase SthA gene encodes a protein with the amino acid sequence of SEQ ID No. 6, or a derived protein with soluble pyridine nucleotide transhydrogenase activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 6. The soluble pyridine nucleotide transhydrogenase SthA gene is any one of the DNA molecules from d51 to d53: d51, whose coding sequence is the cDNA molecule or genomic DNA of SEQ ID No. 21; d52, a cDNA molecule or genomic DNA that hybridizes under stringent conditions to the DNA molecule defined by d51 and encodes the soluble pyridine nucleotide transhydrogenase; d53, a cDNA molecule or genomic DNA that has 75% or more identity with the DNA molecule defined by d51 or d52 and encodes the soluble pyridine nucleotide transhydrogenase; The pyridine nucleotide transhydrogenase PntAB gene encodes a protein with amino acid sequences of SEQ ID No. 7 and SEQ ID No. 8, or a derived protein with pyridine nucleotide transhydrogenase activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequences shown in SEQ ID No. 7 and SEQ ID No. 8.

[0008] The pyridine nucleotide transhydrogenase PntAB gene is any one of the DNA molecules from d61 to d63: d61. Its coding sequence is the cDNA molecule or genomic DNA of SEQ ID No. 22 and SEQ ID No. 23; d62, a cDNA molecule or genomic DNA that hybridizes under stringent conditions with the DNA molecule defined by d61 and encodes the pyridine nucleotide transhydrogenase; d63, a cDNA molecule or genomic DNA that has 75% or more identity with the DNA molecule defined by d61 or d62 and encodes the pyridine nucleotide transhydrogenase; The PTS transport system glucose transporter PtsG gene encodes a protein with the amino acid sequence of SEQ ID No. 9, or a derived protein with glucose transporter activity in the PTS transport system obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 9.

[0009] The glucose transporter PtsG gene in the PTS transport system is any one of the DNA molecules from d71 to d73: d71, whose coding sequence is the cDNA molecule or genomic DNA of SEQ ID No. 24; d72, a cDNA molecule or genomic DNA that hybridizes under stringent conditions with the DNA molecule defined by d71 and encodes the glucose transporter in the PTS transport system; d73, a cDNA molecule or genomic DNA that has 75% or more identity with the DNA molecule defined by d71 or d72 and encodes the glucose transporter in the PTS transport system; The glucokinase Glk gene encodes a protein with the amino acid sequence of SEQ ID No. 10 or a derived protein with glucokinase activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 10. The glucokinase Glk gene is any one of the DNA molecules from d81 to d83: d81, whose coding sequence is the cDNA molecule or genomic DNA of SEQ ID No. 25; d82, a cDNA molecule or genomic DNA that hybridizes under stringent conditions with the DNA molecule defined by d81 and encodes the glucokinase; d83, a cDNA molecule or genomic DNA that has 75% or more identity with the DNA molecule defined by d81 or d82 and encodes the glucokinase; The gene encoding the GalR gene, a regulator of galactose transport and metabolism, encodes a protein with the amino acid sequence SEQ ID No. 11, or a derived protein with regulatory activity of galactose transport and metabolism obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 11.

[0010] The GalR gene, a regulator of galactose transport and metabolism, is any one of the DNA molecules from d91 to d93. d91, whose coding sequence is the cDNA molecule or genomic DNA of SEQ ID No. 26; d92, a cDNA molecule or genomic DNA that hybridizes under stringent conditions to the DNA molecule defined by d91 and encodes the regulator of said galactose transport and metabolism; d93, a cDNA molecule or genomic DNA that has 75% or more identity with the DNA molecule defined by d91 or d92 and encodes the regulator of said galactose transport and metabolism. The glucose promoter Glf gene encodes a protein with the amino acid sequence of SEQ ID No. 12 or a derived protein with glucose promoter activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 12. The glucose promoter Glf gene is any DNA molecule from d101 to d103: d101, whose coding sequence is the cDNA molecule or genomic DNA of SEQ ID No. 27; d102, a cDNA molecule or genomic DNA that hybridizes under stringent conditions with the DNA molecule defined by d101 and encodes the glucose promoter; d103, a cDNA molecule or genomic DNA that has 75% or more identity with the DNA molecule defined by d101 or d102 and encodes the glucose promoter; The outer membrane protease OmpT gene encodes a protein with the amino acid sequence of SEQ ID No. 13 or a derived protein with outer membrane protease activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 13.

[0011] The outer membrane protease OmpT gene is any one of the DNA molecules d111-d113: d111, whose coding sequence is the cDNA molecule or genomic DNA of SEQ ID No. 28; d112, a cDNA molecule or genomic DNA that hybridizes under stringent conditions with the DNA molecule defined by d111 and encodes the outer membrane protease; d113, a cDNA molecule or genomic DNA that has 75% or more identity with the DNA molecule defined by d111 or d112 and encodes the outer membrane protease; The phosphoenolpyruvate carboxylase Ppc gene encodes a protein with the amino acid sequence of SEQ ID No. 14, or a derived protein with phosphoenolpyruvate carboxylase activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 14. The phosphoenolpyruvate carboxylase Ppc gene is any one of the DNA molecules from d121 to d123: d121, whose coding sequence is the cDNA molecule or genomic DNA of SEQ ID No. 29; d122, a cDNA molecule or genomic DNA that hybridizes under stringent conditions with the DNA molecule defined by d121 and encodes the phosphoenolpyruvate carboxylase; d123, a cDNA molecule or genomic DNA that has 75% or more identity with the DNA molecule defined by d121 or d122 and encodes the phosphoenolpyruvate carboxylase; The isocitrate lyase AceA gene encodes a protein with the amino acid sequence of SEQ ID No. 15 or a derivative protein with isocitrate lyase activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 15.

[0012] The isocitrate lyase AceA gene is any one of the DNA molecules from d21 to d23: d21. Its coding sequence is the cDNA molecule or genomic DNA of SEQ ID No. 30; d22. A cDNA molecule or genomic DNA that hybridizes under stringent conditions with the DNA molecule defined by d21 and encodes the isocitrate lyase; d23, a cDNA molecule or genomic DNA that has 75% or more identity with the DNA molecule defined by d21 or d22 and encodes the isocitrate lyase; The mutant Escherichia coli obtained after the above modifications in this invention is shown below: The mutant *E. coli* P1 is a wild-type *E. coli* mutant obtained by modifying the wild-type *E. coli* by d1, specifically by knocking out the coding gene for L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase PutA in *E. coli*. This modification is carried out using "Δ putA "express; The mutant *E. coli* P2 is a wild-type *E. coli* mutant obtained by modifying the wild-type *E. coli* on days 1 and 2. Specifically, the coding gene for L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase PutA is knocked out, and the coding gene for NADPH-dependent glutamate dehydrogenase GdhA is replaced with the coding gene for NADH-dependent glutamate dehydrogenase RocG. This modification is termed "ΔputAΔ". gdhA :: rocG "express; The mutant *E. coli* P3 is a wild-type *E. coli* mutant obtained by modifying the wild-type *E. coli* on days 1, 2, and 3. Specifically, the coding gene for L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase PutA is knocked out, the coding gene for NADPH-dependent glutamate dehydrogenase GdhA is replaced with the coding gene for NADH-dependent glutamate dehydrogenase RocG, and the coding gene for soluble pyridine nucleotide transhydrogenase SthA is replaced with the coding gene for pyridine nucleotide transhydrogenase PntAB. This modification is characterized by "Δ put AΔ gdhA :: rocG Δ sthA :: pntAB "express; The mutant Escherichia coli P4 is a wild-type Escherichia coli mutant obtained by modifying wild-type Escherichia coli on days 1, 2, 3, and 4. Specifically, the coding gene for L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase PutA is knocked out, the coding gene for NADPH-dependent glutamate dehydrogenase GdhA is replaced with the coding gene for NADH-dependent glutamate dehydrogenase RocG, the coding gene for soluble pyridine nucleotide transhydrogenase SthA is replaced with the coding gene for pyridine nucleotide transhydrogenase PntAB, and the coding gene for glucose transporter PtsG in the PTS transport system is replaced with the coding gene for glucokinase Glk. This modification is represented as "ΔputAΔgdhA::rocGΔsthA::pntABΔptsG::glk". The mutant *E. coli* P4-1 is a wild-type *E. coli* mutant obtained by modifying the wild-type *E. coli* on days 1, 2, 3, 4, and 5. Specifically, the coding gene for L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase PutA was knocked out; the coding gene for NADPH-dependent glutamate dehydrogenase GdhA was replaced with the coding gene for NADH-dependent glutamate dehydrogenase RocG; the coding gene for soluble pyridine nucleotide transhydrogenase SthA was replaced with the coding gene for pyridine nucleotide transhydrogenase PntAB; the coding gene for glucose transporter PtsG in the PTS transport system was replaced with the coding gene for glucokinase Glk; and the coding gene for galactose transport and metabolism regulator GalR was replaced with the coding gene for glucose promoter Glf. This modification is based on the principle of "Δ putA Δ gdhA :: rocG Δ sthA :: pntAB Δ ptsG :: glk Δ galR : :glf "express; The mutant *E. coli* P5 is a wild-type *E. coli* mutant obtained by modifying the wild-type *E. coli* on days 1, 2, 3, 4, 5, and 6. Specifically, the coding gene for L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase PutA is knocked out; the coding gene for NADPH-dependent glutamate dehydrogenase GdhA is replaced with the coding gene for NADH-dependent glutamate dehydrogenase RocG; the coding gene for soluble pyridine nucleotide transhydrogenase SthA is replaced with the coding gene for pyridine nucleotide transhydrogenase PntAB; the coding gene for glucose transporter PtsG in the PTS transport system is replaced with the coding gene for glucokinase Glk; the coding gene for galactose transport and metabolism regulator GalR is replaced with the coding gene for glucose promoter Glf; and the coding gene for outer membrane protease OmpT is replaced with the coding gene for phosphoenolpyruvate carboxylase Ppc. This modification is based on the "Δ putA Δ gdhA :: rocG Δ sthA :: pntAB Δ ptsG :: glk Δ galR :: glf Δ ompT :: PPC "express; The mutant *E. coli* P6 is a wild-type *E. coli* mutant obtained by modifying the wild-type *E. coli* on days 1, 2, 3, 4, 5, 6, and 7. Specifically, the coding gene for L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase PutA was knocked out; the coding gene for NADPH-dependent glutamate dehydrogenase GdhA was replaced with the coding gene for NADH-dependent glutamate dehydrogenase RocG; the coding gene for soluble pyridine nucleotide transhydrogenase SthA was replaced with the coding gene for pyridine nucleotide transhydrogenase PntAB; the coding gene for glucose transporter PtsG in the PTS transport system was replaced with the coding gene for glucokinase Glk; the coding gene for galactose transport and metabolism regulator GalR was replaced with the coding gene for glucose promoter Glf; the coding gene for outer membrane protease OmpT was replaced with the coding gene for phosphoenolpyruvate carboxylase Ppc; and the coding gene for isocitrate lyase AceA was knocked out. This modification is characterized by "Δ putA Δ gdhA :: rocG Δ sthA :: pntAB Δ ptsG :: glk Δ ga lR:: glf Δ ompT :: pp c Δ aceA "express; Both gene knockout and gene replacement mentioned above can be achieved through homologous recombination.

[0013] Furthermore, the promoter for initiating transcription of the coding genes of γ-glutamyl kinase and its mutants and glutamate-5-semialdehyde dehydrogenase and its mutants in the recombinant vector is the arabinose (ara) promoter, and the terminator for terminating transcription of the coding genes of γ-glutamyl kinase and its mutants and glutamate-5-semialdehyde dehydrogenase and its mutants is the rrnB terminator.

[0014] Furthermore, the recombinant vector is obtained by recombination of the fragment between the XhoI and BglⅡ recognition sites of the DNA molecule replacement vector pBAD / hisB with SEQ ID No. 16 and the fragment between the PstI and KpnI recognition sites of the DNA molecule replacement vector pBAD / hisB with SEQ ID No. 17.

[0015] The second objective of this invention is to provide a recombinant bacterium for producing L-proline.

[0016] The third objective of this invention is to provide an application of recombinant bacteria in the production of L-proline.

[0017] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows: 1. This invention constructs a novel recombinant bacterial strain capable of directly fermenting glucose to produce L-proline, enhancing the carbon metabolic flux allocation between oxaloacetate and glutamate and strengthening NADPH supply according to the L-proline biosynthetic pathway. Under conventional fermentation conditions, 86-119 g / L L-proline can accumulate in the fermentation broth after 62 hours, with a glucose conversion rate of 0.33-0.49 g / g glucose, which is significantly higher than existing processes. The direct fermentation of glucose to produce L-proline using the constructed recombinant strain in this invention offers advantages over existing fermentation methods, including lower raw material costs, simpler culture conditions, less equipment wear and tear, shorter fermentation cycle, higher yield, and significantly higher glucose conversion rate. Attached Figure Description

[0018] Figure 1 This is a schematic diagram showing the production of L-proline by recombinant strains PRO01, PRO02, PRO03, PRO04, PRO05, PRO06, and PRO07 from Escherichia coli K12 in Example 1 of the present invention. Figure 2 This is a schematic diagram showing the L-proline production of recombinant strains PRO06, PRO08, PRO09, PRO10, PRO11, PRO12 and PRO13 in Example 2 of the present invention; Figure 3 This is a schematic diagram showing the yield of L-proline and glucose consumption of the recombinant strain PRO08 obtained in Example 2 of the present invention in 10 L fermentation. Figure 4 This diagram illustrates the yield of L-proline and glucose consumption of the recombinant strain PRO13 obtained in Example 2 of this invention during 10 L fermentation. Detailed Implementation

[0019] The present invention will be further described below with reference to preferred embodiments. The endpoints and any values ​​of the ranges disclosed in the present invention are not limited to the precise ranges or values. These ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges. These numerical ranges should be considered as specifically disclosed herein.

[0020] Unless otherwise specified, the experimental methods in the following examples are conventional methods, performed in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions.

[0021] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0022] The molecular biology experiments not specifically described in the following examples include vector construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation, which are mainly performed with reference to "Molecular Cloning: A Laboratory Manual" (3rd edition); PCR amplification experiments are performed according to the reaction conditions or kit instructions provided by the vector or DNA template supplier.

[0023] In the examples below, the wild-type Escherichia coli was Escherichia coli K12. Escherichia coli K12 and its gene knockout mutants K12ΔputA and K12ΔaceA are described in Tomoya Baba et al. (Construction of...) Escherichia coli The article "K-12 in-frame, single-gene knockout mutants: the Keiocollection. Molecular Systems Biology 2006, doi:10.1038 / msb4100050" is available to the public from Fujian Normal University. This biological material is only for repeating the experiments of this invention and may not be used for other purposes.

[0024] The vector pBAD used in the following examples was a product of Invitrogen (product catalog number: V43001); the seamless ligase was a product of Vazyme (product catalog number: C112); and the pCas plasmid and pTargetF plasmid were purchased from Addgene (product numbers Plasmid #62225 and Plasmid #62226, respectively).

[0025] The recombinant bacteria PRO01-PRO13 in the following examples are available to the public from Fujian Normal University. This biological material is only used to repeat the experiments of this invention and shall not be used for other purposes.

[0026] In the following embodiments, the symbol "::" indicates replacement or keying; "Δ" indicates keying out. Example 1 This embodiment provides a method for constructing recombinant bacteria for producing L-proline, the specific steps of which are as follows: I. Construction of Recombinant Vectors The DNA sequence between the XhoI and BglⅡ recognition sites of the pBAD / hisB vector was replaced with the DNA sequence encoding γ-glutamyl kinase ProB shown in SEQ ID No. 16; the DNA sequence between the PstI and KpnI recognition sites was replaced with the DNA sequence encoding glutamate-5-semialdehyde dehydrogenase ProA shown in SEQ ID No. 17; the other DNA sequences remained unchanged, resulting in the recombinant vector PBA. Enzyme digestion confirmed that the coding genes for ProB and ProA were successfully inserted between the XhoI and KpnI recognition sites of the pBAD / hisB vector; the recombinant vector PBA can express γ-glutamyl kinase shown in SEQ ID No. 1 and glutamate-5-semialdehyde dehydrogenase shown in SEQ ID No. 2; II. Construction of a mutant Escherichia coli P1 strain K12ΔputA that inhibits L-proline degradation (1) Preparation of electrocompetent cells: pCas plasmid was transformed into Escherichia coli K12, and positive clones were screened by culturing on LB plates with a kanamycin concentration of 50 μg / mL at 30℃. The positive clones were then inoculated into LB liquid medium containing 2 g / L arabinose and cultured at 30℃ until OD. 600 After reaching a density of approximately 0.6, electrocompetent cells were prepared. (2) Construction of pTarget plasmid: N20 with putA gene knocked out was selected using the website https: / / crispy.secondarymetabolites.org. Primers were designed to construct pTarget plasmid. Using pTargetF as template, PCR amplification was performed using primer pairs pTarget-putA-F and pTarget-putA-R to obtain a fragment of approximately 2100 bp. After digestion with DpnI methyltransferase for about 3 h, the fragment was transformed into E. coli DH5α competent cells. Positive clones were screened on LB plates with streptomycin concentration of 50 μg / mL and sequenced using primer pTarget-cexu-F. After correct sequencing, the clone was named pTarget-putA. The primer sequences used are as follows: pTarget-putA-F: 5'- ctgttctacttcacgcggcggttttagagctagaaatagcaagttaaaat-3'; pTarget-putA-R: 5'- cgccgcgtgaagtagaacagactagtattatacctaggactgagct -3'; pTarget-cexu-F: 5'-ctttcctgcgttatcccctg-3'; (3) Amplification of the targeting fragment: PCR amplification was performed using primers putA-up-F and putA-up-R, and putA-down-F and putA-down-R, respectively, yielding fragments of approximately 500 bp in size. Using a mixture of the two fragments as a template, PCR amplification was performed using primer pairs putA-up-F and putA-down-R, respectively, yielding putA targeting fragments of approximately 1000 bp in size. The targeting fragments were recovered, and from upstream to downstream, they contained a 500 bp upstream homologous arm, leaving only a 21 bp putA mutant gene and a 500 bp downstream homologous arm. The primer sequences used are as follows: putA-up-F: 5'-ccaggcgataaacccaa-3'; putA-up-R: 5'-ctacctgtttaacctatggttcccatgccattac-3'; putA-down-F: 5'-tggcatgggaaccataggttaaacaggtagccg-3'; putA-down-R: 5'- aggcgctgtatattgcc -3'; (4) Electroporation: 200 ng of pTarget-putA plasmid, 400 ng of putA targeting fragment and 100 μL of electroporation competent cells prepared in step (1) were mixed and placed in a 2 mm electroporation cuvette. After electroporation at 2.5 kV, 1 mL of LB liquid medium was added and the cells were recovered at 30℃. The mixture was then spread on LB plates containing kanamycin and streptomycin (kanamycin concentration was 50 μg / mL and streptomycin concentration was 50 μg / mL). The cells were cultured at 30℃, positive clones were screened, and PCR amplification was performed using primers putA-up-F and putA-down-R. The amplified fragments were then sequenced for verification. (5) Elimination of pTarget plasmid: Positive clones with correct sequencing were inoculated into LB liquid medium containing 0.1 mM IPTG and kanamycin and incubated overnight at 30°C to eliminate the pTarget-putA plasmid. The overnight culture was streaked onto LB plates containing kanamycin and incubated at 30°C to obtain the mutant Escherichia coli P1 recombinant strain (K12ΔputA) containing the pCas plasmid.

[0027] III. Constructing a mutant Escherichia coli P3 recombinant strain (K12ΔputAΔgdhA::rocGΔsthA::pntAB) with enhanced glutamate synthesis pathway and NADPH supply. (1) The mutant Escherichia coli P1 strain K12ΔputA obtained through the above steps was inoculated into LB liquid medium containing 2 g / L arabinose and cultured at 30°C until OD. 600 After reaching a density of approximately 0.6, electrocompetent cells were prepared. (2) Construction of pTarget plasmid: Using the website https: / / crispy.secondarymetabolites.org, N20 with the gdhA gene knocked out was selected, and primers were designed to construct the pTarget plasmid. Using pTargetF as a template, PCR amplification was performed using primer pairs pTarget-gdhA-F and pTarget-gdhA-R, respectively, to obtain a fragment of approximately 2100 bp. After digestion with DpnI methyltransferase for about 3 h, it was directly transformed into E. coli DH5α competent cells using chemical transformation. Positive clones were screened on LB plates with a streptomycin concentration of 50 μg / mL and sequenced using primer pTarget-cexu-F. After correct sequencing, it was named pTarget-gdhA. The primer sequences used are as follows: pTarget-gdhA-F: 5'-cttattcgcccggaagctacgttttagagctagaaatagcaagttaaaa-3'; pTarget-gdhA-R: 5'- gtagcttccgggcgaataagactagtattatacctaggactgagct -3'; (3) Amplification of the targeting fragment: PCR amplification was performed using primer pairs gdhA::rocG-Up-F and gdhA::rocG-Up-R, rocG-F and rocG-R, and gdhA::rocG-down-F and gdhA::rocG-down-R, yielding fragments of approximately 500 bp, 1300 bp, and 500 bp, respectively. Using a mixture of the three fragments as a template, PCR amplification was performed using primer pairs gdhA::rocG-up-F and gdhA::rocG-down-R, yielding a gdhA::rocG targeting fragment of approximately 2300 bp. The targeting fragment was recovered, and from upstream to downstream, it contained a 500 bp upstream homologous arm, the rocG gene, and a 500 bp downstream homologous arm. The primer sequences used are as follows: gdhA::rocG-Up-F:5'-actagtattatacctaggactgagct-3'; gdhA::rocG-Up-R:5'-acgtggtgttagctgtgagatataaaacccttatatattaatacgatt-3'; rocG-F: 5'-ggaggaattaaccatgggtatgtcagcaaagcaagtct-3'; rocG-R: 5'-gagctcaccgaattcttagacccatccgcggaa-3'; gdhA::rocG-down-F:5'-tcgaaagactgggccttgttgtaaatgcctgatggc-3'; gdhA::rocG-down-R:5'-gactatatctctgattgcgct-3'; (4) Electroporation: 200 ng of pTarget-gdhA plasmid, 400 ng of gdhA targeting fragment and 100 μL of electroporation competent cells prepared in step (1) were mixed and placed in a 2 mm electroporation cuvette. After electroporation at 2.5 kV, 1 mL of LB liquid medium was added and the cells were recovered at 30℃. The mixture was then spread on LB plates containing kanamycin and streptomycin (kanamycin concentration of 50 μg / mL and streptomycin concentration of 50 μg / mL). The cells were cultured at 30℃, and positive clones were screened. PCR amplification was performed using primers gdhA::rocG-Up-F and gdhA::rocG-down-R. The amplified fragments were then sequenced for verification. (5) Elimination of pTarget plasmid: Positive clones with correct sequencing were inoculated into LB liquid medium containing 0.1 mM IPTG and kanamycin and incubated overnight at 30°C to eliminate the pTarget-gdhA plasmid. The overnight culture was streaked onto LB plates containing kanamycin and incubated at 30°C to obtain a mutant Escherichia coli P2 recombinant strain (K12ΔputAΔgdhA::rocG) containing the pCas plasmid. (6) The mutant Escherichia coli P2 strain K12ΔputAΔgdhA::rocG containing the pCas plasmid obtained in step (5) above was inoculated into LB liquid medium containing 2 g / L arabinose and cultured at 30°C until OD. 600 After reaching a density of approximately 0.6, electrocompetent cells were prepared. (7) Construction of pTarget plasmid: Using the website https: / / crispy.secondarymetabolites.org, select N20 with the sthA gene knocked out, design primers to construct the pTarget plasmid; using pTargetF as a template, perform PCR amplification with primer pairs pTarget-sthA-F and pTarget-sthA-R respectively to obtain a fragment of approximately 2100 bp. After digestion with DpnI methyltransferase for about 3 h, directly transform E. coli DH5α competent cells using chemical transformation method. Positive clones are screened on LB plates containing streptomycin (streptomycin concentration of 50 μg / mL) and verified by sequencing with primer pTarget-cexu-F. After correct sequencing, it is named pTarget-sthA. The primer sequences used are as follows: pTarget-sthA-F: 5'-gaagagtacgagaagatcgagttttagagctagaaatagcaag-3'; pTarget-sthA-R: 5'-tcgatcttctcgtactcttcactagtattatacctaggactgag-3'; (8) Amplification of the targeting fragment: PCR amplification was performed using primer pairs sthA::pntAB-Up-F and sthA::pntAB-Up-R, pntAB-F and pntAB-R, and sthA::pntAB-down-F and sthA::pntAB-down-R, yielding fragments of approximately 500 bp, 3000 bp, and 500 bp, respectively. Using a mixture of the three fragments as a template, PCR amplification was performed using primer pairs sthA::pntAB-up-F and sthA::pntAB-down-R, yielding a 4000 bp sthA::pntAB targeting fragment. The targeting fragment was recovered, and from upstream to downstream, it contained a 500 bp upstream homologous arm, the pntAB gene, and a 500 bp downstream homologous arm. The primer sequences used are as follows: sthA::pntAB-Up-F:5'-tctacgtcgcggaaatg-3'; sthA::pntAB-Up-R:5'-gtggtgttagctgtgggtagggcttacctgttc-3'; pntAB-F: 5'-aggaggaattaaccatgggtatgcgaattggcatacca-3'; pntAB-R: 5'-gagctcaccgaattcttacagagctttcaggattgc-3'; sthA::pntAB-down-F:5'-tcgaaagactgggccttttaaaccgcctgttttaaaac-3'; sthA::pntAB-down-R:5'-cgcaactggacagcg-3'; (9) Electroporation: 200 ng of pTarget-sthA plasmid, 400 ng of sthA targeting fragment and 100 μL of electroporation competent cells prepared in step (6) were mixed and placed in a 2 mm electroporation cuvette. Electroporation was performed at 2.5 kV. After recovery at 30°C, 1 mL of LB liquid medium was added and the mixture was plated on LB plates containing kanamycin and streptomycin (kanamycin concentration was 50 μg / mL and streptomycin concentration was 50 μg / mL). The mixture was cultured at 30°C, and positive clones were screened. PCR amplification was performed using primers sthA::pntAB-up-F and sthA::pntAB-down-R. The amplified fragments were sequenced for verification. (10) Elimination of pTarget plasmid: Positive clones with correct sequencing were inoculated into LB liquid medium containing 0.1 mM IPTG and kanamycin and incubated overnight at 30°C to eliminate the pTarget-sthA plasmid. The overnight culture was streaked onto LB plates containing kanamycin and incubated at 30°C to obtain the mutant Escherichia coli P3 recombinant strain K12ΔputAΔgdhA::rocGΔsthA::pntAB containing the pCas plasmid.

[0028] IV. Constructing a mutant Escherichia coli P6 recombinant strain with enhanced glucose conversion rate (K12ΔputAΔgdhA::rocGΔsthA::pntABΔptsG::glkΔgalR::glfΔompT::ppcΔaceA); (1) The mutant Escherichia coli P3 strain K12ΔputAΔgdhA::rocGΔsthA::pntAB containing the pCas plasmid obtained in step (10) above was inoculated into LB liquid medium containing 2 g / L arabinose and cultured at 30°C until OD 600 After reaching a density of approximately 0.6, electrocompetent cells were prepared. (2) Construction of pTarget plasmid: Using the website https: / / crispy.secondarymetabolites.org, N20 with the ptsG gene knocked out was selected, and primers were designed to construct the pTarget plasmid. Using pTargetF as a template, PCR amplification was performed using primer pairs pTarget-ptsG-F and pTarget-ptsG-R to obtain a fragment of approximately 2100 bp. After digestion with DpnI methyltransferase for about 3 h, the fragment was directly transformed into E. coli DH5α competent cells using chemical transformation. Positive clones were screened on LB agar plates containing streptomycin (streptomycin concentration of 50 μg / mL) and verified by sequencing with primer pTarget-cexu-F. After correct sequencing, the clone was named pTarget-ptsG. The primer sequences used are as follows: pTarget-ptsG-F: 5'-ggtgaatacaccaacgcagcgttttagagctagaaatagcaagttaa-3'; pTarget-ptsG-R:5'-gctgcgttggtgtattcaccactagtattatacctaggactgagct-3'; (3) Amplification of the targeting fragment: PCR amplification was performed using primer pairs ptsG::glk-Up-F and ptsG::glk-Up-R, glk-F and glk-R, and ptsG::glk-down-F and ptsG::glk-down-R, yielding fragments of approximately 500 bp, 1000 bp, and 500 bp, respectively. Using a mixture of the three fragments as a template, PCR amplification was performed using primer pairs ptsG::glk-up-F and ptsG::glk-down-R, yielding a ptsG::glk targeting fragment of approximately 2000 bp. The targeting fragment was recovered, and from upstream to downstream, it contained a 500 bp upstream homologous arm, the glk gene, and a 500 bp downstream homologous arm. The primer sequences used are as follows: ptsG::glk-Up-F:5'-cctggatcggttactggtg-3'; ptsG::glk-Up-R:5'-acgtggtgttagctgtgaattgagagtgctcctgag-3'; glk-F: 5'-ggaggaattaaccatgggtatgacaaagtatgcattagtcg-3'; glk-R: 5'-gagctcaccgaattcttacagaatgtgacctaaggtctg-3'; ptsG::glk-down-F:5'-tcgaaagactgggccttgaacgccaactaaaatttcc-3'; ptsG::glk-down-R:5'-gtggatgggacagtcagt-3'; (4) Electroporation: 200 ng of pTarget-ptsG plasmid, 400 ng of ptsG::glk targeting fragment and 100 μL of electroporation competent cells prepared in step (1) were mixed and placed in a 2 mm electroporation cuvette. Electroporation was performed at 2.5 kV. After recovery at 30°C, 1 mL of LB liquid medium was added and the mixture was plated on LB plates containing kanamycin and streptomycin (kanamycin concentration was 50 μg / mL and streptomycin concentration was 50 μg / mL). The mixture was cultured at 30°C, positive clones were screened, and PCR amplification was performed using primers ptsG::glk-Up-F and ptsG::glk-down-R. The amplified fragments were sequenced for verification. (5) Elimination of pTarget plasmid: Positive clones with correct sequencing were inoculated into LB liquid medium containing 0.1 mM IPTG and kanamycin and incubated overnight at 30°C to eliminate the pTarget-ptsG plasmid. The overnight culture was streaked onto LB plates containing kanamycin and incubated at 30°C to obtain the mutant E. coli P4 recombinant strain K12ΔputAΔgdhA::rocGΔsthA::pntABΔptsG::glk containing the pCas plasmid.

[0029] (6) The mutant E. coli P4 strain K12ΔputAΔgdhA::rocGΔsthA::pntABΔptsG::glk containing the pCas plasmid obtained in step (5) was inoculated into LB liquid medium containing 2 g / L arabinose and cultured at 30°C until OD 600 After reaching a density of approximately 0.6, electrocompetent cells were prepared. (7) Construction of pTarget plasmid: Using the website https: / / crispy.secondarymetabolites.org, select N20 with the galR gene knocked out, design primers to construct the pTarget plasmid; using pTargetF as a template, perform PCR amplification with primer pairs pTarget-galR-F and pTarget-galR-R respectively to obtain a fragment of approximately 2100 bp. After digestion with DpnI methyltransferase for about 3 h, directly transform E. coli DH5α competent cells using chemical transformation method. Positive clones are screened on LB plates containing streptomycin (streptomycin concentration of 50 μg / mL), and verified by sequencing with primer pTarget-cexu-F. After correct sequencing, it is named pTarget-galR. The primer sequences used are as follows: pTarget-galR-F: 5'-acgcgtcatttaattcagcagttttagagctagaaatagcaagttaa-3'; pTarget-galR-R:5'-tgctgaattaaatgacgcgtactagtattatacctaggactgagct-3'; (8) Amplification of the targeting fragment: PCR amplification was performed using primer pairs galR::glf-Up-F and galR::glf-Up-R, glf-F and glf-R, and galR::glf-down-F and galR::glf-down-R, yielding fragments of approximately 500 bp, 1500 bp, and 500 bp, respectively. Using a mixture of the three fragments as a template, PCR amplification was performed using primer pairs galR::glf-up-F and galR::glf-down-R, yielding a galR::glf targeting fragment of approximately 2500 bp. The targeting fragment was recovered. The targeting fragment, from upstream to downstream, contains a 500 bp upstream homologous arm, the glf gene, and a 500 bp downstream homologous arm. The primer sequences used are as follows: galR::glf-Up-F:5'-catccgcgcaggttg-3'; galR::glf-Up-R:5'-acgtggtgttagctgtggaaaataccttagtgggtaaac-3'; glf-F: 5'-ggaggaattaaccatgggtatgagctctgaaagttcaca-3'; glf-R: 5'-gagctcaccgaattcttacttctggctactctttcat-3'; galR::glf-down-F:5'-tcgaaagactgggccttccgcagttaaagcaattc-3'; galR::glf-down-R:5'-acatcgggataacgtgcc-3'; (9) Electroporation: 200 ng of pTarget-galR plasmid, 400 ng of galR targeting fragment and 100 μL of electroporation competent cells prepared in step (6) were mixed and placed in a 2 mm electroporation cuvette. Electroporation was performed at 2.5 kV. After recovery at 30°C, 1 mL of LB liquid medium was added and the mixture was spread on LB plates containing kanamycin and streptomycin (kanamycin concentration of 50 μg / mL and streptomycin concentration of 50 μg / mL). The mixture was cultured at 30°C, and positive clones were screened. PCR amplification was performed using primers galR::glf-up-F and galR::glf-down-R. The amplified fragments were sequenced for verification. (10) Elimination of pTarget plasmid: Positive clones with correct sequencing were inoculated into LB liquid medium containing 0.1 mM IPTG and kanamycin and incubated overnight at 30°C to eliminate the pTarget-galR plasmid. The overnight culture was streaked onto LB plates containing kanamycin and incubated at 30°C to obtain the mutant Escherichia coli P4-1 recombinant strain K12ΔputAΔgdhA::rocGΔsthA::pntABΔptsG::glkΔgalR::glf.

[0030] (11) The mutant Escherichia coli P4-1 strain K12ΔputAΔgdhA::rocGΔsthA::pntABΔptsG::glkΔgalR::glf containing the pCas plasmid obtained in step (10) was inoculated into LB liquid medium containing 2 g / L arabinose and cultured at 30°C until OD 600 After reaching a density of approximately 0.6, electrocompetent cells were prepared. (12) Construction of pTarget plasmid: N20 with ompT gene knockout was selected using the website https: / / crispy.secondarymetabolites.org, and primers were designed to construct the pTarget plasmid; using pTargetF as a template, PCR amplification was performed using primer pairs pTarget-ompT-F and pTarget-ompT-R to obtain a fragment of approximately 2100 bp. After digestion with DpnI methyltransferase for about 3 h, it was directly transformed into E. coli DH5α competent cells using chemical transformation. Positive clones were screened on LB plates containing streptomycin (streptomycin concentration of 50 μg / mL), and sequenced using primer pTarget-cexu-F for verification. After correct sequencing, it was named pTarget-ompT. The primer sequences used are as follows: pTarget-ompT -F:5'-gatatcggctccttcccgaagttttagagctagaaatagcaagttaa-3'; pTarget-ompT-R:5'-ttcgggaaggagccgatatcactagtattatacctaggactgagct-3'; (13) Amplification of the targeting fragment: PCR amplification was performed using primer pairs ompT::ppc-Up-F and ompT::ppc-Up-R, ppc-F and ppc-R, and ompT::ppc-down-F and ompT::ppc-down-R, yielding fragments of approximately 500 bp, 2700 bp, and 500 bp, respectively. Using a mixture of the three fragments as a template, PCR amplification was performed using primer pairs ompT::ppc-up-F and ompT::ppc-down-R, yielding an ompT::ppc targeting fragment of approximately 3700 bp. The targeting fragment was recovered, and from upstream to downstream, it contained a 500 bp upstream homologous arm, the ppc gene, and a 500 bp downstream homologous arm. The primer sequences used are as follows: ompT::ppc-Up-F:5'-aaacggataagacgggc-3'; ompT::ppc-Up-R:5'-acgtggtgttagctgtgaaaagttctccattcaatcgt-3'; ppc-F: 5'-ggaggaattaaccatgggtatgaacgaacaatattccg-3'; ppc-R: 5'-gagctcaccgaattcttagccggtattacgcatac-3'; ompT::ppc-down-F:5'-tcgaaagactgggccttgaacgccaactaaaatttcc-3'; ompT::ppc-down-R:5'- atattgagagatactaggatgagg -3'; (14) Electroporation: 200 ng of pTarget-ompT plasmid, 400 ng of ppc targeting fragment and 100 μL of electroporation competent cells prepared in step (11) were mixed and placed in a 2 mm electroporation cuvette. Electroporation was performed at 2.5 kV. After recovery at 30°C, 1 mL of LB liquid medium was added and the mixture was spread on LB plates containing kanamycin and streptomycin (kanamycin concentration was 50 μg / mL and streptomycin concentration was 50 μg / mL). The mixture was cultured at 30°C, positive clones were screened, and PCR amplification was performed using primer pairs ompT::ppc-up-F and ompT::ppc-down-R. The amplified fragments were sequenced for verification. (15) Elimination of pTarget plasmid: Positive clones with correct sequencing were inoculated into LB liquid medium containing 0.1 mM IPTG and kanamycin and incubated overnight at 30°C to eliminate the pTarget-ompT plasmid. The overnight culture was streaked onto LB plates containing kanamycin and incubated at 30°C to obtain the mutant Escherichia coli P5 recombinant strain K12ΔputAΔgdhA::rocGΔsthA::pntABΔptsG::glkΔgalR::glfΔompT::ppc.

[0031] (16) The mutant E. coli P5 strain K12ΔputAΔgdhA::rocGΔsthA::pntABΔptsG::glkΔgalR::glfΔompT::ppc obtained in step (15) containing the pCas plasmid was inoculated in LB liquid medium containing 2 g / L arabinose and cultured at 30°C until OD 600 After reaching a density of approximately 0.6, electrocompetent cells were prepared. (17) Construction of pTarget plasmid: N20 with aceA gene knockout was selected using the website https: / / crispy.secondarymetabolites.org. Primers were designed to construct pTarget plasmid. Using pTargetF as template, PCR amplification was performed using primer pairs pTarget-aceA-F and pTarget-aceA-R to obtain a fragment of approximately 2100 bp. After digestion with DpnI methyltransferase for about 3 h, it was directly transformed into E. coli DH5α competent cells using chemical transformation. Positive clones were screened on LB plates containing streptomycin (streptomycin concentration of 50 μg / mL) and sequenced using primer pTarget-cexu-F. After correct sequencing, it was named pTarget-aceA. The primer sequences used are as follows: pTarget-aceA-F: 5'-gcgtctggcagctgacgtgagttttagagctagaaatagcaagttaaaa-3'; pTarget-aceA-R:5'-tcacgtcagctgccagacgcactagtattatacctaggactgagct-3'; (18) Amplification of the targeting fragment: PCR amplification was performed using primers aceA-up-F and aceA-up-R, and aceA-down-F and aceA-down-R, respectively, yielding fragments of approximately 500 bp in size. Using a mixture of the two fragments as a template, PCR amplification was performed using primer pairs aceA-up-F and aceA-down-R, respectively, yielding aceA targeting fragments of approximately 1000 bp in size. The targeting fragments were recovered. The targeting fragments contained a 500 bp upstream homologous arm from upstream to downstream, leaving only a 21 bp aceA mutant gene and a 500 bp downstream homologous arm. The primer sequences used are as follows: aceA-up-F: 5'-gacattctcggctccc-3'; aceA-up-R:5'-gttgcttagaactgggttttcatgtgcagatgc-3'; aceA-down-F: 5'-tgcacatgaaaacccagttctaagcaacaacaacc-3'; aceA-down-R:5'-agctctccgcaatctc-3'; (19) Electroporation: 200 ng of pTarget-aceA plasmid, 400 ng of aceA targeting fragment and 100 μL of electroporation competent cells prepared in step (16) were mixed and placed in a 2 mm electroporation cuvette. Electroporation was performed at 2.5 kV. After recovery at 30°C, 1 mL of LB liquid medium was added and the mixture was spread on LB plates containing kanamycin and streptomycin (kanamycin concentration was 50 μg / mL and streptomycin concentration was 50 μg / mL). The mixture was cultured at 30°C, positive clones were screened, and PCR amplification was performed using primers aceA-up-F and aceA-down-R. The amplified fragments were sequenced for verification. (20) Elimination of pTarget plasmid: Positive clones with correct sequencing were inoculated into LB liquid medium containing 0.1 mM IPTG and kanamycin and incubated overnight at 30°C to eliminate the pTarget-ompT plasmid. The overnight culture was streaked onto LB plates containing kanamycin and incubated at 30°C to obtain the mutant E. coli P6 recombinant strain K12ΔputAΔgdhA::rocG ΔsthA::pntABΔptsG::glkΔgalR::glfΔompT::ppcΔaceA.

[0032] V. Construction of recombinant strains for converting glucose to produce L-proline The recombinant vector PBA obtained was introduced into constructed mutant Escherichia coli strains P1, P2, P3, P4, P5, and P6, and wild-type Escherichia coli strain K12 using the calcium chloride method. Positive clones were screened on plates containing ampicillin, and the obtained positive clones were named as follows: PBA / K12ΔputA (strain number PRO01); PBA / K12ΔputAΔgdhA::rocG (strain number PRO02); PBA / K12ΔputAΔgdhA::rocGΔsthA::pntAB (strain number PRO03); PBA / K12ΔputAΔgdhA::rocG ΔsthA::pntABΔptsG::glkΔgalR::glf (strain number PRO04); PBA / K12ΔputAΔgdhA::rocGΔsthA::pntABΔptsG::glkΔgalR::glfΔompT::ppc (strain number PRO05); PBA / K12ΔputAgdhA::rocGΔsthA::pntABΔptsG::glkΔgalR::glfΔompT::ppcΔaceA (strain number PRO06); PBA / K12 (strain number PRO07).

[0033] VI. Culture and Self-Induction of Recombinant Strains The recombinant L-proline strains PRO01, PRO02, PRO03, PRO04, PRO05, PRO06, and PRO07 constructed above were streaked onto LB agar plates containing 1.5% agar and 100 μg / mL ampicillin, and incubated at 37°C for 12 h. Single colonies from the plates were picked and inoculated into liquid LB medium containing 100 μg / mL ampicillin, and cultured overnight at 37°C with shaking at 220 rpm. The overnight culture was then inoculated at 1% into self-induction medium ZYM and shaken at 200 rpm and 30°C for 16 h to obtain the induced strains PRO01-PRO07 and Escherichia coli K12, respectively. No antibiotics were added during the culture of strain K12.

[0034] VII. Recombinant bacteria transform L-glutamic acid into L-proline The recombinant L-proline strains PRO01, PRO02, PRO03, PRO04, PRO05, PRO06, PRO07 and Escherichia coli K12 constructed above were centrifuged at 8000 g for 10 min at 4 °C to collect the bacterial cells. The bacterial cells were then washed once with 10 mM sodium chloride aqueous solution and collected again under the same centrifugation conditions to obtain washed PRO01-PRO07 and Escherichia coli K12, respectively. The washed strains were resuspended in PBS buffer (pH 7.0) containing 20 g / L glucose and 7.5 g / L glutamate to obtain the transformation solution of the strains. The bacterial cell content in the transformation solution was 45 g / L on a wet weight basis. Finally, the transformation solution was subjected to L-glutamate to L-proline conversion at 30 °C and 220 rpm for 24 h. For L-proline production data of different strains, please refer to the appendix of the instruction manual. Figure 1 ,from Figure 1The results show that after 24 h of transformation, *E. coli* K12 (PRO07) containing the PBA plasmid produced 1.2 g / L of L-proline; however, no L-proline was detected after 24 h of transformation with *E. coli* K12. After 24 h of transformation, strains PRO01 and PRO02 produced 2.2 g / L and 4.5 g / L of L-proline, respectively, representing increases of 83% and 275% compared to PRO7. Strains PRO03 and PRO04 produced 5.0 g / L and 6.2 g / L of L-proline, respectively, representing increases of 316% and 416% compared to PRO07. Strains PRO05 and PRO06 produced 6.9 g / L and 7.6 g / L of L-proline, respectively, representing increases of 475% and 533% compared to PRO07. Among these, strain PRO06 produced the highest yield, significantly improving the molar conversion rate of glucose and L-glutamic acid compared to the original strain.

[0035] Example 2 This embodiment provides the screening of ProB protein mutants and the transformation of recombinant strains into L-glutamic acid for L-proline synthesis. I. Mutation of ProB protein and construction of recombinant strains.

[0036] The ProB protein was subjected to random mutation and high-throughput screening to obtain three single mutant proteins (ProB...). T126A ProB K288R ProB V324I These three mutation sites were then compared with ProB. I150T After combination, three double mutant proteins (ProB) were obtained. I150T / T126A ProB I150T / K288R ProB I150T / V324I ) and two triple-mutated proteins (ProB) I150T / K288R / V324I ProB I150T / T126A / V324I ), using ProB I150T L-proline-synthesizing strains were constructed using a single mutant protein, three double mutant proteins, and two triple mutant proteins. This involved replacing the original ProB protein in the recombinant vector PBA with these six mutant proteins. Then, L-proline-synthesizing strain PRO08 (ProB) was constructed using the same method as for strain PRO06. I150T PRO09 (ProB) I150T / T126A PRO10 (ProB) I150T / K288R PRO11 (ProB) I150T / V324I PRO12 (ProB) I150T / K288R / V324I ) and PRO13 (ProB I150T / T126A / V324I ).

[0037] II. Culture and Self-Induction of Recombinant Strains The recombinant L-proline strains PRO08, PRO09, PRO10, PRO11, PRO12, PRO13, and PRO06 constructed above were streaked onto LB agar plates containing 1.5% agar and 100 μg / mL ampicillin, and incubated at 37°C for 12 h. Single colonies from the plates were picked and inoculated into liquid LB medium containing 100 μg / mL ampicillin, and cultured overnight at 37°C with shaking at 220 rpm. The overnight culture was then inoculated at 1% into self-induction medium ZYM and shaken at 200 rpm and 30°C for 16 h to obtain the induced PRO06 and PRO08-PRO13 strains, respectively.

[0038] III. Recombinant strains transform L-glutamic acid into L-proline After induction, the bacterial cultures of PRO06, PRO08, PRO09, PRO10, PRO11, PRO12, and PRO13 were centrifuged at 4°C and 8000 rpm for 10 min to collect the bacterial cells. The cells were washed once with 10 mM NaCl solution, and centrifuged again under the same conditions to collect the cells. The washed bacterial cells were resuspended in PBS buffer (pH 7.0) containing 20 g / L glucose and 7.5 g / L glutamate, with a wet cell weight of 45 g / L, to obtain the transformation solutions for PRO06 and PRO08-PRO13, respectively. Each transformation solution was reacted at 30°C and 220 rpm for 24 h, and the transformation solutions were collected to determine the L-proline yield.

[0039] The L-proline yield results for different strains are shown in the attached instructions. Figure 2 As shown, the single-mutant strain PRO08 produced approximately 8.3 g / L of L-proline after 24 h of reaction, a 9.2% increase compared to strain PRO06. The triple-mutant strain PRO13 produced the highest L-proline yield after 24 h, approximately 10.5 g / L, a 38% increase compared to strain PRO06. Furthermore, all six ProB protein mutant strains exhibited higher L-proline production capabilities than the strain containing the original PRO06. These results suggest that appropriate single-point or combined mutations in the ProB protein amino acid sequence can more efficiently catalyze the conversion of L-glutamic acid to L-proline, significantly promoting the accumulation of the target product.

[0040] Example 3 This embodiment provides a high-density culture of recombinant strains for the production of L-proline. I. High-density culture of recombinant strain PRO08 to produce L-proline 1.2 mL of PRO08 bacterial culture was taken from a preservation tube stored at 80℃ and inoculated into 120 mL of liquid LB medium containing 100 μg / mL ampicillin. The culture was incubated at 37℃ with shaking for 8 h at 220 rpm. The culture was then inoculated at a 2% (v / v) inoculation rate into a 10 L fermenter containing 6 L of basal medium. The fermentation temperature was maintained at 37℃, and the pH was maintained at approximately 7.0 by adding ammonia. The aeration ratio was 0.8-1 vvm, and the rotation speed was correlated with dissolved oxygen levels, maintaining dissolved oxygen at no less than 20%. After 12 h of fermentation, fed-batch medium was added to maintain the glucose concentration in the fermentation broth. The OD was then cultured. 600 When the concentration reaches about 50%, arabinose is added to a final concentration of 0.2% for induction. Biomass and L-proline production in the tank are measured at intervals. The fermentation cycle is 62 hours. For the fermentation process curve of the 10 L fermenter, please refer to the instruction manual appendix. Figure 3 OD of cells after 12 hours of fermentation 600 The value reached 18.6, and with the addition of glucose, the bacterial concentration in the fermentation broth steadily increased, and the OD of the bacterial cells at 18 h increased. 600 When the pH value reached 51.7, arabinose was added to initiate induction, and the cells began to synthesize L-proline in large quantities. After 62 hours of fermentation, a total of 261.3 g / L of glucose was consumed, and the L-proline yield reached 86.2 g / L. The glucose molar conversion rate was 0.33 g / g (0.515 mol / mol), and the cell density OD... 600 The concentration of L-proline was 75.3, the cell dry weight was approximately 26.4 g / L, and the L-proline yield per cell reached 3.26 g / g DCW; while the control strain PRO07, fermented under the same conditions for 62 h, only produced 7.2 g / L of L-proline.

[0041] II. High-density culture of recombinant strain PRO13 to produce L-proline The recombinant strain PRO13 was cultured in a 10 L fermenter according to the above-described culture method. See the fermentation process curves below. Figure 4 The recombinant strain PRO13 consumed 244.6 g / L of glucose and produced 119.8 g / L of L-proline during fermentation for 62 h. The glucose molar conversion rate was 0.49 g / g (0.76 mol / mol), and the cell density OD was [not specified]. 600 The concentration was 59.1, the cell dry weight was approximately 20.7 g / L, and the L-proline yield per cell reached 5.79 g / g DCW.

[0042] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention specification, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. A method for constructing recombinant bacteria for producing L-proline, characterized in that: The encoding genes of γ-glutamyl kinase ProB and glutamate-5-semialdehyde dehydrogenase ProA were introduced into recipient bacteria via a recombinant vector to obtain a recombinant strain that produces L-proline. The γ-glutamyl kinase ProB gene encodes a protein with the amino acid sequence of SEQ ID No. 1 or a derived protein with γ-glutamyl kinase activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No.

1. The glutamate-5-semialdehyde dehydrogenase ProA gene encodes a protein with the amino acid sequence of SEQ ID No. 2 or a derivative protein with glutamate-5-semialdehyde dehydrogenase activity obtained by substituting and / or deleting and / or adding one or more amino acid residues from the amino acid sequence shown in SEQ ID No.

2. The recipient bacteria are mutant Escherichia coli or wild-type Escherichia coli.

2. The method for constructing a recombinant L-proline-producing bacterium as described in claim 1, characterized in that: The mutant Escherichia coli is a mutant of wild-type Escherichia coli obtained by modifying the d1 gene as follows: d1. Knock out L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase PutA; The L-proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase PutA gene encodes a protein with the amino acid sequence SEQ ID No.

3.

3. The method for constructing a recombinant L-proline-producing bacterium as described in claim 2, characterized in that, The mutant Escherichia coli is a mutant of wild-type Escherichia coli obtained by performing any one of the following gene modifications (d2, d3, d4, d5, d6, and d7) or a combination of gene modifications: d2. Replace the NADPH-dependent glutamate dehydrogenase GdhA gene with the NADH-dependent glutamate dehydrogenase RocG gene. d3. Replace the soluble pyridine nucleotide transhydrogenase SthA gene with the pyridine nucleotide transhydrogenase PntAB gene. d4. Replace the PtsG gene of glucose transporter in the PTS transport system with the Glk gene of glucokinase; d5. Replace the GalR gene, a regulator of galactose transport and metabolism, with the Glf gene, a glucose promoter. d6. Replace the outer membrane protease OmpT gene with the phosphoenolpyruvate carboxylase Ppc gene; d7. Knock out isocitrate lyase AceA; The NADH-dependent glutamate dehydrogenase RocG gene encodes a protein with the amino acid sequence SEQ ID No. 5; the pyridine nucleotide transhydrogenase PntAB gene encodes a protein with the amino acid sequences SEQ ID No. 7 and SEQ ID No. 8; the glucokinase Glk gene encodes a protein with the amino acid sequence SEQ ID No. 10; the glucose promoter Glf gene encodes a protein with the amino acid sequence SEQ ID No. 12; the phosphoenolpyruvate carboxylase Ppc gene encodes a protein with the amino acid sequence SEQ ID No. 14; and the isocitrate lyase AceA gene encodes a protein with the amino acid sequence SEQ ID No.

15.

4. The method for constructing a recombinant L-proline-producing bacterium as described in claim 1, characterized in that: The promoter for initiating transcription of the coding genes of γ-glutamyl kinase and its mutants and glutamate-5-semialdehyde dehydrogenase and its mutants in the recombinant vector is the arabinose (ara) promoter, and the terminator for terminating transcription of the coding genes of γ-glutamyl kinase and its mutants and glutamate-5-semialdehyde dehydrogenase and its mutants is the rrnB terminator.

5. The method for constructing a recombinant L-proline-producing bacterium as described in claim 1, characterized in that: The recombinant vector is obtained by replacing the fragment between the XhoI and BglⅡ recognition sites of the vector pBAD / hisB with the DNA molecule of SEQ ID No. 16, and replacing the fragment between the PstI and KpnI recognition sites of the vector pBAD / hisB with the DNA molecule of SEQ ID No.

17.

6. A recombinant bacterium constructed according to the method for constructing L-proline recombinant bacteria according to claim 1.

7. The application of the recombinant bacteria as described in claim 6 in the production of L-proline.

Images